PanelApp (test)

Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Mendeliome v0.9131 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Mendeliome v0.9131 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Mendeliome v0.9130 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to
Mendeliome v0.9129 LPIN2 Zornitza Stark Mode of inheritance for gene: LPIN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9128 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.96 LPIN2 Zornitza Stark Marked gene: LPIN2 as ready
Red cell disorders v0.96 LPIN2 Zornitza Stark Gene: lpin2 has been classified as Green List (High Evidence).
Red cell disorders v0.96 LPIN2 Zornitza Stark Phenotypes for gene: LPIN2 were changed from Congenital dyserythropoietic anemia; Microcytic anemia; Majeed syndrome, 609628; 609628 Microcytic anemia; CDA; Majeed syndrome; 609628 Majeed syndrome to Majeed syndrome, MIM# 609628; Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia
Red cell disorders v0.95 LPIN2 Zornitza Stark Publications for gene: LPIN2 were set to 17330256; 15994876
Red cell disorders v0.94 LPIN2 Zornitza Stark reviewed gene: LPIN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15994876, 33993107, 33670882, 33314777, 31727123; Phenotypes: Majeed syndrome, MIM# 609628, Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark Marked gene: KCNQ1 as ready
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark Gene: kcnq1 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.206 KCNQ1 Zornitza Stark gene: KCNQ1 was added
gene: KCNQ1 was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: KCNQ1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNQ1 were set to 27539165
Phenotypes for gene: KCNQ1 were set to Long QT syndrome 1, 192500
Review for gene: KCNQ1 was set to RED
Added comment: Can present antenatally with bradycardia, but no specific mention of hydrops.
Sources: Expert Review
Hydrops fetalis v0.205 KCNH2 Zornitza Stark Marked gene: KCNH2 as ready
Hydrops fetalis v0.205 KCNH2 Zornitza Stark Gene: kcnh2 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.205 KCNH2 Zornitza Stark gene: KCNH2 was added
gene: KCNH2 was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KCNH2 were set to 27492745
Phenotypes for gene: KCNH2 were set to long QT syndrome
Review for gene: KCNH2 was set to RED
Added comment: Single case report identified of presentation with hydrops.
Sources: Expert Review
Hydrops fetalis v0.204 SCN5A Zornitza Stark Marked gene: SCN5A as ready
Hydrops fetalis v0.204 SCN5A Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence).
Hydrops fetalis v0.204 SCN5A Zornitza Stark Classified gene: SCN5A as Green List (high evidence)
Hydrops fetalis v0.204 SCN5A Zornitza Stark Gene: scn5a has been classified as Green List (High Evidence).
Hydrops fetalis v0.203 SCN5A Zornitza Stark gene: SCN5A was added
gene: SCN5A was added to Hydrops fetalis. Sources: Expert Review
Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SCN5A were set to 22064211; 15184283; 19419784
Phenotypes for gene: SCN5A were set to Long QT syndrome 3 (MIM#603830)
Review for gene: SCN5A was set to GREEN
Added comment: Three families reported with severe perinatal presentation, including hydrops.
Sources: Expert Review
Repeat Disorders v0.147 OPDM1 Zornitza Stark Tag adult-onset tag was added to STR: OPDM1.
Repeat Disorders v0.147 NIID Zornitza Stark Tag adult-onset tag was added to STR: NIID.
Repeat Disorders v0.147 Zornitza Stark Panel types changed to Australian Genomics; Royal Melbourne Hospital; Rare Disease
Repeat Disorders v0.146 VACTERLX Zornitza Stark Tag paediatric-onset tag was added to STR: VACTERLX.
Repeat Disorders v0.146 OPML1 Zornitza Stark Tag adult-onset tag was added to STR: OPML1.
Repeat Disorders v0.146 NIPA1 Zornitza Stark Marked STR: NIPA1 as ready
Repeat Disorders v0.146 NIPA1 Zornitza Stark Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 NIPA1 Zornitza Stark Tag adult-onset tag was added to STR: NIPA1.
Repeat Disorders v0.146 FRAXF Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXF.
Repeat Disorders v0.146 FRA7A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA7A.
Repeat Disorders v0.146 FRA11B Zornitza Stark Marked STR: FRA11B as ready
Repeat Disorders v0.146 FRA11B Zornitza Stark Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.146 FRA11B Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11B.
Repeat Disorders v0.146 FRA11A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA11A.
Repeat Disorders v0.146 FAME7 Zornitza Stark Tag adult-onset tag was added to STR: FAME7.
Repeat Disorders v0.146 FAME6 Zornitza Stark Tag adult-onset tag was added to STR: FAME6.
Repeat Disorders v0.146 FAME4 Zornitza Stark Tag adult-onset tag was added to STR: FAME4.
Repeat Disorders v0.146 DMD Zornitza Stark Tag adult-onset tag was added to STR: DMD.
Tag paediatric-onset tag was added to STR: DMD.
Repeat Disorders v0.146 FRA2A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA2A.
Repeat Disorders v0.146 FRA12A Zornitza Stark Tag paediatric-onset tag was added to STR: FRA12A.
Repeat Disorders v0.146 CCD Zornitza Stark Marked STR: CCD as ready
Repeat Disorders v0.146 CCD Zornitza Stark Str: ccd has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CCD Zornitza Stark Tag paediatric-onset tag was added to STR: CCD.
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Marked STR: CANVAS_ACAGG as ready
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.146 CANVAS_ACAGG Zornitza Stark Tag adult-onset tag was added to STR: CANVAS_ACAGG.
Repeat Disorders v0.146 XDP Zornitza Stark Tag adult-onset tag was added to STR: XDP.
Repeat Disorders v0.146 TOF Zornitza Stark Tag paediatric-onset tag was added to STR: TOF.
Repeat Disorders v0.146 SPD1 Zornitza Stark Tag paediatric-onset tag was added to STR: SPD1.
Repeat Disorders v0.146 SCA8 Zornitza Stark Tag adult-onset tag was added to STR: SCA8.
Repeat Disorders v0.146 SCA7 Zornitza Stark Tag adult-onset tag was added to STR: SCA7.
Repeat Disorders v0.146 SCA6 Zornitza Stark Tag adult-onset tag was added to STR: SCA6.
Repeat Disorders v0.146 SCA37 Zornitza Stark Tag adult-onset tag was added to STR: SCA37.
Repeat Disorders v0.146 SCA36 Zornitza Stark Tag adult-onset tag was added to STR: SCA36.
Repeat Disorders v0.146 SCA31 Zornitza Stark Tag adult-onset tag was added to STR: SCA31.
Repeat Disorders v0.146 SCA3 Zornitza Stark Tag adult-onset tag was added to STR: SCA3.
Tag paediatric-onset tag was added to STR: SCA3.
Repeat Disorders v0.146 SCA2 Zornitza Stark Tag adult-onset tag was added to STR: SCA2.
Tag paediatric-onset tag was added to STR: SCA2.
Repeat Disorders v0.146 SCA17 Zornitza Stark Tag adult-onset tag was added to STR: SCA17.
Tag paediatric-onset tag was added to STR: SCA17.
Repeat Disorders v0.146 SCA12 Zornitza Stark Tag adult-onset tag was added to STR: SCA12.
Tag paediatric-onset tag was added to STR: SCA12.
Repeat Disorders v0.146 SCA10 Zornitza Stark Tag adult-onset tag was added to STR: SCA10.
Mendeliome v0.9128 FOXE3 Zornitza Stark Marked gene: FOXE3 as ready
Mendeliome v0.9128 FOXE3 Zornitza Stark Gene: foxe3 has been classified as Green List (High Evidence).
Mendeliome v0.9128 FOXE3 Zornitza Stark Phenotypes for gene: FOXE3 were changed from to Anterior segment dysgenesis 2, multiple subtypes, MIM#610256; Cataract 34, multiple types, MIM#612968; Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349
Mendeliome v0.9127 FOXE3 Zornitza Stark Publications for gene: FOXE3 were set to
Mendeliome v0.9126 FOXE3 Zornitza Stark Mode of inheritance for gene: FOXE3 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9125 FOXE3 Eleanor Williams reviewed gene: FOXE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26854927, 27218149, 16826526, 19708017, 20140963, 20664696, 20361012, 24019743, 27669367, 29878917, 32436650, 34046667, 11159941, 19708017, 20806047, 21150893, 11980846, 34046667; Phenotypes: Anterior segment dysgenesis 2, multiple subtypes, MIM#610256, Cataract 34, multiple types, MIM#612968, Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.9125 SLC26A1 Zornitza Stark Phenotypes for gene: SLC26A1 were changed from to Nephrolithiasis, calcium oxalate, MIM#167030
Mendeliome v0.9124 SLC26A1 Zornitza Stark Publications for gene: SLC26A1 were set to
Mendeliome v0.9123 SLC26A1 Zornitza Stark Mode of inheritance for gene: SLC26A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9122 SLC26A1 Zornitza Stark Classified gene: SLC26A1 as Amber List (moderate evidence)
Mendeliome v0.9122 SLC26A1 Zornitza Stark Gene: slc26a1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9121 SLC26A1 Zornitza Stark reviewed gene: SLC26A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27210743, 20160351, 30383413, 27125215; Phenotypes: Nephrolithiasis, calcium oxalate, MIM#167030; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9121 RHAG Zornitza Stark Marked gene: RHAG as ready
Mendeliome v0.9121 RHAG Zornitza Stark Gene: rhag has been classified as Green List (High Evidence).
Mendeliome v0.9121 RHAG Zornitza Stark Phenotypes for gene: RHAG were changed from to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000
Mendeliome v0.9120 RHAG Zornitza Stark Publications for gene: RHAG were set to
Mendeliome v0.9119 RHAG Zornitza Stark Mode of inheritance for gene: RHAG was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9118 SPTA1 Zornitza Stark Marked gene: SPTA1 as ready
Mendeliome v0.9118 SPTA1 Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence).
Mendeliome v0.9118 SPTA1 Zornitza Stark Phenotypes for gene: SPTA1 were changed from to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970
Mendeliome v0.9117 SPTA1 Zornitza Stark Publications for gene: SPTA1 were set to
Mendeliome v0.9116 SPTA1 Zornitza Stark Mode of inheritance for gene: SPTA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9115 SPTA1 Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.94 RHAG Zornitza Stark Marked gene: RHAG as ready
Red cell disorders v0.94 RHAG Zornitza Stark Gene: rhag has been classified as Green List (High Evidence).
Red cell disorders v0.94 RHAG Zornitza Stark Phenotypes for gene: RHAG were changed from Stomatocytosis; Anemia, hemolytic, Rh-null, regulator type (BIALLELIC, autosomal or pseudoautosomal), 268150; 185000 Overhydrated hereditary stomatocytosis; Overhydrated hereditary stomatocytosis (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 185000; 268150 Anemia, hemolytic, Rh-null, regulator type to Anaemia, haemolytic, Rh-null, regulator type MIM# 268150; Overhydrated hereditary stomatocytosis MIM#185000
Red cell disorders v0.93 RHAG Zornitza Stark Publications for gene: RHAG were set to 18931342
Red cell disorders v0.92 SLC11A2 Zornitza Stark Marked gene: SLC11A2 as ready
Red cell disorders v0.92 SLC11A2 Zornitza Stark Gene: slc11a2 has been classified as Green List (High Evidence).
Red cell disorders v0.92 SLC11A2 Zornitza Stark Phenotypes for gene: SLC11A2 were changed from 206100 Anemia, hypochromic microcytic, with iron overload 1; Anemia, hypochromic microcytic, with iron overload 1, 206100 to Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100
Red cell disorders v0.91 SLC11A2 Zornitza Stark Publications for gene: SLC11A2 were set to 16160008; 16439678; 15459009
Red cell disorders v0.90 SLC2A1 Zornitza Stark Marked gene: SLC2A1 as ready
Red cell disorders v0.90 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Red cell disorders v0.90 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from Stomatocytosis; 612126 GLUT1 deficiency without epilepsy and/or hemolytic anemia; 608885 Stomatin-deficient cryohydrocytosis with neurologic defects; Pyridoxine-refractory sideroblastic anemia to Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885; delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia; haemolytic anaemia
Red cell disorders v0.89 SLC2A1 Zornitza Stark Publications for gene: SLC2A1 were set to 22492876; 21791420
Mendeliome v0.9115 SPTB Zornitza Stark Marked gene: SPTB as ready
Mendeliome v0.9115 SPTB Zornitza Stark Gene: sptb has been classified as Green List (High Evidence).
Red cell disorders v0.88 SPTA1 Zornitza Stark Marked gene: SPTA1 as ready
Red cell disorders v0.88 SPTA1 Zornitza Stark Gene: spta1 has been classified as Green List (High Evidence).
Red cell disorders v0.88 SPTA1 Zornitza Stark Phenotypes for gene: SPTA1 were changed from 270970 Spherocytosis, type 3; 266140 Pyropoikilocytosis; RBC membrane abnormality; Pyropoikilocytosis (BIALLELIC, autosomal or pseudoautosomal), 266140; 266140 Pyropoikilocytosis, 270970 Spherocytosis, type 3; Spherocytosis, type 3 (BIALLELIC, autosomal or pseudoautosomal), 270970; 130600 Elliptocytosis-2; Elliptocytosis-2 (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 130600 to Elliptocytosis-2 MIM# 130600; Pyropoikilocytosis MIM# 266140; Spherocytosis, type 3 MIM# 270970
Red cell disorders v0.87 SPTA1 Zornitza Stark Publications for gene: SPTA1 were set to 1679439; 3940543; 4077050
Mendeliome v0.9115 SPTB Zornitza Stark Phenotypes for gene: SPTB were changed from to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948
Mendeliome v0.9114 SPTB Zornitza Stark Publications for gene: SPTB were set to
Mendeliome v0.9113 SPTB Zornitza Stark Mode of inheritance for gene: SPTB was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.86 SPTB Zornitza Stark Marked gene: SPTB as ready
Red cell disorders v0.86 SPTB Zornitza Stark Gene: sptb has been classified as Green List (High Evidence).
Red cell disorders v0.86 SPTB Zornitza Stark Phenotypes for gene: SPTB were changed from 617948 Elliptocytosis-3; Spherocytosis,616649; Anemia, neonatal hemolytic, fatal and near-fatal; RBC membrane abnormality; 616649 Spherocytosis, type 2; 616649 Anemia, neonatal hemolytic, fatal and near-fatal; Elliptocytosis to Spherocytosis, type 2 MIM# 616649; Elliptocytosis-3 MIM# 617948; Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948
Red cell disorders v0.85 SPTB Zornitza Stark Publications for gene: SPTB were set to 8226774; 3276733
Red cell disorders v0.84 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Red cell disorders v0.84 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Red cell disorders v0.84 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from megaloblastic bone marrow; neutropenia; thrombocytopenia; 275350 Transcobalamin II deficiency; Agammaglobulinemia; pancytopenia; neutropenic colitis; failure to thrive; Transcobalamin II deficiency; can have a presentation similar to severe combined immunodeficiency; hypotonia, myoclonic like movements, pallor, purpura, anaemia, thrombocytopenia, megaloblastosis, aplastic bone marrow to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; Reticulocytopaenia; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection; if untreated (B12) for prolonged periods results in intellectual disability
Red cell disorders v0.83 TCN2 Zornitza Stark Publications for gene: TCN2 were set to 10518276; 7849710
Mendeliome v0.9112 TF Zornitza Stark Marked gene: TF as ready
Mendeliome v0.9112 TF Zornitza Stark Gene: tf has been classified as Green List (High Evidence).
Mendeliome v0.9112 TF Zornitza Stark Phenotypes for gene: TF were changed from to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure
Mendeliome v0.9111 TF Zornitza Stark Publications for gene: TF were set to
Mendeliome v0.9110 TF Zornitza Stark Mode of inheritance for gene: TF was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.82 TF Zornitza Stark Marked gene: TF as ready
Red cell disorders v0.82 TF Zornitza Stark Gene: tf has been classified as Green List (High Evidence).
Red cell disorders v0.82 TF Zornitza Stark Phenotypes for gene: TF were changed from Congenital hypotransferrinemia; Atransferrinemia, 209300; 209300 Congenital hypotransferrinemia to Atransferrinaemia MIM# 209300; iron overload; hypochromic anaemia; low serum transferrin; Hemosiderosis of the heart and/or liver; Congestive heart failure
Mendeliome v0.9109 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9109 RHAG Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9109 SPTB Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9109 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.81 RHAG Danielle Ariti reviewed gene: RHAG: Rating: GREEN; Mode of pathogenicity: None; Publications: 30990901, 28470789, 4962358, 18931342, 21849667, 23406318; Phenotypes: Anaemia, haemolytic, Rh-null, regulator type MIM# 268150, Overhydrated hereditary stomatocytosis MIM#185000; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.81 SLC11A2 Danielle Ariti reviewed gene: SLC11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 21871825, 15459009; Phenotypes: Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.81 SLC2A1 Danielle Ariti reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27353637; Phenotypes: Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885, delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia, haemolytic anaemia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.81 HBD Zornitza Stark Marked gene: HBD as ready
Red cell disorders v0.81 HBD Zornitza Stark Gene: hbd has been classified as Green List (High Evidence).
Red cell disorders v0.81 HBD Zornitza Stark Phenotypes for gene: HBD were changed from Thalassemia due to Hb Lepore; Thalassemia,delta; Thalassemiadue to HbLepore; 141749 Delta-beta thalassaemia, thalassaemia due to Hb Lepore; Thalassemia, delta to Thalassaemia, delta-; Thalassaemia due to Hb Lepore
Red cell disorders v0.80 HBD Zornitza Stark reviewed gene: HBD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassaemia, delta-, Thalassaemia due to Hb Lepore; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Red cell disorders v0.80 HBB Zornitza Stark Marked gene: HBB as ready
Red cell disorders v0.80 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Red cell disorders v0.80 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Sickle cell anemia (BIALLELIC, autosomal or pseudoautosomal),603903; 613985 Thalassemia, beta; Erythremias, beta-; 603902 Thalassemia-beta, dominant inclusion-body; Thalassemias, beta-,(BIALLELIC, autosomal or pseudoautosomal), 613985; Hereditary persistence of fetal hemoglobin,(MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown),141749; 603902 Dominand inclusion body beta thalassaemia; 603903 Sickle cell disease; 141749 Delta-beta thalassaemia; Heinz body anemias, beta- (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 140700; Globin Disorder; Thalassemia-beta, dominant inclusion-body, 603902; Delta-beta thalassemia (MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown), 141749; 613985 Beta thalassaemia; Methemoglobinemias, beta- to Thalassemia, beta, MIM# 613985; Sickle cell anaemia, MIM# 603903; Methaemoglobinaemia, beta type, MIM# 617971; Hereditary persistence of fetal haemoglobin, MIM# 141749; Heinz body anaemia, MIM# 140700; Erythrocytosis 6, MIM# 617980
Red cell disorders v0.79 HBB Zornitza Stark reviewed gene: HBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, beta, MIM# 613985, Sickle cell anaemia, MIM# 603903, Methaemoglobinaemia, beta type, MIM# 617971, Hereditary persistence of fetal haemoglobin, MIM# 141749, Heinz body anaemia, MIM# 140700, Erythrocytosis 6, MIM# 617980; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.79 HBA2 Zornitza Stark Marked gene: HBA2 as ready
Red cell disorders v0.79 HBA2 Zornitza Stark Gene: hba2 has been classified as Green List (High Evidence).
Red cell disorders v0.79 HBA2 Zornitza Stark Phenotypes for gene: HBA2 were changed from Hypochromic microcytic anemia; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Erythrocytosis; 60413 Thalassemia, alpha; Heinz body anemia,140700; Thalassemia, alpha-, 604131 to Thalassemia, alpha-, MIM# 604131; Heinz body anaemia, MIM# 140700; Erythrocytosis 7, MIM# 617981
Red cell disorders v0.78 HBA2 Zornitza Stark reviewed gene: HBA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemia, alpha-, MIM# 604131, Heinz body anaemia, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.78 HBA1 Zornitza Stark Marked gene: HBA1 as ready
Red cell disorders v0.78 HBA1 Zornitza Stark Gene: hba1 has been classified as Green List (High Evidence).
Red cell disorders v0.78 HBA1 Zornitza Stark Phenotypes for gene: HBA1 were changed from Thalassemias, alpha-, 604131; 604131 Thalassemias, alpha; Erythremias, alpha-; Heinz body anemias, alpha-, 140700; Hemoglobin H disease, nondeletional, 613978; Globin Disorder; 604131 Alpha thalassaemia; Methemoglobinemias, alpha- to Thalassemias, alpha-, MIM# 604131; Heinz body anemias, alpha-, MIM# 140700; Erythrocytosis 7, MIM# 617981
Red cell disorders v0.77 HBA1 Zornitza Stark reviewed gene: HBA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thalassemias, alpha-, MIM# 604131, Heinz body anemias, alpha-, MIM# 140700, Erythrocytosis 7, MIM# 617981; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.77 GSS Zornitza Stark Marked gene: GSS as ready
Red cell disorders v0.77 GSS Zornitza Stark Gene: gss has been classified as Green List (High Evidence).
Red cell disorders v0.77 GSS Zornitza Stark Phenotypes for gene: GSS were changed from 231900 Enzyme Disorder; Hemolytic anemia due to glutathione synthetase deficiency, 231900; 266130 Glutathione synthetase deficiency; Enzyme Disorder; Glutathione synthetase deficiency, 266130; Hemolytic anemia due to glutathione synthetase deficiency to Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900
Red cell disorders v0.76 GSS Zornitza Stark Publications for gene: GSS were set to 8896573
Red cell disorders v0.75 GSS Zornitza Stark reviewed gene: GSS: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896573, 31198081, 29395598, 29340523, 28267090; Phenotypes: Haemolytic anaemia due to glutathione synthetase deficiency, MIM# 231900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.195 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; deafness; ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; deafness; ovarian insufficiency
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.194 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Deafness_IsolatedAndComplex v1.92 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Deafness_IsolatedAndComplex v1.91 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Muscular dystrophy and myopathy_Paediatric v0.93 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Muscular dystrophy and myopathy_Paediatric v0.92 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Mendeliome v0.9109 GGPS1 Zornitza Stark Phenotypes for gene: GGPS1 were changed from Muscular dystrophy; Deafness; Ovarian insufficiency to Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518; Muscular dystrophy; Deafness; Ovarian insufficiency
Mendeliome v0.9108 GGPS1 Zornitza Stark edited their review of gene: GGPS1: Changed phenotypes: Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518, Muscular dystrophy, Deafness, Ovarian insufficiency
Red cell disorders v0.75 SPTA1 Danielle Ariti reviewed gene: SPTA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9075575, 8018926, 29484404, 27667160, 31333484, 8941647, 3785322; Phenotypes: Elliptocytosis-2 MIM# 130600, Pyropoikilocytosis MIM# 266140, Spherocytosis, type 3 MIM# 270970; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.75 SPTB Danielle Ariti reviewed gene: SPTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19538529, 8102379, 9075575, 7883966, 9005995, 32256302; Phenotypes: Spherocytosis, type 2 MIM# 616649, Elliptocytosis-3 MIM# 617948, Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.75 TCN2 Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, Reticulocytopaenia, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection, if untreated (B12) for prolonged periods results in intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.75 TF Danielle Ariti reviewed gene: TF: Rating: GREEN; Mode of pathogenicity: None; Publications: 11110675, 3472216; Phenotypes: Atransferrinaemia MIM# 209300, iron overload, hypochromic anaemia, low serum transferrin, Hemosiderosis of the heart and/or liver, Congestive heart failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.146 SCA1 Zornitza Stark Tag adult-onset tag was added to STR: SCA1.
Repeat Disorders v0.146 SBMA Zornitza Stark Tag adult-onset tag was added to STR: SBMA.
Repeat Disorders v0.146 RCPS Zornitza Stark Tag paediatric-onset tag was added to STR: RCPS.
Repeat Disorders v0.146 CCHS Zornitza Stark Marked STR: CCHS as ready
Repeat Disorders v0.146 CCHS Zornitza Stark Str: cchs has been classified as Green List (High Evidence).
Mendeliome v0.9108 GSR Zornitza Stark Marked gene: GSR as ready
Mendeliome v0.9108 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9108 GSR Zornitza Stark Phenotypes for gene: GSR were changed from to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660
Mendeliome v0.9107 GSR Zornitza Stark Publications for gene: GSR were set to
Mendeliome v0.9106 GSR Zornitza Stark Mode of inheritance for gene: GSR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9105 GSR Zornitza Stark Classified gene: GSR as Amber List (moderate evidence)
Mendeliome v0.9105 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9104 GSR Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.75 GSR Zornitza Stark Marked gene: GSR as ready
Red cell disorders v0.75 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.75 GSR Zornitza Stark Phenotypes for gene: GSR were changed from Hemolytic anemia due to glutathione reductase deficiency; Enzyme Disorder; NA Enzyme Disorder to Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660
Red cell disorders v0.74 GSR Zornitza Stark Publications for gene: GSR were set to 8533822
Red cell disorders v0.73 GSR Zornitza Stark Classified gene: GSR as Amber List (moderate evidence)
Red cell disorders v0.73 GSR Zornitza Stark Gene: gsr has been classified as Amber List (Moderate Evidence).
Red cell disorders v0.72 GSR Zornitza Stark reviewed gene: GSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 17185460, 31122244; Phenotypes: Haemolytic anaemia due to glutathione reductase deficiency, MIM# 618660; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.146 Bryony Thompson Panel status changed from internal to public
Arthrogryposis v0.294 MAGEL2 Zornitza Stark Publications for gene: MAGEL2 were set to 24076603; 27195816; 26365340
Arthrogryposis v0.293 MAGEL2 Zornitza Stark Mode of inheritance for gene: MAGEL2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9104 MKRN3 Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405 33214675 31041429 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Imprinting disorders v0.3 MKRN3 Anna Le Fevre reviewed gene: MKRN3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32480405, 33214675, 31041429, 32407292; Phenotypes: Central Precocious Puberty; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9104 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33820833, 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Arthrogryposis v0.292 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26365340, 33820833, 34128869; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome, Arthrogryposis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Repeat Disorders v0.145 OPMD Zornitza Stark Tag adult-onset tag was added to STR: OPMD.
Repeat Disorders v0.145 OPDM2 Zornitza Stark Tag adult-onset tag was added to STR: OPDM2.
Repeat Disorders v0.145 MEDPSACH Zornitza Stark Tag paediatric-onset tag was added to STR: MEDPSACH.
Repeat Disorders v0.145 HSAN8 Zornitza Stark Tag paediatric-onset tag was added to STR: HSAN8.
Repeat Disorders v0.145 FRA2A Bryony Thompson Marked STR: FRA2A as ready
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.145 FRA2A Bryony Thompson Classified STR: FRA2A as Amber List (moderate evidence)
Repeat Disorders v0.145 FRA2A Bryony Thompson Str: fra2a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.144 FRA2A Bryony Thompson STR: FRA2A was added
STR: FRA2A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA2A were set to 24763282
Phenotypes for STR: FRA2A were set to Neurodevelopmental delay
Review for STR: FRA2A was set to AMBER
Added comment: Three families with a wide spectrum of neurodevelopmental phenotypes with expression of folate-sensitive fragile site FRA2A. The CGG repeat is in an alternative promoter for AFF3, active in the brain. Expansion of >300 repeats causes expression of FRA2A and is associated with hypermethylation and silencing of AFF3 in at least one individual. There were 3-20 repeats in normal controls.
Sources: Literature
Red cell disorders v0.72 GPI Zornitza Stark Marked gene: GPI as ready
Red cell disorders v0.72 GPI Zornitza Stark Gene: gpi has been classified as Green List (High Evidence).
Red cell disorders v0.72 GPI Zornitza Stark Phenotypes for gene: GPI were changed from 613470 Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency; Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency, 613470 to Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470
Red cell disorders v0.71 GPI Zornitza Stark Publications for gene: GPI were set to 411100
Red cell disorders v0.70 GPI Zornitza Stark reviewed gene: GPI: Rating: GREEN; Mode of pathogenicity: None; Publications: 8499925, 9856489, 32103498; Phenotypes: Haemolytic anaemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Marked gene: UMPS as ready
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4109 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria MIM# 258900
Intellectual disability syndromic and non-syndromic v0.4108 UMPS Zornitza Stark Publications for gene: UMPS were set to
Intellectual disability syndromic and non-syndromic v0.4107 UMPS Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4106 UMPS Zornitza Stark reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9104 UMPS Zornitza Stark Marked gene: UMPS as ready
Mendeliome v0.9104 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Mendeliome v0.9104 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from to Orotic aciduria, MIM# 258900
Mendeliome v0.9103 UMPS Zornitza Stark Publications for gene: UMPS were set to
Mendeliome v0.9102 UMPS Zornitza Stark Mode of inheritance for gene: UMPS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9101 UMPS Zornitza Stark edited their review of gene: UMPS: Added comment: 20 unrelated patients have been reported with biallelic missense variants; one mouse model

Orotic aciduria is characterised by megaloblastic anaemia and orotic acid crystalluria, frequently associated with a degree of physical and intellectual disability. Other features include, congenital malformations (Atrial/ Ventricular septal defect) and immunodeficiencies (T-cell dysfunction, failure to thrive, recurrent infections).

Haematology features
- Megaloblastic anaemia
- Low to normal reticulocyte count
- Anisocytosis
- Poikilocytosis
- Hypochromia; Changed publications: 9042911, 33489760; Changed phenotypes: Orotic aciduria, MIM# 258900
Red cell disorders v0.70 UMPS Zornitza Stark Marked gene: UMPS as ready
Red cell disorders v0.70 UMPS Zornitza Stark Gene: umps has been classified as Green List (High Evidence).
Red cell disorders v0.70 UMPS Zornitza Stark Phenotypes for gene: UMPS were changed from 258900 Orotic aciduria with megaloblastic anaemia to Orotic aciduria MIM# 258900; megaloblastic anaemia; orotic acid crystalluria; ID; immunodeficiencies
Red cell disorders v0.69 UMPS Zornitza Stark Publications for gene: UMPS were set to 9042911
Imprinting disorders v0.3 MAGEL2 Anna Le Fevre gene: MAGEL2 was added
gene: MAGEL2 was added to Imprinting disorders. Sources: Literature
Mode of inheritance for gene: MAGEL2 was set to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Publications for gene: MAGEL2 were set to 24076603; 31397880; 29599419; 30302899
Phenotypes for gene: MAGEL2 were set to Schaaf-Yang syndrome; Chitayat-Hall Syndrome
Review for gene: MAGEL2 was set to GREEN
Added comment: MAGEL2 is a single-exon gene.
Frameshift mutations may not cause nonsense-mediated decay, but instead a variety of truncated or elongated protein products.
The pathogenicity of haploinsufficiency of the paternal allele is uncertain (ClinGen review 2018). A dominant-negative effect has been suggested. Haploinsufficiency may play a role.
Sources: Literature
Autism v0.167 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24076603, 31397880, 29599419, 30302899; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Marked gene: TMPRSS6 as ready
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence).
Mendeliome v0.9101 TMPRSS6 Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia
Mendeliome v0.9100 TMPRSS6 Zornitza Stark Publications for gene: TMPRSS6 were set to
Mendeliome v0.9099 TMPRSS6 Zornitza Stark Mode of inheritance for gene: TMPRSS6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Marked gene: TMPRSS6 as ready
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Gene: tmprss6 has been classified as Green List (High Evidence).
Red cell disorders v0.68 TMPRSS6 Zornitza Stark Phenotypes for gene: TMPRSS6 were changed from Iron refractoryirondeficiencyanemia,206200; Iron-Refractory Iron Deficiency Anemia; 206200 Iron refractoryirondeficiencyanemia to Iron-refractory iron deficiency anaemia MIM# 206200; Iron malabsorption; hypochromic microcytic anaemia
Red cell disorders v0.67 TMPRSS6 Zornitza Stark Publications for gene: TMPRSS6 were set to 18408718
Mendeliome v0.9098 TPI1 Zornitza Stark changed review comment from: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; to: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital haemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.
Mendeliome v0.9098 TPI1 Zornitza Stark edited their review of gene: TPI1: Added comment: More than 10 unrelated families reported; bi-allelic (missense, nonsense, frameshift) variants; Common p.Glu104Asp variant in Northern European population

Triosephosphate isomerase deficiency (TPID) is an autosomal recessive multisystem disorder characterised by early childhood onset congenital hemolytic anaemia, and progressive neuromuscular dysfunction. Many patients die from respiratory failure in childhood. The neurological features are variable, but usually includes lower motor neuron dysfunction with hypotonia, muscle weakness and atrophy, and hyporeflexia. Other features include intracellular accumulation of dihydroxyacetone phosphate (DHAP), particularly in red blood cells and increased susceptibility to infections.; Changed publications: 9338582, 32873690, 8503454; Changed phenotypes: Haemolytic anaemia due to triosephosphate isomerase deficiency, MIM# 615512
Red cell disorders v0.66 TPI1 Zornitza Stark Marked gene: TPI1 as ready
Red cell disorders v0.66 TPI1 Zornitza Stark Gene: tpi1 has been classified as Green List (High Evidence).
Red cell disorders v0.66 TPI1 Zornitza Stark Phenotypes for gene: TPI1 were changed from 615512 Hemolytic anemia due to triosephosphate isomerase deficiency; Enzyme Disorder; Hemolytic anemia due to triosephosphate isomerase deficiency,615512 to Haemolytic anaemia due to triosephosphate isomerase deficiency MIM# 615512; chronic haemolytic anaemia; neuromuscular dysfunction; intracellular accumulation of dihydroxyacetone phosphate (DHAP)
Red cell disorders v0.65 TPI1 Zornitza Stark Publications for gene: TPI1 were set to 11698297; 9338582
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre Deleted their review
Mitochondrial disease v0.648 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Mitochondrial disease v0.648 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Mitochondrial disease v0.648 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Mitochondrial disease v0.647 YARS2 Zornitza Stark Publications for gene: YARS2 were set to
Mitochondrial disease v0.646 YARS2 Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.645 YARS2 Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9098 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Mendeliome v0.9098 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4106 MAGEL2 Anna Le Fevre reviewed gene: MAGEL2: Rating: ; Mode of pathogenicity: None; Publications: 24076603, 30302899, 31397880; Phenotypes: Schaaf-Yang syndrome, Chitayat-Hall Syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.9098 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Mendeliome v0.9097 YARS2 Zornitza Stark Publications for gene: YARS2 were set to
Mendeliome v0.9096 YARS2 Zornitza Stark Mode of inheritance for gene: YARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 YARS2 Zornitza Stark reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Metal Metabolism Disorders v0.23 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 TMPRSS6 Danielle Ariti reviewed gene: TMPRSS6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18408718, 8596229, 18596229, 19592582; Phenotypes: Iron-refractory iron deficiency anaemia MIM# 206200, Iron malabsorption, hypochromic microcytic anaemia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 TPI1 Danielle Ariti reviewed gene: TPI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9338582, 32873690, 8503454; Phenotypes: Hemolytic anemia due to triosephosphate isomerase deficiency MIM# 615512, chronic hemolytic anaemia, neuromuscular dysfunction, intracellular accumulation of dihydroxyacetone phosphate (DHAP); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.64 GLRX5 Zornitza Stark Marked gene: GLRX5 as ready
Red cell disorders v0.64 GLRX5 Zornitza Stark Gene: glrx5 has been classified as Green List (High Evidence).
Red cell disorders v0.64 GLRX5 Zornitza Stark Phenotypes for gene: GLRX5 were changed from 616860 Pyridoxine refractory sideroblastic anaemia 3; Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive, 205950; 205950 Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive to Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860
Red cell disorders v0.63 GLRX5 Zornitza Stark Publications for gene: GLRX5 were set to 20364084; 25342667; 17485548
Red cell disorders v0.62 GLRX5 Zornitza Stark changed review comment from: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.; to: Sideroblastic anemia-3 is an autosomal recessive hematologic disorder characterized by onset of anaemia in adulthood. Affected individuals show signs of systemic iron overload, and iron chelation therapy may be of clinical benefit. At least three unrelated individuals reported.
Red cell disorders v0.62 GIF Zornitza Stark Marked gene: GIF as ready
Red cell disorders v0.62 GIF Zornitza Stark Gene: gif has been classified as Green List (High Evidence).
Red cell disorders v0.62 GIF Zornitza Stark Phenotypes for gene: GIF were changed from 261000 Intrinsic factor deficiency to Intrinsic factor deficiency, MIM# 261000
Red cell disorders v0.61 GIF Zornitza Stark Publications for gene: GIF were set to 15738392; 14576042
Red cell disorders v0.60 GIF Zornitza Stark reviewed gene: GIF: Rating: GREEN; Mode of pathogenicity: None; Publications: 14695536, 14576042, 15738392; Phenotypes: Intrinsic factor deficiency, MIM# 261000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Regression v0.371 GCLC Zornitza Stark Marked gene: GCLC as ready
Regression v0.371 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Regression v0.371 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Regression v0.370 GCLC Zornitza Stark Publications for gene: GCLC were set to
Regression v0.369 GCLC Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.368 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 28571779, 10515893; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 GCLC Zornitza Stark Marked gene: GCLC as ready
Mendeliome v0.9095 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Red cell disorders v0.60 UMPS Danielle Ariti reviewed gene: UMPS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9042911, 33489760; Phenotypes: Orotic aciduria MIM# 258900, megaloblastic anaemia, orotic acid crystalluria, ID, immunodeficiencies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9095 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450; Disorders of the gamma-glutamyl cycle
Mendeliome v0.9094 GCLC Zornitza Stark Publications for gene: GCLC were set to
Mendeliome v0.9093 GCLC Zornitza Stark Mode of inheritance for gene: GCLC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9092 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.60 GCLC Zornitza Stark Marked gene: GCLC as ready
Red cell disorders v0.60 GCLC Zornitza Stark Gene: gclc has been classified as Green List (High Evidence).
Red cell disorders v0.60 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450 to Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Red cell disorders v0.59 GCLC Zornitza Stark Phenotypes for gene: GCLC were changed from 230450 Glutamate-cysteine ligase deficiency; Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, 230450; Enzyme Disorder; Glutamate-cysteine ligase deficiency; 230450 Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency to Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450
Red cell disorders v0.58 GCLC Zornitza Stark Publications for gene: GCLC were set to 10515893
Red cell disorders v0.57 GCLC Zornitza Stark reviewed gene: GCLC: Rating: GREEN; Mode of pathogenicity: None; Publications: 10515893, 28571779; Phenotypes: Haemolytic anemia due to gamma-glutamylcysteine synthetase deficiency, MIM# 230450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.143 FRA7A Bryony Thompson Marked STR: FRA7A as ready
Repeat Disorders v0.143 FRA7A Bryony Thompson Str: fra7a has been classified as Red List (Low Evidence).
Repeat Disorders v0.143 FRA7A Bryony Thompson STR: FRA7A was added
STR: FRA7A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA7A were set to 25196122
Phenotypes for STR: FRA7A were set to Autism spectrum disorder
Review for STR: FRA7A was set to AMBER
Added comment: A de novo occurrence of the 7p11.2 folate-sensitive fragile site FRA7A in a male with an autistic spectrum disorder (ASD) due to a CGG-repeat expansion mutation (∼450 repeats) in a 5' intron of ZNF713. The expanded allele showed hypermethylation of the adjacent CpG island and reduced ZNF713 expression observed in a proband-derived lymphoblastoid cell line. The probands mother had a pre-mutation with 85 repeats. Controls showed a CGG-repeat range of 5 to 22. In a second family a pre-mutation (66-72) was identified in 3 siblings with ASD and an unaffected father. One of the siblings had mitotic instability.
Sources: Literature
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Marked gene: MAP1B as ready
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Gene: map1b has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Classified gene: MAP1B as Green List (high evidence)
Deafness_IsolatedAndComplex v1.91 MAP1B Zornitza Stark Gene: map1b has been classified as Green List (High Evidence).
Mendeliome v0.9092 PDGFRL Zornitza Stark Marked gene: PDGFRL as ready
Mendeliome v0.9092 PDGFRL Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence).
Mendeliome v0.9092 PDGFRL Zornitza Stark Classified gene: PDGFRL as Red List (low evidence)
Mendeliome v0.9092 PDGFRL Zornitza Stark Gene: pdgfrl has been classified as Red List (Low Evidence).
Red cell disorders v0.57 YARS2 Zornitza Stark Marked gene: YARS2 as ready
Red cell disorders v0.57 YARS2 Zornitza Stark Gene: yars2 has been classified as Green List (High Evidence).
Red cell disorders v0.57 YARS2 Zornitza Stark Phenotypes for gene: YARS2 were changed from 613561 Myopathy, lactic acidosis, and sideroblastic anemia 2; Myopathy, lactic acidosis, and sideroblastic anemia 2, 613561 to Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561; sideroblastic anaemia; muscle atrophy; myopathy; lactic acidosis; Hypertrophic cardiomyopathy; Hepatomegaly; Decreased cytochrome C oxidase activity
Red cell disorders v0.56 YARS2 Zornitza Stark Publications for gene: YARS2 were set to 23918765; 22504945; 20598274
Repeat Disorders v0.142 VACTERLX Bryony Thompson Marked STR: VACTERLX as ready
Repeat Disorders v0.142 VACTERLX Bryony Thompson Str: vacterlx has been classified as Red List (Low Evidence).
Repeat Disorders v0.142 VACTERLX Bryony Thompson STR: VACTERLX was added
STR: VACTERLX was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: VACTERLX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: VACTERLX were set to 20452998; 32639022
Phenotypes for STR: VACTERLX were set to VACTERL association, X-linked MIM#314390
Review for STR: VACTERLX was set to RED
Added comment: NM_003413.4(ZIC3):c.163GCC[X]
PMID: 20452998 - reports a single case with VACTERL association and an expansion of the poly-Ala tract from 10 to 12 alanines.
PMID: 32639022 - a family with Oculo-auriculo-vertebral spectrum (OAVS) segregates the 11 alanine expansion in affected males
This polyalanine tract is highly polymorphic in gnomAD v2.1, there are 86 hemizygote 12 alanine expansions present and 65 hemizygotes with the 11 alanine expansion. The 13 polyalanine expansion is also present in 13 hemizygotes.
Sources: Literature
Mendeliome v0.9091 PDGFRL Michelle Torres reviewed gene: PDGFRL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown; Current diagnostic: yes
Repeat Disorders v0.141 FRA12A Bryony Thompson Marked STR: FRA12A as ready
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.141 FRA12A Bryony Thompson Classified STR: FRA12A as Amber List (moderate evidence)
Repeat Disorders v0.141 FRA12A Bryony Thompson Str: fra12a has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.140 FRA12A Bryony Thompson STR: FRA12A was added
STR: FRA12A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA12A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA12A were set to 17236128
Phenotypes for STR: FRA12A were set to Mental retardation, FRA12A type MIM#136630
Review for STR: FRA12A was set to AMBER
Added comment: NM_173602.2:c.-137CGG[X]
All individuals expressing FRA12A had CGG-repeat expansion. The length of the expanded allele in 3 unaffected FRA12A carriers was 650–850 bp. In the two affected patients from 2 families with FRA12A, the length of the expanded allele was ∼1,050-1,150 bp.
70 controls used to determine the "normal" repeat range.
Sources: Literature
Red cell disorders v0.55 XK Danielle Ariti reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8004674, 30128557, 30800707; Phenotypes: McLeod syndrome with or without chronic granulomatous disease MIM# 300842, absence of red blood cell Kx antigen, weak expression of Kell red blood cell antigens, neuroacanthocytosis (peripheral and central nervous systems), cardiovascular abnormalities, myopathy; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Repeat Disorders v0.139 FRA11A Bryony Thompson Marked STR: FRA11A as ready
Repeat Disorders v0.139 FRA11A Bryony Thompson Str: fra11a has been classified as Red List (Low Evidence).
Repeat Disorders v0.139 FRA11A Bryony Thompson STR: FRA11A was added
STR: FRA11A was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11A was set to Unknown
Publications for STR: FRA11A were set to 18160775; 453198
Phenotypes for STR: FRA11A were set to Intellectual disability
Review for STR: FRA11A was set to RED
Added comment: Expansion of a polymorphic CGG-repeat located at the 5' end of the C11orf80 gene causes expression of the folate-sensitive fragile site FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. The expansion was identified in the 15-year-old proband with intellectual disability as well as in phenotypically normal members of the family.
Sources: Literature
Red cell disorders v0.55 YARS2 Danielle Ariti reviewed gene: YARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24430573, 24344687; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561, sideroblastic anaemia, muscle atrophy, myopathy, lactic acidosis, Hypertrophic cardiomyopathy, Hepatomegaly, Decreased cytochrome C oxidase activity; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.138 TOF Bryony Thompson Marked STR: TOF as ready
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.138 TOF Bryony Thompson Classified STR: TOF as Green List (high evidence)
Repeat Disorders v0.138 TOF Bryony Thompson Str: tof has been classified as Green List (High Evidence).
Repeat Disorders v0.137 TOF Bryony Thompson STR: TOF was added
STR: TOF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: TOF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TOF were set to 19948535; 11748311
Phenotypes for STR: TOF were set to Tetralogy of Fallot MIM#187500
Review for STR: TOF was set to GREEN
STR: TOF was marked as clinically relevant
Added comment: Poly-alanine tract expansion. In vitro functional assays demonstrated the expansion lead to protein aggregation in cells. Two unrelated cases reported with 25 repeats, one case with isolated interrupted aortic arch and one case with scoliosis, facial asymmetry, upslanting
palpebral fissures, absent PV, isolated left pulmonary artery (expected de novo - excluded in mother and father not available for testing). Other variant types cause disease in this gene.
Sources: Literature
Deafness_IsolatedAndComplex v1.90 MAP1B Elena Savva gene: MAP1B was added
gene: MAP1B was added to Deafness_IsolatedAndComplex. Sources: Literature
Mode of inheritance for gene: MAP1B was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: MAP1B were set to PMID: 33268592
Phenotypes for gene: MAP1B were set to Periventricular nodular heterotopia 9 MIM#618918; sensorineural hearing loss
Review for gene: MAP1B was set to GREEN
Added comment: PMID: 33268592 - three unrelated patients with heterozygous missense variants and nonsyndromic sensorineural hearing loss. Functional studies on one missense show reduced protein expression and less phosphorylation.
Variant correction via CRISPR rescued cell dysfunction, and K/O mice show hearing loss
Sources: Literature
Repeat Disorders v0.136 FRAXF Bryony Thompson Marked STR: FRAXF as ready
Repeat Disorders v0.136 FRAXF Bryony Thompson Str: fraxf has been classified as Red List (Low Evidence).
Repeat Disorders v0.136 FRAXF Bryony Thompson STR: FRAXF was added
STR: FRAXF was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRAXF was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXF were set to 7874164; 10094554; 8651274
Phenotypes for STR: FRAXF were set to Intellectual disability
Review for STR: FRAXF was set to RED
Added comment: FRAXF is a folate-sensitive fragile site, where expansion was identified in a male with developmental delay. However, further studies found that expression of the fragile site through expansion is not associated with a disease phenotype.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.4106 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Cataract v0.287 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Cataract v0.287 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Cataract v0.287 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Cataract v0.287 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Mendeliome v0.9091 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Mendeliome v0.9091 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Mendeliome v0.9091 IFIH1 Zornitza Stark Phenotypes for gene: IFIH1 were changed from to Aicardi-Goutieres syndrome 7, MIM#615846; Early-onset Inflammatory Bowel Disease
Mendeliome v0.9090 IFIH1 Zornitza Stark Publications for gene: IFIH1 were set to
Mendeliome v0.9089 IFIH1 Zornitza Stark Mode of inheritance for gene: IFIH1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence)
Genetic Epilepsy v0.1192 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1191 PRICKLE2 Zornitza Stark gene: PRICKLE2 was added
gene: PRICKLE2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease. Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)). Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Repeat Disorders v0.135 FRA11B Bryony Thompson Classified STR: FRA11B as Red List (low evidence)
Repeat Disorders v0.135 FRA11B Bryony Thompson Added comment: Comment on list classification: Low evidence of clinical relevance of expression of the fragile site.
Repeat Disorders v0.135 FRA11B Bryony Thompson Str: fra11b has been classified as Red List (Low Evidence).
Repeat Disorders v0.134 FRA11B Bryony Thompson STR: FRA11B was added
STR: FRA11B was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FRA11B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FRA11B were set to 7881408; 7603564; 9508241; 9927483; 10767345; 11076037; 19267933
Phenotypes for STR: FRA11B were set to Jacobsen syndrome MIM#147791
Review for STR: FRA11B was set to AMBER
Added comment: FRA11B is a rare folate sensitive fragile site caused by expansion of (CCG)n in the 5'UTR of CBL, and hypermethylation of adjacent CpG islands. There are commonly 11 repeats. The pre-mutation ranges from 80-100, while >100 leads to expression of the fragile site. Two cases of Jacobsen (llq-) syndrome, which is the clinical presentation of the loss of part of the long arm of chromosome 11, have been associated with the FRA11B repeat expansion (expected breakpoint). The estimated prevalence of the FRA11B expansion is 1 in 5,000, which the estimated prevalence of Jacobsen syndrome is <1 in 100,000.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Classified gene: PRICKLE2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4105 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4104 PRICKLE2 Hazel Phillimore gene: PRICKLE2 was added
gene: PRICKLE2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PRICKLE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PRICKLE2 were set to PMID: 34092786
Phenotypes for gene: PRICKLE2 were set to Neurodevelopmental disorder; global developmental delay; behavioural difficulties ± epilepsy; autistic features; attention deficit hyperactive disorder; psychiatric symptoms
Review for gene: PRICKLE2 was set to GREEN
Added comment: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.

Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PMID: 21276947).
Sources: Literature
Inflammatory bowel disease v0.59 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Sources: Literature; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified.
Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant.
Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis.
Sources: Literature
Mendeliome v0.9088 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: IFIH1 encodes MDA5, a key cystolic sensor for viral nucleic acids. Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. There were seven carriers of LoF variants identified (range of onset 6 months to 6 years of age). In three of these cases, a second hypomorphic missense variant was identified.
Luciferase reporter assays were employed to assess MDA5 activity. In some cases, the second missense variant was either proven to not affect protein function or was in cis with the LoF variant.
Complete and partial MDA5 deficiency is associated with VEOIBD with variable penetrance and expressivity, suggesting a role for impaired intestinal viral sensing in IBD pathogenesis.
Mendeliome v0.9088 IFIH1 Sarah Pantaleo changed review comment from: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.; to: Rare, likely loss-of-functions IFIH1 variants identified in eight independent probands with Very Early Onset Inflammatory Bowel Disease (VEOIBD) from a combined cohort of 42 children. IFIH1 variants were significantly enriched in children with VEOIBD as compared to controls (p=0.007).
In one case of neonatal-onset IBD, a homozygous truncating variant was identified. seven carriers of LoF variants (three of whom have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Mendeliome v0.9088 PRICKLE2 Hazel Phillimore changed review comment from: Six subjects from four unrelated families with heterozygous variants (two de novo missense (c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg)), one de novo nonsense variant (c.214 C>T; p.(Arg72*) and one frameshift variant (c.1286_1287delGT; p.(Ser429Thrfs*56)) which segregated with the disease in three affected females.

Loss-of-function (homozygous) variants cause seizures in flies, and both heterozygous and homozygous mice showed behavioral abnormalities including altered social interaction, learning abnormalities, and behavioural inflexibility. PubMed: 21276947.; to: Six subjects from four unrelated families with neurodevelopmental delay, behavioural difficulties and epilepsy had heterozygous variants, either de novo or segregating with disease.
Two missense were de novo, c.122 C>T; p.(Pro41Leu) and c.680C>G; p.(Thr227Arg); one nonsense variant was de novo (c.214 C>T; p.(Arg72*); and one frameshift variant segregated with the disorder in three affected females (c.1286_1287delGT; p.(Ser429Thrfs*56)).

Loss-of-function (homozygous) variants have been shown to cause seizures in flies; and both heterozygous and homozygous mice have shown behavioral abnormalities including altered social interaction, learning abnormalities, and behavioral inflexibility (PubMed: 21276947).
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Marked gene: IFIH1 as ready
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Classified gene: IFIH1 as Green List (high evidence)
Inflammatory bowel disease v0.59 IFIH1 Zornitza Stark Gene: ifih1 has been classified as Green List (High Evidence).
Mendeliome v0.9088 IFIH1 Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Inflammatory bowel disease v0.58 IFIH1 Sarah Pantaleo gene: IFIH1 was added
gene: IFIH1 was added to Inflammatory bowel disease. Sources: Literature
Mode of inheritance for gene: IFIH1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: IFIH1 were set to 34185153
Phenotypes for gene: IFIH1 were set to Inflammatory Bowel Disease
Penetrance for gene: IFIH1 were set to Incomplete
Review for gene: IFIH1 was set to GREEN
Added comment: Rare, likely loss-of-functions IFIH1 variants identified in eight patients with Very Early Onset Inflammatory Bowel Disease (VEOIBD) with VEOIBD from a combined cohort of 42 children. One homozygous truncating variant in a neonate from a consanguineous family, seven carriers of LoF variants (three of whom also have a second hypomorphic missense variant). Luciferase reporter assays employed to assess MDA5 activity (encoded by IFIH1). In three cases, the functional studies demonstrated that the second missense variant either did not affect protein function or was in cis with the LoF variant.
Sources: Literature
Mendeliome v0.9088 FGF8 Zornitza Stark Marked gene: FGF8 as ready
Mendeliome v0.9088 FGF8 Zornitza Stark Gene: fgf8 has been classified as Green List (High Evidence).
Mendeliome v0.9088 FGF8 Zornitza Stark Phenotypes for gene: FGF8 were changed from to Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Femoral hypoplasia
Mendeliome v0.9087 FGF8 Zornitza Stark Publications for gene: FGF8 were set to
Mendeliome v0.9086 FGF8 Zornitza Stark Mode of inheritance for gene: FGF8 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Susceptibility to Viral Infections v0.77 IFIH1 Sarah Pantaleo reviewed gene: IFIH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34185153; Phenotypes: Inflammatory Bowel Disease; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9085 FGF8 Zornitza Stark Tag SV/CNV tag was added to gene: FGF8.
Mendeliome v0.9085 FGF8 Zornitza Stark reviewed gene: FGF8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cataract v0.286 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Cataract. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Mendeliome v0.9085 UBE2U Zornitza Stark Marked gene: UBE2U as ready
Mendeliome v0.9085 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Marked gene: PRICKLE2 as ready
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Gene: prickle2 has been classified as Green List (High Evidence).
Mendeliome v0.9085 PRICKLE2 Zornitza Stark Phenotypes for gene: PRICKLE2 were changed from to Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.
Mendeliome v0.9084 PRICKLE2 Zornitza Stark Publications for gene: PRICKLE2 were set to
Intellectual disability syndromic and non-syndromic v0.4104 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Mendeliome v0.9083 PRICKLE2 Zornitza Stark Mode of inheritance for gene: PRICKLE2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Marked gene: COPB2 as ready
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9082 PRICKLE2 Hazel Phillimore reviewed gene: PRICKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34092786; Phenotypes: Neurodevelopmental disorder, global developmental delay, behavioural difficulties ± epilepsy, autistic features, and attention deficit hyperactive disorder.; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9082 UBE2U Ee Ming Wong changed review comment from: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature; to: - one missense UBE2U variant identified in one family with five affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Classified gene: COPB2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4104 COPB2 Zornitza Stark Gene: copb2 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Genetic Epilepsy v0.1190 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4103 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9082 UBE2U Zornitza Stark Classified gene: UBE2U as Red List (low evidence)
Mendeliome v0.9082 UBE2U Zornitza Stark Gene: ube2u has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 COPB2 Belinda Chong gene: COPB2 was added
gene: COPB2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: COPB2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: COPB2 were set to PMID: 34450031
Phenotypes for gene: COPB2 were set to Osteoporosis and developmental delay
Review for gene: COPB2 was set to AMBER
Added comment: Loss-of-function variants in COPB2 (MIM: 606990), a component of the COPI coatomer complex, in six individuals from five unrelated families presenting with a clinical spectrum of osteoporosis or os- teopenia, with or without fractures, and developmental delay of variable severity. A hypomorphic, homozygous missense variant in COPB2 was previously reported in two siblings with microcephaly, spasticity, and develop- mental delay (MIM: 617800) in whom we also here identified low bone mass. Data demonstrate that pathogenic variants in COPB2 lead to early onset osteoporosis and variable developmental delay and that COPB2 and the COPI complex are essential regulators of skeletal homeostasis

3 frameshift (2 de novo, 1 not maternal), 1 x splice (de novo), 2 missense (homozygous).
Sources: Literature
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Classified gene: GRIK2 as Green List (high evidence)
Genetic Epilepsy v0.1189 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9081 FGF8 Dean Phelan reviewed gene: FGF8: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 34433009; Phenotypes: Femoral hypoplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9081 LRP1 Seb Lunke Marked gene: LRP1 as ready
Mendeliome v0.9081 LRP1 Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence).
Growth failure v1.4 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Growth failure v1.4 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1188 GRIK2 Zornitza Stark Classified gene: GRIK2 as Green List (high evidence)
Genetic Epilepsy v0.1188 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9081 LRP1 Seb Lunke Classified gene: LRP1 as Red List (low evidence)
Mendeliome v0.9081 LRP1 Seb Lunke Added comment: Comment on list classification: Two papers without related phenotypes and little overall evidence for gene disease association.
Mendeliome v0.9081 LRP1 Seb Lunke Gene: lrp1 has been classified as Red List (Low Evidence).
Growth failure v1.4 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Growth failure v1.4 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9080 COPB2 Zornitza Stark Phenotypes for gene: COPB2 were changed from Microcephaly 19, primary, autosomal recessive, MIM# 617800 to Microcephaly 19, primary, autosomal recessive, MIM# 617800; Osteoporosis and developmental delay
Mendeliome v0.9079 COPB2 Zornitza Stark Publications for gene: COPB2 were set to 29036432
Mendeliome v0.9078 COPB2 Zornitza Stark Mode of inheritance for gene: COPB2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.1187 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9077 COPB2 Zornitza Stark Classified gene: COPB2 as Green List (high evidence)
Mendeliome v0.9077 COPB2 Zornitza Stark Gene: copb2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9076 CACNA1I Seb Lunke Marked gene: CACNA1I as ready
Mendeliome v0.9076 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1187 GRIK2 Danielle Ariti gene: GRIK2 was added
gene: GRIK2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: GRIK2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: GRIK2 were set to 34375587; 17847003; 25039795
Phenotypes for gene: GRIK2 were set to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD)
Review for gene: GRIK2 was set to GREEN
Added comment: Over 10 individuals with variants in GRIK2; Bi-allelic and mono-allelic; loss of function

2 (sibs) with bi-allelic truncating variants and 1 family with bi-allelic deletion (removing exons 7 and 8).
11 individuals with de novo mono-allelic missense variants
(5x with the same missense variant c.1969G>A (p.Ala657Thr) all the others were near this location).

Associated with nonsyndromic neurodevelopmental disorder (NDD) with intellectual disability and developmental delay as core features with 30-50% individuals experiencing seizures.
Sources: Literature
Mendeliome v0.9076 CACNA1I Seb Lunke Classified gene: CACNA1I as Green List (high evidence)
Mendeliome v0.9076 CACNA1I Seb Lunke Gene: cacna1i has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4102 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; nonsyndromic neurodevelopmental disorder (NDD), autosomal dominant
Mendeliome v0.9075 UBE2U Ee Ming Wong gene: UBE2U was added
gene: UBE2U was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: UBE2U was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBE2U were set to PMID: 33776059
Phenotypes for gene: UBE2U were set to Retinoschisis; cataracts; learning disabilities; developmental delay
Penetrance for gene: UBE2U were set to Complete
Review for gene: UBE2U was set to RED
gene: UBE2U was marked as current diagnostic
Added comment: - one missense UBE2U variant identified in one family with four other affected individuals (includes proband)
- in silico analyses predicts the UBE2U variant to be damaging
- no functional
- another STUM missense variant identified in the same family predicted to be benign
- additional clinical assessment indicated that the family shared some systemic dysmorphisms and learning disabilities similar to RIDDLE syndrome
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4101 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Growth failure v1.3 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to AMBER
gene: ZNF668 was marked as current diagnostic
Added comment: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9075 LRP1 Elena Savva reviewed gene: LRP1: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 26142438, 33776059; Phenotypes: ?Keratosis pilaris atrophicans MIM#604093; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4100 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9075 COPB2 Belinda Chong reviewed gene: COPB2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34450031; Phenotypes: Osteoporosis and developmental delay; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4099 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9075 GRIK2 Zornitza Stark Marked gene: GRIK2 as ready
Mendeliome v0.9075 GRIK2 Zornitza Stark Gene: grik2 has been classified as Green List (High Evidence).
Mendeliome v0.9075 CFAP206 Seb Lunke Marked gene: CFAP206 as ready
Mendeliome v0.9075 CFAP206 Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9075 GRIK2 Zornitza Stark Phenotypes for gene: GRIK2 were changed from to Mental retardation, autosomal recessive, 6 MIM# 611092; Nonsyndromic neurodevelopmental disorder, autosomal dominant
Mendeliome v0.9074 CFAP206 Seb Lunke Publications for gene: CFAP206 were set to
Mendeliome v0.9073 GRIK2 Zornitza Stark Publications for gene: GRIK2 were set to
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9072 GRIK2 Zornitza Stark Mode of inheritance for gene: GRIK2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9071 CFAP206 Seb Lunke Classified gene: CFAP206 as Amber List (moderate evidence)
Mendeliome v0.9071 CFAP206 Seb Lunke Gene: cfap206 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9070 CFAP206 Seb Lunke Phenotypes for gene: CFAP206 were changed from Multiple morphological abnormalities of the fagella to Multiple morphological abnormalities of the flagella
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4099 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Microcephaly v1.45 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.45 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Microcephaly v1.45 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9069 ZNF668 Zornitza Stark Marked gene: ZNF668 as ready
Mendeliome v0.9069 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9069 ZNF668 Zornitza Stark Classified gene: ZNF668 as Amber List (moderate evidence)
Mendeliome v0.9069 ZNF668 Zornitza Stark Gene: znf668 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9068 CACNA1I Kristin Rigbye gene: CACNA1I was added
gene: CACNA1I was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CACNA1I was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1I were set to 33704440
Phenotypes for gene: CACNA1I were set to Neurodevelopmental disorder
Mode of pathogenicity for gene: CACNA1I was set to Other
Review for gene: CACNA1I was set to GREEN
Added comment: 4 different missense variants identified and shown to result in a gain of function.

2 individuals with de novo variants (a 3rd also suspected de novo but their father was unavailable for testing) - these patients all had severe neurodevelopmental disorders, involving severe global developmental delay, absence of speech, gross motor delay, muscular hypotonia, early-onset seizures, cortical visual impairment, and feeding difficulties. Variable clinical features include various brain malformations, startle response or seizures, postnatal growth retardation, gastroesophageal reflux, and gastrostomy.

1 family had three affected individuals - variable cognitive impairment in all, involving borderline intellectual functioning or mild or moderate intellectual disability as main clinical feature, with late-onset seizures in the mother and speech retardation in one of the children. This variant had a milder functional effect than the variants in sporadic cases.
Sources: Literature
Mendeliome v0.9068 GRIK2 Danielle Ariti reviewed gene: GRIK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34375587, 17847003, 25039795; Phenotypes: Mental retardation, autosomal recessive, 6 MIM# 611092, nonsyndromic neurodevelopmental disorder (NDD; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Microcephaly v1.44 ZNF668 Paul De Fazio edited their review of gene: ZNF668: Changed rating: AMBER
Microcephaly v1.44 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9068 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 2 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Marked gene: LAMA1 as ready
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Classified gene: LAMA1 as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Classified gene: LAMA1 as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.14 LAMA1 Zornitza Stark Gene: lama1 has been classified as Green List (High Evidence).
Mendeliome v0.9068 GLIS1 Seb Lunke Marked gene: GLIS1 as ready
Mendeliome v0.9068 GLIS1 Seb Lunke Gene: glis1 has been classified as Red List (Low Evidence).
Microcephaly v1.44 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9068 GLIS1 Seb Lunke Phenotypes for gene: GLIS1 were changed from Increased ocular pressure to Increased ocular pressure; Glaucoma
Joubert syndrome and other neurological ciliopathies v1.13 LAMA1 Zornitza Stark gene: LAMA1 was added
gene: LAMA1 was added to Joubert syndrome and other neurological ciliopathies. Sources: Literature
Mode of inheritance for gene: LAMA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LAMA1 were set to 34423300
Phenotypes for gene: LAMA1 were set to Poretti-Boltshauser syndrome, MIM# 615960
Review for gene: LAMA1 was set to GREEN
Added comment: Four families with Poretti-Bolthauser syndrome identified in a cohort of 'unsolved' Joubert syndrome patients -- included due to phenotypic overlap.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9067 GLIS1 Seb Lunke changed review comment from: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.
Sources: Literature; to: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.

The authors did show dysregulation of GLIS1 in a human cell line study, and performed linkage analysis suggesting an association of the GLIS1 locus with Glaucoma in UK biobank samples.
Sources: Literature
Mendeliome v0.9067 ZNF668 Paul De Fazio changed review comment from: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature; to: 5 individuals from 3 consanguineous families reported with different biallelic truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Mendeliome v0.9067 CFAP206 Ain Roesley gene: CFAP206 was added
gene: CFAP206 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CFAP206 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFAP206 were set to Multiple morphological abnormalities of the fagella
Penetrance for gene: CFAP206 were set to unknown
Review for gene: CFAP206 was set to AMBER
Added comment: 1x hom with a fs variant

Sperm from knockout mouse model mainly had a fagellum of normal length but most of them showed abnormal forms including bent and coiled fagella. There was also a significant increase of sperm cells with absent or short fagella compared to the WT mice.
Sources: Literature
Mendeliome v0.9067 ZNF668 Paul De Fazio gene: ZNF668 was added
gene: ZNF668 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZNF668 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF668 were set to 34313816; 26633546
Phenotypes for gene: ZNF668 were set to DNA damage repair defect; microcephaly; growth deficiency; severe global developmental delay; brain malformation; facial dysmorphism
Review for gene: ZNF668 was set to GREEN
gene: ZNF668 was marked as current diagnostic
Added comment: 5 individuals from 3 consanguineous families reported with different truncating (not NMD) variants in ZNF668. Phenotypes included microcephaly, growth deficiency, severe global developmental delay, brain malformation, and distinct facial dysmorphism.

Immunofluorescence indicated ZNF668 deficiency. An increased DNA damage phenotype was demonstrated in patient fibroblasts.
Sources: Literature
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Marked gene: SLC32A1 as ready
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence)
Genetic Epilepsy v0.1187 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1186 SLC32A1 Zornitza Stark gene: SLC32A1 was added
gene: SLC32A1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC32A1 were set to 34038384
Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus
Review for gene: SLC32A1 was set to GREEN
Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition.
Sources: Literature
Mendeliome v0.9067 SLC32A1 Zornitza Stark Marked gene: SLC32A1 as ready
Mendeliome v0.9067 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Mendeliome v0.9067 GLIS1 Seb Lunke gene: GLIS1 was added
gene: GLIS1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GLIS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GLIS1 were set to 34385434
Phenotypes for gene: GLIS1 were set to Increased ocular pressure
Review for gene: GLIS1 was set to RED
Added comment: Functional studies in KO mice show increased intra-ocular pressure (IOT) caused by defects in the ocular drainage system. IOT is frequently associated with Glaucoma, however mice were not investigated for glaucoma, and no patients described.
Sources: Literature
Mendeliome v0.9066 SLC32A1 Zornitza Stark Classified gene: SLC32A1 as Green List (high evidence)
Mendeliome v0.9066 SLC32A1 Zornitza Stark Gene: slc32a1 has been classified as Green List (High Evidence).
Mendeliome v0.9065 SLC32A1 Zornitza Stark gene: SLC32A1 was added
gene: SLC32A1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SLC32A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC32A1 were set to 34038384
Phenotypes for gene: SLC32A1 were set to Genetic epilepsy with febrile seizures plus
Review for gene: SLC32A1 was set to GREEN
Added comment: 8 unrelated families reported, including segregation evidence in two large pedigrees. Variants are predicted to alter γ-aminobutyric acid (GABA) transport into synaptic vesicles, leading to altered neuronal inhibition.
Sources: Literature
Red cell disorders v0.55 GATA1 Zornitza Stark Marked gene: GATA1 as ready
Red cell disorders v0.55 GATA1 Zornitza Stark Gene: gata1 has been classified as Green List (High Evidence).
Red cell disorders v0.55 GATA1 Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367 to Thrombocytopaenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Red cell disorders v0.54 GATA1 Zornitza Stark Phenotypes for gene: GATA1 were changed from Thrombocytopenia, X-linked, with or without dyserythropoietic anemia 300367; 300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; Myelodysplastic syndrome (MDS), Paediatric; Diamond-Blackfan anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities 300835; Diamond Blackfan Anaemia; 300835 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia; 300367 Diamond Blackfan Anaemia; Anemia, X-linked, with/without neutropenia and/or platelet abnormalities; Thrombocytopenia, X-linked, with or without dyserythropoietic anemia, 300367 to Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Red cell disorders v0.53 GATA1 Zornitza Stark edited their review of gene: GATA1: Changed publications: 30228860, 24766296, 22706301
Red cell disorders v0.53 GATA1 Zornitza Stark edited their review of gene: GATA1: Changed phenotypes: Thrombocytopenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367
Mendeliome v0.9064 G6PD Zornitza Stark Marked gene: G6PD as ready
Mendeliome v0.9064 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Mendeliome v0.9064 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908
Mendeliome v0.9063 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Mendeliome v0.9062 G6PD Zornitza Stark Publications for gene: G6PD were set to
Mendeliome v0.9061 G6PD Zornitza Stark Mode of inheritance for gene: G6PD was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9060 G6PD Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: 18177777; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Red cell disorders v0.53 G6PD Zornitza Stark Marked gene: G6PD as ready
Red cell disorders v0.53 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Red cell disorders v0.53 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from Haemolytic anemia, G6PD deficient (favism), MIM# 300908 to Haemolytic anaemia, G6PD deficient (favism), MIM# 300908
Red cell disorders v0.52 G6PD Zornitza Stark Phenotypes for gene: G6PD were changed from 300908 Hemolytic anemia, G6PD deficient (favism); Enzyme Disorder; 300908 Hemolytic anemia due to G6PD deficiency; Hemolytic anemia due to G6PD deficiency, 300908 to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Red cell disorders v0.51 G6PD Zornitza Stark reviewed gene: G6PD: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Haemolytic anemia, G6PD deficient (favism), MIM# 300908; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.9060 EPB42 Zornitza Stark Marked gene: EPB42 as ready
Mendeliome v0.9060 EPB42 Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence).
Mendeliome v0.9060 EPB42 Zornitza Stark Phenotypes for gene: EPB42 were changed from to Spherocytosis, type 5, MIM# 612690
Mendeliome v0.9059 EPB42 Zornitza Stark Publications for gene: EPB42 were set to
Mendeliome v0.9058 EPB42 Zornitza Stark Mode of inheritance for gene: EPB42 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9057 EPB42 Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.51 EPB42 Zornitza Stark Marked gene: EPB42 as ready
Red cell disorders v0.51 EPB42 Zornitza Stark Gene: epb42 has been classified as Green List (High Evidence).
Red cell disorders v0.51 EPB42 Zornitza Stark Phenotypes for gene: EPB42 were changed from Spherocytosis, type 5, 612690; 612690 Hereditary spherocytosis type 5; RBC membrane abnormality; Hereditary spherocytosis type 5; 612690 Spherocytosis, type 5; EPB42-related hereditary spherocytosis; Minkowski-Chauffard disease; Spherocytosis, Recessive; Elliptocytosis to Spherocytosis, type 5, MIM# 612690
Red cell disorders v0.50 EPB42 Zornitza Stark Publications for gene: EPB42 were set to 12176912; 7772513; 1558976
Red cell disorders v0.49 EPB42 Zornitza Stark edited their review of gene: EPB42: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.49 EPB42 Zornitza Stark reviewed gene: EPB42: Rating: GREEN; Mode of pathogenicity: None; Publications: 1558976, 7803799, 7772513; Phenotypes: Spherocytosis, type 5, MIM# 612690; Mode of inheritance: None
Mendeliome v0.9057 EPB41 Zornitza Stark Marked gene: EPB41 as ready
Mendeliome v0.9057 EPB41 Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence).
Mendeliome v0.9057 EPB41 Zornitza Stark Phenotypes for gene: EPB41 were changed from to Elliptocytosis-1, MIM# 611804
Mendeliome v0.9056 EPB41 Zornitza Stark Publications for gene: EPB41 were set to
Mendeliome v0.9055 EPB41 Zornitza Stark Mode of inheritance for gene: EPB41 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9054 EPB41 Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.49 EPB41 Zornitza Stark Marked gene: EPB41 as ready
Red cell disorders v0.49 EPB41 Zornitza Stark Gene: epb41 has been classified as Green List (High Evidence).
Red cell disorders v0.49 EPB41 Zornitza Stark Phenotypes for gene: EPB41 were changed from Elliptocytosis-1,611804; RBC membrane abnormality; 611804 Hereditary elliptocytosis; 611804 Elliptocytosis-1; Elliptocytosis; Hereditary elliptocytosis to Elliptocytosis-1, MIM# 611804
Red cell disorders v0.48 EPB41 Zornitza Stark Publications for gene: EPB41 were set to 8423235; 1430200; 3134067
Red cell disorders v0.47 EPB41 Zornitza Stark Mode of inheritance for gene: EPB41 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Red cell disorders v0.46 EPB41 Zornitza Stark reviewed gene: EPB41: Rating: GREEN; Mode of pathogenicity: None; Publications: 33942936, 32807033, 27667160, 21839655; Phenotypes: Elliptocytosis-1, MIM# 611804; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9054 DHFR Zornitza Stark Marked gene: DHFR as ready
Mendeliome v0.9054 DHFR Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence).
Mendeliome v0.9054 DHFR Zornitza Stark Phenotypes for gene: DHFR were changed from to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839
Mendeliome v0.9053 DHFR Zornitza Stark Publications for gene: DHFR were set to
Mendeliome v0.9052 DHFR Zornitza Stark Mode of inheritance for gene: DHFR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9051 DHFR Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.46 DHFR Zornitza Stark Marked gene: DHFR as ready
Red cell disorders v0.46 DHFR Zornitza Stark Gene: dhfr has been classified as Green List (High Evidence).
Red cell disorders v0.46 DHFR Zornitza Stark Phenotypes for gene: DHFR were changed from Megaloblastic anemia due to dihydrofolate reductase deficiency, 613839; 613839 Megaloblastic anemia due to dihydrofolate reductase deficiency to Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839
Red cell disorders v0.45 DHFR Zornitza Stark reviewed gene: DHFR: Rating: GREEN; Mode of pathogenicity: None; Publications: 21310276, 21310277; Phenotypes: Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9051 CYB5R3 Zornitza Stark Marked gene: CYB5R3 as ready
Mendeliome v0.9051 CYB5R3 Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence).
Mendeliome v0.9051 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from to Methaemoglobinaemia, type I and II, MIM# 250800
Mendeliome v0.9050 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to
Mendeliome v0.9049 CYB5R3 Zornitza Stark Mode of inheritance for gene: CYB5R3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9048 CYB5R3 Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methaemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.45 CYB5R3 Zornitza Stark Marked gene: CYB5R3 as ready
Red cell disorders v0.45 CYB5R3 Zornitza Stark Gene: cyb5r3 has been classified as Green List (High Evidence).
Red cell disorders v0.45 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methemoglobinaemia, type I and II, MIM# 250800 to Methaemoglobinaemia, type I and II, MIM# 250800
Red cell disorders v0.44 CYB5R3 Zornitza Stark Phenotypes for gene: CYB5R3 were changed from Methaemoglobinaemia; 250800 Methemoglobinemia; Methaemoglobinaemia type I and II, 250800; 250800 Methaemoglobinaemia type I and II to Methemoglobinaemia, type I and II, MIM# 250800
Red cell disorders v0.43 CYB5R3 Zornitza Stark Publications for gene: CYB5R3 were set to 18318771; 15921385
Red cell disorders v0.42 CYB5R3 Zornitza Stark reviewed gene: CYB5R3: Rating: GREEN; Mode of pathogenicity: None; Publications: 2107882, 1707593, 12393396; Phenotypes: Methemoglobinaemia, type I and II, MIM# 250800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.133 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.133 NIPA1 Bryony Thompson Added comment: Comment on list classification: This is an association/risk allele rather than high-risk disease-causing expansion, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.133 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.132 NIPA1 Bryony Thompson Deleted their comment
Repeat Disorders v0.132 NIPA1 Bryony Thompson Classified STR: NIPA1 as Red List (low evidence)
Repeat Disorders v0.132 NIPA1 Bryony Thompson Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting.
Repeat Disorders v0.132 NIPA1 Bryony Thompson Str: nipa1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.131 NIPA1 Bryony Thompson STR: NIPA1 was added
STR: NIPA1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIPA1 was set to Unknown
Publications for STR: NIPA1 were set to 30342764; 22378146
Phenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis
Review for STR: NIPA1 was set to GREEN
Added comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5.
Sources: Literature
Red cell disorders v0.42 CUBN Zornitza Stark Marked gene: CUBN as ready
Red cell disorders v0.42 CUBN Zornitza Stark Gene: cubn has been classified as Green List (High Evidence).
Red cell disorders v0.42 CUBN Zornitza Stark Phenotypes for gene: CUBN were changed from Megaloblastic anemia-1, Finnish type, 261100; Megaloblastic Anemia; 261100 Megaloblastic anemia-1, Finnish type to Imerslund-Grasbeck syndrome 1, MIM# 261100
Red cell disorders v0.41 CUBN Zornitza Stark Publications for gene: CUBN were set to 17285242; 15024727
Red cell disorders v0.40 CUBN Zornitza Stark reviewed gene: CUBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10080186, 21208123, 17668238]; Phenotypes: Imerslund-Grasbeck syndrome 1, MIM# 261100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.40 COX4I2 Zornitza Stark changed review comment from: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs).; to: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs). Note no other variants reported in this gene since original report in 2009. All variants submitted to ClinVar are VOUS/LB/B.
Red cell disorders v0.40 COX4I2 Zornitza Stark Marked gene: COX4I2 as ready
Red cell disorders v0.40 COX4I2 Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence).
Red cell disorders v0.40 COX4I2 Zornitza Stark Phenotypes for gene: COX4I2 were changed from Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, 612714; 612714 Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, andCalvarial Hyperostosis; 612714 Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714
Red cell disorders v0.39 COX4I2 Zornitza Stark Publications for gene: COX4I2 were set to 19268275
Red cell disorders v0.38 COX4I2 Zornitza Stark Classified gene: COX4I2 as Red List (low evidence)
Red cell disorders v0.38 COX4I2 Zornitza Stark Gene: cox4i2 has been classified as Red List (Low Evidence).
Red cell disorders v0.37 COX4I2 Zornitza Stark reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.37 CDAN1 Zornitza Stark Marked gene: CDAN1 as ready
Red cell disorders v0.37 CDAN1 Zornitza Stark Gene: cdan1 has been classified as Green List (High Evidence).
Red cell disorders v0.37 CDAN1 Zornitza Stark Phenotypes for gene: CDAN1 were changed from 224120 Dyserythropoietic anemia, congenital, type Ia; 224120 Congenital dyserythropoietic anaemia type 1a; Dyserythropoietic anemia, congenital, type Ia, 224120 to Dyserythropoietic anaemia, congenital, type Ia, 224120
Red cell disorders v0.36 CDAN1 Zornitza Stark Publications for gene: CDAN1 were set to 16098079; 12434312
Red cell disorders v0.35 CDAN1 Zornitza Stark edited their review of gene: CDAN1: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ia, 224120
Red cell disorders v0.35 ALDOA Zornitza Stark Marked gene: ALDOA as ready
Red cell disorders v0.35 ALDOA Zornitza Stark Gene: aldoa has been classified as Green List (High Evidence).
Red cell disorders v0.35 ALDOA Zornitza Stark Phenotypes for gene: ALDOA were changed from Enzyme Disorder; Glycogen storage disease; Aldolase A deficiency; 611881 Aldolase A deficiency; 611881 Glycogen storage disease XII; Glycogen storage disease XII, 611881; Glycogen storage disease due to aldolase A deficiency to Glycogen storage disease XII , MIM#611881
Red cell disorders v0.34 ALDOA Zornitza Stark Publications for gene: ALDOA were set to 8598869; 7331996
Red cell disorders v0.33 ALDOA Zornitza Stark reviewed gene: ALDOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7331996, 8598869, 25392908; Phenotypes: Glycogen storage disease XII , MIM#611881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9048 CD59 Zornitza Stark Marked gene: CD59 as ready
Mendeliome v0.9048 CD59 Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence).
Mendeliome v0.9048 CD59 Zornitza Stark Phenotypes for gene: CD59 were changed from to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300
Mendeliome v0.9047 CD59 Zornitza Stark Publications for gene: CD59 were set to
Mendeliome v0.9046 CD59 Zornitza Stark Mode of inheritance for gene: CD59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.33 CD59 Zornitza Stark changed review comment from: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.; to: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.

More than 5 unrelated families reported.
Mendeliome v0.9045 CD59 Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.33 CD59 Zornitza Stark Marked gene: CD59 as ready
Red cell disorders v0.33 CD59 Zornitza Stark Gene: cd59 has been classified as Green List (High Evidence).
Red cell disorders v0.33 CD59 Zornitza Stark Phenotypes for gene: CD59 were changed from Dyskeratosis congenita, X-linked, 305000; 305000 Dyskeratosis congenita, X-linked to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300
Red cell disorders v0.32 CD59 Zornitza Stark reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.32 C15orf41 Zornitza Stark Marked gene: C15orf41 as ready
Red cell disorders v0.32 C15orf41 Zornitza Stark Gene: c15orf41 has been classified as Green List (High Evidence).
Red cell disorders v0.32 C15orf41 Zornitza Stark Phenotypes for gene: C15orf41 were changed from 615631 Congenital dyserythropoietic anaemia type 1b; Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib; 615631 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib, 615631 to Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631
Red cell disorders v0.31 C15orf41 Zornitza Stark Publications for gene: C15orf41 were set to 29031773; 23716552; 29885034
Red cell disorders v0.30 C15orf41 Zornitza Stark edited their review of gene: C15orf41: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631
Repeat Disorders v0.130 HSAN8 Bryony Thompson Marked STR: HSAN8 as ready
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.130 HSAN8 Bryony Thompson Classified STR: HSAN8 as Green List (high evidence)
Repeat Disorders v0.130 HSAN8 Bryony Thompson Str: hsan8 has been classified as Green List (High Evidence).
Repeat Disorders v0.129 HSAN8 Bryony Thompson STR: HSAN8 was added
STR: HSAN8 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HSAN8 were set to 26005867
Phenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488
Review for STR: HSAN8 was set to GREEN
STR: HSAN8 was marked as clinically relevant
Added comment: NM_021619.3(PRDM12):c.1041CGC[X]
Poly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Repeat Disorders v0.128 RCPS Bryony Thompson Marked STR: RCPS as ready
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.128 RCPS Bryony Thompson Classified STR: RCPS as Green List (high evidence)
Repeat Disorders v0.128 RCPS Bryony Thompson Str: rcps has been classified as Green List (High Evidence).
Repeat Disorders v0.127 RCPS Bryony Thompson STR: RCPS was added
STR: RCPS was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RCPS were set to 24360810; 29112243
Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: RCPS was set to GREEN
STR: RCPS was marked as clinically relevant
Added comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Periventricular Grey Matter Heterotopia v1.0 Zornitza Stark promoted panel to version 1.0
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark Marked gene: SYNCRIP as ready
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark Gene: syncrip has been classified as Red List (Low Evidence).
Periventricular Grey Matter Heterotopia v0.30 SYNCRIP Zornitza Stark gene: SYNCRIP was added
gene: SYNCRIP was added to Periventricular Grey Matter Heterotopia. Sources: Literature
Mode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SYNCRIP were set to 34157790
Phenotypes for gene: SYNCRIP were set to SYNCRIP-related neurodevelopmental disorder
Review for gene: SYNCRIP was set to RED
Added comment: One of 8 individuals reported so far had PVNH.
Sources: Literature
Mendeliome v0.9045 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Mendeliome v0.9045 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Mendeliome v0.9045 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201
Mendeliome v0.9044 NEDD4L Zornitza Stark Publications for gene: NEDD4L were set to
Mendeliome v0.9043 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9042 NEDD4L Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.29 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from to Periventricular nodular heterotopia 7, MIM# 617201
Periventricular Grey Matter Heterotopia v0.28 NEDD4L Zornitza Stark Publications for gene: NEDD4L were set to
Periventricular Grey Matter Heterotopia v0.27 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.27 NEDD4L Zornitza Stark Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Periventricular Grey Matter Heterotopia v0.26 NEDD4L Zornitza Stark reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Marked STR: MEDPSACH as ready
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Classified STR: MEDPSACH as Green List (high evidence)
Repeat Disorders v0.126 MEDPSACH Bryony Thompson Str: medpsach has been classified as Green List (High Evidence).
Repeat Disorders v0.125 MEDPSACH Bryony Thompson STR: MEDPSACH was added
STR: MEDPSACH was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MEDPSACH were set to 9887340; 17133256; 21922596
Phenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170
Review for STR: MEDPSACH was set to GREEN
STR: MEDPSACH was marked as clinically relevant
STR: MEDPSACH was marked as current diagnostic
Added comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene.
Sources: Literature
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Marked gene: FLNA as ready
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Gene: flna has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.26 FLNA Zornitza Stark Phenotypes for gene: FLNA were changed from to Heterotopia, periventricular, 1 , MIM#300049
Periventricular Grey Matter Heterotopia v0.25 FLNA Zornitza Stark Publications for gene: FLNA were set to
Periventricular Grey Matter Heterotopia v0.24 FLNA Zornitza Stark Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Periventricular Grey Matter Heterotopia v0.23 FLNA Zornitza Stark reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: 9883725, 15668422, 15994863; Phenotypes: Heterotopia, periventricular, 1 , MIM#300049; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Marked gene: ARF1 as ready
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Marked gene: DCHS1 as ready
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Gene: dchs1 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.22 DCHS1 Zornitza Stark Phenotypes for gene: DCHS1 were changed from to Van Maldergem syndrome 1, MIM# 601390
Periventricular Grey Matter Heterotopia v0.21 DCHS1 Zornitza Stark Publications for gene: DCHS1 were set to
Periventricular Grey Matter Heterotopia v0.20 DCHS1 Zornitza Stark Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.19 DCHS1 Zornitza Stark reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Classified gene: ARF1 as Green List (high evidence)
Genetic Epilepsy v0.1185 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1184 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Marked gene: ARF1 as ready
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Classified gene: ARF1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4098 ARF1 Zornitza Stark Gene: arf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4097 ARF1 Zornitza Stark gene: ARF1 was added
gene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF1 were set to 28868155; 34353862
Phenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185
Review for gene: ARF1 was set to GREEN
Added comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID).
Sources: Literature
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark changed review comment from: Additional reported of affected parent and child.; to: Additional report of affected parent and child.
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark commented on gene: ARF1: Additional reported of affected parent and child.
Periventricular Grey Matter Heterotopia v0.19 ARF1 Zornitza Stark edited their review of gene: ARF1: Changed publications: 28868155, 34353862; Changed phenotypes: Periventricular nodular heterotopia 8, MIM# 618185
Mendeliome v0.9042 ARF1 Zornitza Stark Publications for gene: ARF1 were set to 28868155
Craniosynostosis v1.25 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Craniosynostosis v1.25 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Craniosynostosis v1.25 GINS2 Zornitza Stark gene: GINS2 was added
gene: GINS2 was added to Craniosynostosis. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included.

GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Growth failure v1.3 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Growth failure v1.3 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Growth failure v1.3 GINS2 Zornitza Stark gene: GINS2 was added
gene: GINS2 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included. GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Mendeliome v0.9041 GINS2 Zornitza Stark Marked gene: GINS2 as ready
Mendeliome v0.9041 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Mendeliome v0.9041 GINS2 Zornitza Stark Classified gene: GINS2 as Red List (low evidence)
Mendeliome v0.9041 GINS2 Zornitza Stark Gene: gins2 has been classified as Red List (Low Evidence).
Red cell disorders v0.30 ANK1 Zornitza Stark Marked gene: ANK1 as ready
Red cell disorders v0.30 ANK1 Zornitza Stark Gene: ank1 has been classified as Green List (High Evidence).
Red cell disorders v0.30 ANK1 Zornitza Stark Phenotypes for gene: ANK1 were changed from Spherocytosis, type 1; Spherocytosis, type 1,182900; RBC membrane abnormality; 182900 Spherocytosis, type 1; 182900 RBC membrane abnormality to Spherocytosis, type 1, MIM# 182900
Red cell disorders v0.29 ANK1 Zornitza Stark Publications for gene: ANK1 were set to 7883994; 9590147; 11167760
Red cell disorders v0.28 ANK1 Zornitza Stark reviewed gene: ANK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8640229; Phenotypes: Spherocytosis, type 1, MIM# 182900; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9040 AMN Zornitza Stark Marked gene: AMN as ready
Mendeliome v0.9040 AMN Zornitza Stark Gene: amn has been classified as Green List (High Evidence).
Mendeliome v0.9040 AMN Zornitza Stark Phenotypes for gene: AMN were changed from to Imerslund-Grasbeck syndrome 2, MIM# 618882
Mendeliome v0.9039 AMN Zornitza Stark Publications for gene: AMN were set to
Mendeliome v0.9038 AMN Zornitza Stark Mode of inheritance for gene: AMN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9037 AMN Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.28 AMN Zornitza Stark Marked gene: AMN as ready
Red cell disorders v0.28 AMN Zornitza Stark Gene: amn has been classified as Green List (High Evidence).
Red cell disorders v0.28 AMN Zornitza Stark Phenotypes for gene: AMN were changed from 261100 Megaloblastic anemia-1, Norwegian type; Megaloblastic anemia-1, Norwegian type, 261100 to Imerslund-Grasbeck syndrome 2, MIM# 618882
Red cell disorders v0.27 AMN Zornitza Stark Publications for gene: AMN were set to 17285242; 12590260
Red cell disorders v0.26 AMN Zornitza Stark reviewed gene: AMN: Rating: GREEN; Mode of pathogenicity: None; Publications: 12590260, 15024727, 17285242, 24156255, 26040326; Phenotypes: Imerslund-Grasbeck syndrome 2, MIM# 618882; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.124 DMD Bryony Thompson Marked STR: DMD as ready
Repeat Disorders v0.124 DMD Bryony Thompson Str: dmd has been classified as Red List (Low Evidence).
Repeat Disorders v0.124 DMD Bryony Thompson STR: DMD was added
STR: DMD was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: DMD was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: DMD were set to 27417533
Phenotypes for STR: DMD were set to Duchenne muscular dystrophy MIM#310200; Becker muscular dystrophy MIM#300376
Review for STR: DMD was set to RED
Added comment: Single family reported with GAA repeat expansion in intron 62. Normal repeat range 11-33 in healthy controls. Expanded repeats range from 59-82 in the family, with 2 female carriers manifesting symptoms, a male foetus, 2 asymptomatic female carriers, and 2 male asymptomatic carriers ages 6 and 4 years.
Sources: Literature
Mendeliome v0.9037 AK1 Zornitza Stark Marked gene: AK1 as ready
Mendeliome v0.9037 AK1 Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence).
Mendeliome v0.9037 AK1 Zornitza Stark Phenotypes for gene: AK1 were changed from to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631
Mendeliome v0.9036 AK1 Zornitza Stark Publications for gene: AK1 were set to
Mendeliome v0.9035 AK1 Zornitza Stark Mode of inheritance for gene: AK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9034 AK1 Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.26 AK1 Zornitza Stark Marked gene: AK1 as ready
Red cell disorders v0.26 AK1 Zornitza Stark Gene: ak1 has been classified as Green List (High Evidence).
Red cell disorders v0.26 AK1 Zornitza Stark Phenotypes for gene: AK1 were changed from 612631 Hemolytic anemia due to adenylate kinase deficiency; Hemolytic anemia due to adenylate kinase deficiency, 612631 to Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631
Red cell disorders v0.25 AK1 Zornitza Stark Publications for gene: AK1 were set to 28211224
Red cell disorders v0.24 AK1 Zornitza Stark reviewed gene: AK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2542324, 9432020, 10233365, 34321014; Phenotypes: Haemolytic anemia due to adenylate kinase deficiency, MIM# 612631; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9034 ALAS2 Zornitza Stark Marked gene: ALAS2 as ready
Mendeliome v0.9034 ALAS2 Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence).
Mendeliome v0.9034 ALAS2 Zornitza Stark Phenotypes for gene: ALAS2 were changed from to Anaemia, sideroblastic, 1, MIM# 300751; Protoporphyria, erythropoietic, X-linked, MIM# 300752
Mendeliome v0.9033 ALAS2 Zornitza Stark Publications for gene: ALAS2 were set to
Mendeliome v0.9032 ALAS2 Zornitza Stark Mode of inheritance for gene: ALAS2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9031 ALAS2 Zornitza Stark reviewed gene: ALAS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10029606, 7949148, 10029606, 25615817; Phenotypes: Anaemia, sideroblastic, 1, MIM# 300751, Protoporphyria, erythropoietic, X-linked, MIM# 300752; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.24 ALAS2 Zornitza Stark Marked gene: ALAS2 as ready
Red cell disorders v0.24 ALAS2 Zornitza Stark Gene: alas2 has been classified as Green List (High Evidence).
Red cell disorders v0.24 ALAS2 Zornitza Stark Phenotypes for gene: ALAS2 were changed from Anemia, sideroblastic, 1 300751; Anemia, sideroblastic, 1, 300751; 300751 Sideroblastic anaemia 1; 300751 Anemia, sideroblastic, 1 to Anaemia, sideroblastic, 1, MIM# 300751
Red cell disorders v0.23 ALAS2 Zornitza Stark Publications for gene: ALAS2 were set to 10029606
Red cell disorders v0.22 ALAS2 Zornitza Stark edited their review of gene: ALAS2: Added comment: The essential features of X-linked sideroblastic anemia include: (1) a hypochromic microcytic anaemia and 2 discrete populations of red blood cells, one microcytic and the other normocytic; (2) marrow ringed sideroblasts, particularly prominent in the late erythroid precursors; (3) a variable haematologic response to pharmacologic doses of pyridoxine; and (4) systemic iron overload secondary to chronic ineffective erythropoiesis. The age of clinical onset of the disorder can vary from in utero to the ninth decade.

Well established gene-disease association.; Changed publications: 10029606, 7949148, 10029606
Red cell disorders v0.22 ALAS2 Zornitza Stark edited their review of gene: ALAS2: Changed phenotypes: Anaemia, sideroblastic, 1, MIM# 300751
Red cell disorders v0.22 ABCG8 Zornitza Stark Marked gene: ABCG8 as ready
Red cell disorders v0.22 ABCG8 Zornitza Stark Gene: abcg8 has been classified as Green List (High Evidence).
Red cell disorders v0.22 ABCG8 Zornitza Stark Phenotypes for gene: ABCG8 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolemia 1, MIM# 210250
Red cell disorders v0.21 ABCG8 Zornitza Stark Publications for gene: ABCG8 were set to
Red cell disorders v0.20 ABCG8 Zornitza Stark reviewed gene: ABCG8: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 33807969; Phenotypes: Sitosterolemia 1, MIM# 210250; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.20 ADA2 Zornitza Stark Marked gene: ADA2 as ready
Red cell disorders v0.20 ADA2 Zornitza Stark Gene: ada2 has been classified as Green List (High Evidence).
Red cell disorders v0.20 ADA2 Zornitza Stark Phenotypes for gene: ADA2 were changed from Diamond Blackfan anaemia to Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome, MIM# 615688
Red cell disorders v0.19 ADA2 Zornitza Stark Publications for gene: ADA2 were set to
Red cell disorders v0.18 ADA2 Zornitza Stark changed review comment from: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency.

At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.; to: Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome (VAIHS) is an autosomal recessive multisystem disorder with onset in childhood. The phenotype is highly variable, but most patients have features of a systemic vascular inflammatory disorder with skin ulceration and recurrent strokes affecting the small vessels of the brain resulting in neurologic dysfunction. Other features may include recurrent fever, elevated acute-phase proteins, myalgias, lesions resembling polyarteritis nodosa, and/or livedo racemosa or reticularis with an inflammatory vasculitis on biopsy. Some patients may have renal and/or gastrointestinal involvement, hypertension, aneurysms, or ischemic necrosis of the digits. Some affected individuals have immunodeficiency.

At least 10 unrelated families reported, the p.Gly47Arg variant is a common founder variant in the Jewish population.

Anaemia is a reported feature.
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Familial hypercholesterolaemia v0.18 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666
Familial hypercholesterolaemia v0.17 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Familial hypercholesterolaemia v0.16 ABCG5 Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Familial hypercholesterolaemia v0.15 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9031 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Mendeliome v0.9031 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Mendeliome v0.9031 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from to Sitosterolaemia 2, MIM# 618666
Mendeliome v0.9030 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Mendeliome v0.9029 ABCG5 Zornitza Stark Mode of inheritance for gene: ABCG5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9028 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 34304999, 33907061, 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Red cell disorders v0.18 ABCG5 Zornitza Stark Marked gene: ABCG5 as ready
Red cell disorders v0.18 ABCG5 Zornitza Stark Gene: abcg5 has been classified as Green List (High Evidence).
Red cell disorders v0.18 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to 32546081; 23556150
Red cell disorders v0.17 ABCG5 Zornitza Stark edited their review of gene: ABCG5: Changed publications: 34304999, 33907061, 32546081, 23556150
Red cell disorders v0.17 ABCG5 Zornitza Stark Phenotypes for gene: ABCG5 were changed from 210250 sitosterolaemia; sitosterolaemia to Sitosterolaemia 2, MIM# 618666
Red cell disorders v0.16 ABCG5 Zornitza Stark Publications for gene: ABCG5 were set to
Red cell disorders v0.15 ABCG5 Zornitza Stark reviewed gene: ABCG5: Rating: GREEN; Mode of pathogenicity: None; Publications: 32546081, 23556150; Phenotypes: Sitosterolaemia 2, MIM# 618666; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v1.2 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Genetic Health Queensland; Rare Disease
Regression v0.368 ABCB7 Zornitza Stark Marked gene: ABCB7 as ready
Regression v0.368 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence).
Regression v0.368 ABCB7 Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.367 ABCB7 Zornitza Stark Phenotypes for gene: ABCB7 were changed from to Anaemia, sideroblastic, with ataxia, MIM# 301310
Regression v0.366 ABCB7 Zornitza Stark Publications for gene: ABCB7 were set to
Regression v0.366 ABCB7 Zornitza Stark Mode of inheritance for gene: ABCB7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Regression v0.365 ABCB7 Zornitza Stark Classified gene: ABCB7 as Red List (low evidence)
Regression v0.365 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Red List (Low Evidence).
Regression v0.364 ABCB7 Zornitza Stark reviewed gene: ABCB7: Rating: RED; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.14 ABCB7 Zornitza Stark Marked gene: ABCB7 as ready
Red cell disorders v0.14 ABCB7 Zornitza Stark Gene: abcb7 has been classified as Green List (High Evidence).
Red cell disorders v0.14 ABCB7 Zornitza Stark Phenotypes for gene: ABCB7 were changed from 301310 Sideroblastic anaemia; Anemia, sideroblastic, with ataxia; Anemia, sideroblastic, with ataxia, 301310; 301310 Sideroblastic Anemia and Ataxia; Sideroblastic Anemia and Ataxia to Anaemia, sideroblastic, with ataxia, MIM# 301310
Red cell disorders v0.13 ABCB7 Zornitza Stark Publications for gene: ABCB7 were set to 11843825; 4045952; 11050011
Red cell disorders v0.12 ABCB7 Zornitza Stark reviewed gene: ABCB7: Rating: GREEN; Mode of pathogenicity: None; Publications: 10196363, 11050011, 34354969; Phenotypes: Anaemia, sideroblastic, with ataxia, MIM# 301310; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Red cell disorders v0.11 Zornitza Stark Panel name changed from Rare anaemia_GEL to Red cell disorders
Callosome v0.320 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Genetic Epilepsy v0.1183 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Genetic Epilepsy v0.1182 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Mendeliome v0.9028 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512 to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Mendeliome v0.9027 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4096 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512, Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517
Intellectual disability syndromic and non-syndromic v0.4095 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Callosome v0.320 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Callosome v0.319 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Genetic Epilepsy v0.1182 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Genetic Epilepsy v0.1181 CLCN3 Zornitza Stark edited their review of gene: CLCN3: Changed phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Mendeliome v0.9027 CLCN3 Zornitza Stark Phenotypes for gene: CLCN3 were changed from Neurodevelopmental disorder to Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512
Mendeliome v0.9026 CLCN3 Zornitza Stark reviewed gene: CLCN3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512; Mode of inheritance: None
Mendeliome v0.9026 TOM1 Zornitza Stark Marked gene: TOM1 as ready
Mendeliome v0.9026 TOM1 Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence).
Mendeliome v0.9026 TOM1 Zornitza Stark gene: TOM1 was added
gene: TOM1 was added to Mendeliome. Sources: Expert list
Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOM1 were set to 31263572
Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510
Review for gene: TOM1 was set to RED
Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data.
Sources: Expert list
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark Marked gene: TOM1 as ready
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark Gene: tom1 has been classified as Red List (Low Evidence).
Combined Immunodeficiency v1.1 TOM1 Zornitza Stark gene: TOM1 was added
gene: TOM1 was added to Combined Immunodeficiency. Sources: Expert list
Mode of inheritance for gene: TOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TOM1 were set to 31263572
Phenotypes for gene: TOM1 were set to Immunodeficiency 85 and autoimmunity, MIM# 619510
Review for gene: TOM1 was set to RED
Added comment: Parent and child reported with onset of atopic eczema and recurrent respiratory infections in the first decade of life; autoimmune enteropathy with vomiting, diarrhoea, and poor overall growth. More variable features included autoimmune oligoarthritis, interstitial pneumonitis, and EBV viremia. Laboratory studies showed hypogammaglobulinaemia and abnormal T-cell function, consistent with a combined immunodeficiency. Missense variant in TOM1, with limited functional data.
Sources: Expert list
Mendeliome v0.9025 ARF1 Arina Puzriakova reviewed gene: ARF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28868155, 34353862; Phenotypes: Periventricular nodular heterotopia 8, OMIM:618185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.9025 GINS2 Arina Puzriakova gene: GINS2 was added
gene: GINS2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GINS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS2 were set to 34353863
Phenotypes for gene: GINS2 were set to Meier-Gorlin syndrome with craniosynostosis
Review for gene: GINS2 was set to RED
Added comment: Sa et al., 2021 (PMID: 34353863) identified a patient presenting with prenatal and postnatal growth restriction, a craniofacial gestalt of MGORS and coronal craniosynostosis. A homozygous missense variant (c.341G>T, p.Arg114Leu) in GINS2 was identified that was heterozygous in both unaffected parents. Some supportive functional data included.

GINS2 is not currently not associated with any phenotype in OMIM or G2P and no additional cases have been identified to date.
Sources: Literature
Mendeliome v0.9025 DNAH10 Zornitza Stark Phenotypes for gene: DNAH10 were changed from primary male infertility with asthenoteratozoospermia to Spermatogenic failure 56, MIM# 619515
Mendeliome v0.9024 DNAH10 Zornitza Stark reviewed gene: DNAH10: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 56, MIM# 619515; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4095 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Intellectual disability syndromic and non-syndromic v0.4094 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Mendeliome v0.9024 GNB2 Zornitza Stark Phenotypes for gene: GNB2 were changed from intellectual disability; dysmorphic features to Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503
Mendeliome v0.9023 GNB2 Zornitza Stark edited their review of gene: GNB2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM# 619503
Mendeliome v0.9023 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; cerebral ventriculomegaly; limb contractures to Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296; Ventriculomegaly and arthrogryposis, MIM# 619501
Mendeliome v0.9022 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296, Ventriculomegaly and arthrogryposis, MIM# 619501
Hydrocephalus_Ventriculomegaly v0.94 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures
Hydrocephalus_Ventriculomegaly v0.93 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures
Arthrogryposis v0.292 KIDINS220 Zornitza Stark Phenotypes for gene: KIDINS220 were changed from cerebral ventriculomegaly; limb contractures to Ventriculomegaly and arthrogryposis, MIM# 619501; cerebral ventriculomegaly; limb contractures
Arthrogryposis v0.291 KIDINS220 Zornitza Stark edited their review of gene: KIDINS220: Changed phenotypes: Ventriculomegaly and arthrogryposis, MIM# 619501, cerebral ventriculomegaly, limb contractures
Growth failure v1.1 Zornitza Stark Panel name changed from Growth failure in early childhood to Growth failure
Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Growth failure v1.0 Zornitza Stark promoted panel to version 1.0
Growth failure v0.404 ZFP57 Zornitza Stark edited their review of gene: ZFP57: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.404 ZFP57 Zornitza Stark Marked gene: ZFP57 as ready
Growth failure v0.404 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Growth failure v0.404 ZFP57 Zornitza Stark Phenotypes for gene: ZFP57 were changed from diabetes mellitus, transient neonatal, 1MONDO:0011073; Diabetes mellitus, transient neonatal 1 OMIM:601410; IUGR; Multi Locus Imprinting Disturbance to Diabetes mellitus, transient neonatal 1, MIM# 601410
Growth failure v0.403 ZFP57 Zornitza Stark Classified gene: ZFP57 as Green List (high evidence)
Growth failure v0.403 ZFP57 Zornitza Stark Gene: zfp57 has been classified as Green List (High Evidence).
Growth failure v0.402 ZFP57 Zornitza Stark reviewed gene: ZFP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 18622393; Phenotypes: Diabetes mellitus, transient neonatal 1, MIM# 601410; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Classified gene: GOSR2 as Green List (high evidence)
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Added comment: Comment on list classification: Additional cases reported with muscular dystrophy
Muscular dystrophy and myopathy_Paediatric v0.92 GOSR2 Bryony Thompson Gene: gosr2 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.91 GOSR2 Bryony Thompson reviewed gene: GOSR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34167170, 33639315, 33639315, 29855340, DOI:https://doi.org/10.1016/j.nmd.2013.06.404; Phenotypes: Epilepsy, progressive myoclonic 6 MIM#614018, congenital muscluar dystrophy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.402 PADI6 Zornitza Stark Marked gene: PADI6 as ready
Growth failure v0.402 PADI6 Zornitza Stark Gene: padi6 has been classified as Amber List (Moderate Evidence).
Growth failure v0.402 PADI6 Zornitza Stark Phenotypes for gene: PADI6 were changed from miscarriages in the family; Preimplantation embryonic lethality 2 OMIM:617234; Short stature; preimplantation embryonic lethality 2 MONDO:0014978; Multi Locus Imprinting Disturbance; IUGR; Beckwith-Wiedemann syndrome to IUGR
Growth failure v0.401 PADI6 Zornitza Stark Mode of inheritance for gene: PADI6 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.400 PADI6 Zornitza Stark reviewed gene: PADI6: Rating: AMBER; Mode of pathogenicity: None; Publications: 33221824, 32928291, 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.400 NLRP7 Zornitza Stark Marked gene: NLRP7 as ready
Growth failure v0.400 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Amber List (Moderate Evidence).
Growth failure v0.400 NLRP7 Zornitza Stark Phenotypes for gene: NLRP7 were changed from hydatidiform mole, recurrent, 1 MONDO:0009273; Short stature; fetal wastage; Hydatidiform mole, recurrent, 1 OMIM:231090; IUGR; Multi Locus Imprinting Disturbance to IUGR
Growth failure v0.399 NLRP7 Zornitza Stark Mode of inheritance for gene: NLRP7 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.398 NLRP7 Zornitza Stark reviewed gene: NLRP7: Rating: AMBER; Mode of pathogenicity: None; Publications: 28561018; Phenotypes: IUGR; Mode of inheritance: Other
Myopathy Superpanel v1.43 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Myopathy - adult onset; Muscular dystrophy_Paediatric; Rhabdomyolysis; Limb Girdle Muscular Dystrophy
Mendeliome v0.9022 CHRM1 Bryony Thompson Marked gene: CHRM1 as ready
Mendeliome v0.9022 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Marked gene: CHRM1 as ready
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4094 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4093 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Mendeliome v0.9022 CHRM1 Bryony Thompson Classified gene: CHRM1 as Amber List (moderate evidence)
Mendeliome v0.9022 CHRM1 Bryony Thompson Gene: chrm1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9021 CHRM1 Bryony Thompson gene: CHRM1 was added
gene: CHRM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CHRM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHRM1 were set to 34212451; 31981491; 12483218
Phenotypes for gene: CHRM1 were set to Neurodevelopmental delay; intellectual disability; autism
Review for gene: CHRM1 was set to AMBER
Added comment: PMID: 34212451 - 2 unrelated cases with de novo missense variants (p.Pro380Leu and p.Phe425Ser), one case with early-onset refractory epilepsy, severe disability, and progressive cerebral and cerebellar atrophy, and the second case with mild dysmorphism, global developmental delay, and moderate intellectual disability. In vitro biochemical analyses of p.Pro380Leu demonstrated a reduction in protein levels, impaired cellular trafficking, and defective activation of intracellular signaling pathways.
PMID: 31981491 - an autism spectrum disorder (no other information on phenotype, except ascertained to have severe neurodevelopmental delay) case with a de novo missense variant p.(Arg210Leu)
PMID: 12483218 - null mouse model assessing memory demonstrated selective cognitive dysfunction.
Sources: Literature
Mendeliome v0.9020 FGF20 Zornitza Stark Marked gene: FGF20 as ready
Mendeliome v0.9020 FGF20 Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9020 FGF20 Zornitza Stark Classified gene: FGF20 as Amber List (moderate evidence)
Mendeliome v0.9020 FGF20 Zornitza Stark Gene: fgf20 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.9019 FGF20 Zornitza Stark gene: FGF20 was added
gene: FGF20 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: FGF20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FGF20 were set to 22698282
Phenotypes for gene: FGF20 were set to Renal hypodysplasia/aplasia 2, MIM#615721
Review for gene: FGF20 was set to AMBER
Added comment: Multiple affected fetuses in a consanguineous family; functional data.
Sources: Expert Review
Mendeliome v0.9018 ITGA8 Zornitza Stark Marked gene: ITGA8 as ready
Mendeliome v0.9018 ITGA8 Zornitza Stark Gene: itga8 has been classified as Green List (High Evidence).
Mendeliome v0.9018 ITGA8 Zornitza Stark Phenotypes for gene: ITGA8 were changed from to Renal hypodysplasia/aplasia 1, MIM# 191830
Mendeliome v0.9017 ITGA8 Zornitza Stark Publications for gene: ITGA8 were set to
Mendeliome v0.9016 ITGA8 Zornitza Stark Mode of inheritance for gene: ITGA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9015 ITGA8 Zornitza Stark reviewed gene: ITGA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 24439109; Phenotypes: Renal hypodysplasia/aplasia 1, MIM# 191830; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.398 NLRP5 Zornitza Stark Marked gene: NLRP5 as ready
Growth failure v0.398 NLRP5 Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence).
Growth failure v0.398 NLRP5 Zornitza Stark Phenotypes for gene: NLRP5 were changed from body asymmetry; Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR to Short stature; Failure to thrive; multilocus imprinting disturbances; IUGR
Growth failure v0.397 NLRP5 Zornitza Stark Mode of inheritance for gene: NLRP5 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.396 NLRP5 Zornitza Stark Classified gene: NLRP5 as Amber List (moderate evidence)
Growth failure v0.396 NLRP5 Zornitza Stark Gene: nlrp5 has been classified as Amber List (Moderate Evidence).
Growth failure v0.395 NLRP5 Zornitza Stark changed review comment from: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP2 in the MOTHER of the patient.

Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother.

Current trio filtering protocols may not account for this adequately.; to: A number of patients with IUGR and failure of catch up have an imprinting error (within the spectrum of Silver Russell syndrome) caused by mutations in NLRP5 in the MOTHER of the patient.

Note that LOF mutations (homozygous or heterozygous mutations) identified in the mother would lead to further patient testing for multi-locus imprinting disturbance through methylation testing or vice versa, methylation abnormalities in offspring may prompt genomic evaluation of the mother.

Current trio filtering protocols may not account for this adequately.
Growth failure v0.395 NLRP5 Zornitza Stark reviewed gene: NLRP5: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.395 STAT3 Zornitza Stark Marked gene: STAT3 as ready
Growth failure v0.395 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Growth failure v0.395 STAT3 Zornitza Stark Classified gene: STAT3 as Green List (high evidence)
Growth failure v0.395 STAT3 Zornitza Stark Gene: stat3 has been classified as Green List (High Evidence).
Growth failure v0.394 Zornitza Stark removed gene:NPR2 from the panel
Mendeliome v0.9015 NPR2 Zornitza Stark Marked gene: NPR2 as ready
Mendeliome v0.9015 NPR2 Zornitza Stark Gene: npr2 has been classified as Green List (High Evidence).
Mendeliome v0.9015 NPR2 Zornitza Stark Phenotypes for gene: NPR2 were changed from to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Epiphyseal chondrodysplasia, Miura type, MIM# 615923; Short stature with nonspecific skeletal abnormalities, MIM# 616255
Mendeliome v0.9014 NPR2 Zornitza Stark Publications for gene: NPR2 were set to
Mendeliome v0.9013 NPR2 Zornitza Stark Mode of inheritance for gene: NPR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9012 NPR2 Zornitza Stark changed review comment from: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.; to: Bi-allelic variants: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.

Mono-allelic variants have been linked to both tall stature and short stature disorders. Multiple families.
Mendeliome v0.9012 NPR2 Zornitza Stark edited their review of gene: NPR2: Changed publications: 31555216, 16384845, 15146390, 22870295, 24057292, 24259409, 16384845, 24471569; Changed phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Epiphyseal chondrodysplasia, Miura type, MIM# 615923, Short stature with nonspecific skeletal abnormalities, MIM# 616255; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9012 NPR2 Zornitza Stark reviewed gene: NPR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31555216, 16384845, 15146390; Phenotypes: Acromesomelic dysplasia, Maroteaux type MIM# 602875, Short stature, disproportionate, Oval vertebral bodies in infancy, Progressive shortening of humerus, radius and ulna in first year, dwarfism, Prominent forehead; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.393 Zornitza Stark removed gene:RAPSN from the panel
Arthrogryposis v0.291 RAPSN Zornitza Stark Marked gene: RAPSN as ready
Arthrogryposis v0.291 RAPSN Zornitza Stark Gene: rapsn has been classified as Green List (High Evidence).
Arthrogryposis v0.291 RAPSN Zornitza Stark Phenotypes for gene: RAPSN were changed from to Fetal akinesia deformation sequence 2 MIM# 618388; AChR deficiency; fetal akinesia; IUGR; micrognathia; hypokinesia; contractures; muscular hypotonia; feeding difficulties; severe respiratory insufficiency; history of miscarriage
Arthrogryposis v0.290 RAPSN Zornitza Stark Publications for gene: RAPSN were set to
Arthrogryposis v0.289 RAPSN Zornitza Stark Mode of inheritance for gene: RAPSN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.288 RAPSN Zornitza Stark reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Mendeliome v0.9012 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region)
Mendeliome v0.9011 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Mendeliome v0.9010 RPS6KA3 Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.9009 RPS6KA3 Zornitza Stark reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.392 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Growth failure v0.392 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Growth failure v0.392 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from Coffin Lowry to Coffin-Lowry syndrome MIM# 303600; Intellectual disability; short stature; delayed bone age; hearing deficit; hypotonia; tapering fingers; abnormal facies (hypertelorism, anteverted nares, prominent frontal region)
Growth failure v0.391 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Growth failure v0.390 RPS6KA3 Zornitza Stark Classified gene: RPS6KA3 as Green List (high evidence)
Growth failure v0.390 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Atrial Fibrillation v0.7 SHOX2 Zornitza Stark gene: SHOX2 was added
gene: SHOX2 was added to Atrial Fibrillation. Sources: Expert Review
Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHOX2 were set to 30443179
Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation
Review for gene: SHOX2 was set to RED
Added comment: Single family reported with LoF in this gene and AF.
Sources: Expert Review
Mendeliome v0.9009 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Mendeliome v0.9009 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Mendeliome v0.9009 SHOX2 Zornitza Stark gene: SHOX2 was added
gene: SHOX2 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: SHOX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SHOX2 were set to 30443179
Phenotypes for gene: SHOX2 were set to Sinus Node Dysfunction; Atrial Fibrillation
Review for gene: SHOX2 was set to RED
Added comment: Single family reported with LoF in this gene and AF.
Sources: Expert Review
Growth failure v0.389 SHOX2 Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.388 SHOX2 Zornitza Stark Marked gene: SHOX2 as ready
Growth failure v0.388 SHOX2 Zornitza Stark Gene: shox2 has been classified as Red List (Low Evidence).
Growth failure v0.388 SHOX2 Zornitza Stark Phenotypes for gene: SHOX2 were changed from to Sinus Node Dysfunction; Atrial Fibrillation
Growth failure v0.387 SHOX2 Zornitza Stark Publications for gene: SHOX2 were set to
Growth failure v0.386 SHOX2 Zornitza Stark Mode of inheritance for gene: SHOX2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.385 SMARCAL1 Zornitza Stark Marked gene: SMARCAL1 as ready
Growth failure v0.385 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Growth failure v0.385 SMARCAL1 Zornitza Stark Phenotypes for gene: SMARCAL1 were changed from to Schimke immune-osseous dysplasia MIM# 242900; T cell deficiency; Short stature; IUGR; spondyloepiphyseal dysplasia; growth retardation; renal dysfunction; lymphocytopaenia; nephropathy; bacterial/viral/fungal infections; may present as SCID; bone marrow failure
Growth failure v0.384 SMARCAL1 Zornitza Stark Publications for gene: SMARCAL1 were set to
Growth failure v0.383 SMARCAL1 Zornitza Stark Mode of inheritance for gene: SMARCAL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.382 SMARCAL1 Zornitza Stark Classified gene: SMARCAL1 as Green List (high evidence)
Growth failure v0.382 SMARCAL1 Zornitza Stark Gene: smarcal1 has been classified as Green List (High Evidence).
Growth failure v0.381 NPR2 Danielle Ariti gene: NPR2 was added
gene: NPR2 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: NPR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NPR2 were set to 31555216; 16384845; 15146390
Phenotypes for gene: NPR2 were set to Acromesomelic dysplasia, Maroteaux type MIM# 602875; Short stature, disproportionate; Oval vertebral bodies in infancy; Progressive shortening of humerus, radius and ulna in first year; dwarfism; Prominent forehead
Review for gene: NPR2 was set to GREEN
Added comment: Over 15 unrelated families; Biallelic (missense, nonsense, frameshift, splice) NPR2 variants; loss of function; multiple mouse models.

Disorder is characterised by severe dwarfism with shortening of the middle and distal segments of the limbs (disproportionate) with skeletal growth falling off sharply after birth.
Sources: Literature
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Marked gene: EPHB4 as ready
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence).
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Classified gene: EPHB4 as Amber List (moderate evidence)
Vascular Malformations_Somatic v1.6 EPHB4 Bryony Thompson Gene: ephb4 has been classified as Amber List (Moderate Evidence).
Vascular Malformations_Somatic v1.5 EPHB4 Bryony Thompson gene: EPHB4 was added
gene: EPHB4 was added to Vascular Malformations_Somatic. Sources: Other
Mode of inheritance for gene: EPHB4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHB4 were set to 31300548; 30760892
Phenotypes for gene: EPHB4 were set to Capillary malformation-arteriovenous malformation
Review for gene: EPHB4 was set to AMBER
Added comment: A single CV-AVM case has been reported with mosaicism of an EPHB4 variant. Mosaicism has also been reported for the other CV-AVM gene, RASA1.
Sources: Other
Growth failure v0.381 STAT3 Danielle Ariti gene: STAT3 was added
gene: STAT3 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: STAT3 were set to 25349174; 25038750; 25359994
Phenotypes for gene: STAT3 were set to Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952; Lymphoproliferation; solid organ autoimmunity; growth failure; recurrent infections; short stature; IUGR; eczema; delayed puberty; dental abnormalities; autoimmune interstitial lung disease; juvenile-onset arthritis; primary hypothyroidism
Mode of pathogenicity for gene: STAT3 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: STAT3 was set to GREEN
Added comment: 18 individuals from 15 unrelated families; monoallelic (missense or in-frame del) variants; gain of function; Multiple mouse models

Individuals exhibited various clinical features, with most presenting with early-onset autoimmunity and growth failure (IUGR, lymphadenopathy, autoimmune cytopaenias, multiorgan autoimmunity, recurrent infections, and short stature (<2SDS)).
Sources: Literature
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Marked gene: HS2ST1 as ready
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Classified gene: HS2ST1 as Green List (high evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.85 HS2ST1 Zornitza Stark Gene: hs2st1 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.84 HS2ST1 Zornitza Stark gene: HS2ST1 was added
gene: HS2ST1 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Expert Review
Mode of inheritance for gene: HS2ST1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HS2ST1 were set to 33159882
Phenotypes for gene: HS2ST1 were set to Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194
Review for gene: HS2ST1 was set to GREEN
Added comment: 4 individuals from 3 unrelated families reported.
Sources: Expert Review
Repeat Disorders v0.123 PHPX Zornitza Stark Tag paediatric-onset tag was added to STR: PHPX.
Growth failure v0.381 RAPSN Danielle Ariti reviewed gene: RAPSN: Rating: GREEN; Mode of pathogenicity: None; Publications: 18179903, 18252226, 28495245, 22482962; Phenotypes: Fetal akinesia deformation sequence 2 MIM# 618388, AChR deficiency, fetal akinesia, IUGR, micrognathia, hypokinesia, contractures, muscular hypotonia, feeding difficulties, severe respiratory insufficiency, history of miscarriage; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mirror movements v1.0 Bryony Thompson promoted panel to version 1.0
Mirror movements v0.9 Bryony Thompson Panel status changed from internal to public
Mirror movements v0.8 DNAL4 Bryony Thompson gene: DNAL4 was added
gene: DNAL4 was added to Mirror movements. Sources: Other
Mode of inheritance for gene: DNAL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAL4 were set to 25098561; 25236653
Phenotypes for gene: DNAL4 were set to Mirror movements 3 MIM#616059
Review for gene: DNAL4 was set to RED
Added comment: Only a single large consanguineous Pakastani family with a homozygous variant reported.
Sources: Other
Mirror movements v0.7 RAD51 Bryony Thompson Marked gene: RAD51 as ready
Mirror movements v0.7 RAD51 Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence).
Mirror movements v0.7 RAD51 Bryony Thompson Classified gene: RAD51 as Green List (high evidence)
Mirror movements v0.7 RAD51 Bryony Thompson Gene: rad51 has been classified as Green List (High Evidence).
Mirror movements v0.6 RAD51 Bryony Thompson gene: RAD51 was added
gene: RAD51 was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD51 were set to 25763452; 22305526; 27830107; 24808016
Phenotypes for gene: RAD51 were set to Mirror movements 2 MIM#614508
Review for gene: RAD51 was set to GREEN
gene: RAD51 was marked as current diagnostic
Added comment: >3 families/probands reported with mirror movements
Sources: Expert list
Growth failure v0.381 RPS6KA3 Danielle Ariti reviewed gene: RPS6KA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 6879200; Phenotypes: Coffin-Lowry syndrome MIM# 303600, Intellectual disability, short stature, delayed bone age, hearing deficit, hypotonia, tapering fingers, abnormal facies (hypertelorism, anteverted nares, prominent frontal region); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.381 SHOX2 Danielle Ariti reviewed gene: SHOX2: Rating: RED; Mode of pathogenicity: None; Publications: 30443179, 16537395, 16537395; Phenotypes: Linked to Sinus Node Dysfunction, Linked to Atrial Fibrillation; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.381 SMARCAL1 Danielle Ariti reviewed gene: SMARCAL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301550, 17089404, 20036229; Phenotypes: Schimke immune-osseous dysplasia MIM# 242900, T cell deficiency, Short stature, IUGR, spondyloepiphyseal dysplasia, growth retardation, renal dysfunction, lymphocytopaenia, nephropathy, bacterial/viral/fungal infections, may present as SCID, bone marrow failure; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mirror movements v0.5 NTN1 Bryony Thompson Marked gene: NTN1 as ready
Mirror movements v0.5 NTN1 Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence).
Mirror movements v0.5 NTN1 Bryony Thompson Classified gene: NTN1 as Green List (high evidence)
Mirror movements v0.5 NTN1 Bryony Thompson Gene: ntn1 has been classified as Green List (High Evidence).
Mirror movements v0.4 NTN1 Bryony Thompson gene: NTN1 was added
gene: NTN1 was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: NTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NTN1 were set to 25763452; 28945198; 33472083
Phenotypes for gene: NTN1 were set to Mirror movements 4 MIM#618264
Review for gene: NTN1 was set to GREEN
gene: NTN1 was marked as current diagnostic
Added comment: Two unrelated families and an unrelated proband with mirror movements. Also, a mouse model recapitulates the human phenotype.
Sources: Expert list
Repeat Disorders v0.123 HPE5 Zornitza Stark Tag paediatric-onset tag was added to STR: HPE5.
Repeat Disorders v0.123 HMNMYO Zornitza Stark Tag paediatric-onset tag was added to STR: HMNMYO.
Repeat Disorders v0.123 HFGS_tract3 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract3.
Repeat Disorders v0.123 HFGS_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract2.
Repeat Disorders v0.123 HFGS_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: HFGS_tract1.
Repeat Disorders v0.123 HDL2 Zornitza Stark Tag adult-onset tag was added to STR: HDL2.
Repeat Disorders v0.123 HD Zornitza Stark Tag adult-onset tag was added to STR: HD.
Repeat Disorders v0.123 GDPAG Zornitza Stark Tag paediatric-onset tag was added to STR: GDPAG.
Repeat Disorders v0.123 FXTAS Zornitza Stark Tag adult-onset tag was added to STR: FXTAS.
Repeat Disorders v0.123 FXS Zornitza Stark Tag paediatric-onset tag was added to STR: FXS.
Repeat Disorders v0.123 FXPOI Zornitza Stark Tag adult-onset tag was added to STR: FXPOI.
Mirror movements v0.3 DCC Bryony Thompson Classified gene: DCC as Green List (high evidence)
Mirror movements v0.3 DCC Bryony Thompson Gene: dcc has been classified as Green List (High Evidence).
Mirror movements v0.2 DCC Bryony Thompson gene: DCC was added
gene: DCC was added to Mirror movements. Sources: Expert list
Mode of inheritance for gene: DCC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DCC were set to 20431009; 25763452; 28250454
Phenotypes for gene: DCC were set to Mirror movements 1 and/or agenesis of the corpus callosum MIM#157600
Review for gene: DCC was set to GREEN
gene: DCC was marked as current diagnostic
Added comment: Well-established and most common cause of congenital mirror movements. >20 cases reported.
Sources: Expert list
Mirror movements v0.1 Bryony Thompson Panel name changed from Osteoporosis to Mirror movements
Panel status changed from deleted to internal
Repeat Disorders v0.123 FTDALS Zornitza Stark Tag adult-onset tag was added to STR: FTDALS.
Repeat Disorders v0.123 FRDA Zornitza Stark Tag paediatric-onset tag was added to STR: FRDA.
Repeat Disorders v0.123 FRAXE Zornitza Stark Tag paediatric-onset tag was added to STR: FRAXE.
Repeat Disorders v0.123 FECD3 Zornitza Stark Tag adult-onset tag was added to STR: FECD3.
Repeat Disorders v0.123 FAME3 Zornitza Stark Tag adult-onset tag was added to STR: FAME3.
Repeat Disorders v0.123 FAME2 Zornitza Stark Tag adult-onset tag was added to STR: FAME2.
Repeat Disorders v0.123 FAME1 Zornitza Stark Tag adult-onset tag was added to STR: FAME1.
Repeat Disorders v0.123 EPM1 Zornitza Stark Tag paediatric-onset tag was added to STR: EPM1.
Repeat Disorders v0.123 EIEE1_tract2 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract2.
Repeat Disorders v0.123 EIEE1_tract1 Zornitza Stark Tag paediatric-onset tag was added to STR: EIEE1_tract1.
Repeat Disorders v0.123 DRPLA Zornitza Stark Tag adult-onset tag was added to STR: DRPLA.
Tag paediatric-onset tag was added to STR: DRPLA.
Repeat Disorders v0.123 DM2 Zornitza Stark Tag adult-onset tag was added to STR: DM2.
Repeat Disorders v0.123 DM1 Zornitza Stark Tag adult-onset tag was added to STR: DM1.
Tag paediatric-onset tag was added to STR: DM1.
Repeat Disorders v0.123 DBQD2 Zornitza Stark Tag paediatric-onset tag was added to STR: DBQD2.
Repeat Disorders v0.123 CJD Zornitza Stark Tag adult-onset tag was added to STR: CJD.
Repeat Disorders v0.123 CCHS Zornitza Stark Tag paediatric-onset tag was added to STR: CCHS.
Repeat Disorders v0.123 CANVAS Zornitza Stark Tag adult-onset tag was added to STR: CANVAS.
Repeat Disorders v0.123 BPES Zornitza Stark Tag paediatric-onset tag was added to STR: BPES.
Growth failure v0.381 MSTO1 Zornitza Stark Marked gene: MSTO1 as ready
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.381 MSTO1 Zornitza Stark Classified gene: MSTO1 as Green List (high evidence)
Growth failure v0.381 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Growth failure v0.380 MSTO1 Zornitza Stark reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28544275, 29339779, 30684668; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9007 KCTD7 Zornitza Stark Marked gene: KCTD7 as ready
Mendeliome v0.9007 KCTD7 Zornitza Stark Gene: kctd7 has been classified as Green List (High Evidence).
Mendeliome v0.9007 KCTD7 Zornitza Stark Phenotypes for gene: KCTD7 were changed from to Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)
Mendeliome v0.9006 KCTD7 Zornitza Stark Publications for gene: KCTD7 were set to
Mendeliome v0.9005 KCTD7 Zornitza Stark Mode of inheritance for gene: KCTD7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.9004 KCTD7 Kristin Rigbye reviewed gene: KCTD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 22693283, 22748208; Phenotypes: Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Clefting disorders v0.139 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Clefting disorders v0.138 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4092 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Intellectual disability syndromic and non-syndromic v0.4091 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Genetic Epilepsy v0.1181 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Genetic Epilepsy v0.1180 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Mendeliome v0.9004 ANKRD17 Zornitza Stark Phenotypes for gene: ANKRD17 were changed from Intellectual disability; dysmorphic features to Chopra-Amiel-Gordan syndrome, MIM# 619504; Intellectual disability; dysmorphic features
Mendeliome v0.9003 ANKRD17 Zornitza Stark edited their review of gene: ANKRD17: Changed phenotypes: Chopra-Amiel-Gordan syndrome, MIM# 619504, Intellectual disability, dysmorphic features
Growth failure v0.380 RPL10 Zornitza Stark Marked gene: RPL10 as ready
Growth failure v0.380 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Growth failure v0.380 RPL10 Zornitza Stark Phenotypes for gene: RPL10 were changed from Mental retardation, X-linked, syndromic, 35 to Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998; severe growth retardation; intrauterine growth restriction; short stature; dysmorphic facial features (prognathism, dental crowding, thin upper lip); microcephaly; seizures; hypotonia; genitourinary abnormalities; cerebellar hypoplasia
Growth failure v0.379 RPL10 Zornitza Stark Publications for gene: RPL10 were set to 25316788
Growth failure v0.378 RPL10 Zornitza Stark Classified gene: RPL10 as Green List (high evidence)
Growth failure v0.378 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Mendeliome v0.9003 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9003 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face; Brachydactyly, type B1 MIM# 113000; hypoplasia/aplasia of distal phalanges and nails (2-5)
Mendeliome v0.9002 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Mendeliome v0.9001 ROR2 Zornitza Stark Mode of inheritance for gene: ROR2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.9000 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.377 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Growth failure v0.377 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Growth failure v0.377 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow to Robinow syndrome, autosomal recessive MIM# 268310; hypertelorism; short stature; mesomelic shortening of the limbs; hypoplastic genitalia; rib/vertebral anomalies; abnormal morphogenesis of the face
Growth failure v0.376 ROR2 Zornitza Stark Publications for gene: ROR2 were set to
Growth failure v0.375 ROR2 Zornitza Stark Classified gene: ROR2 as Green List (high evidence)
Growth failure v0.375 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Mendeliome v0.9000 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Mendeliome v0.9000 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Mendeliome v0.8999 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Mendeliome v0.8998 PROP1 Zornitza Stark Mode of inheritance for gene: PROP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 PROP1 Zornitza Stark reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.374 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Growth failure v0.374 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.374 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined to Pituitary hormone deficiency, combined, 2 MIM# 262600; Ateliotic dwarfism with hypogonadism; growth failure; short stature; failure to thrive; absent sexual development at puberty; GH, PRL, TSH, LH, and FSH deficiency; pituitary hypoplasia
Growth failure v0.373 PROP1 Zornitza Stark Publications for gene: PROP1 were set to
Growth failure v0.372 PROP1 Zornitza Stark Classified gene: PROP1 as Green List (high evidence)
Growth failure v0.372 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Marked gene: PROKR2 as ready
Growth failure v0.371 PROKR2 Zornitza Stark Gene: prokr2 has been classified as Red List (Low Evidence).
Growth failure v0.371 PROKR2 Zornitza Stark Phenotypes for gene: PROKR2 were changed from hypopituitarism, Hypoplastic corpus callosum, normal or small anterior pituitary, Club foot, syrinx spinal cord, microcephaly, epilepsy to Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200; Kallmann syndrome (KS); normosmic idiopathic hypogonadotropic hypogonadism (nIHH); Anosmia; GnRH deficiency; cleft lip and palate; renal agenesis; Hypogonadotropic hypogonadism; low testosterone/ estradiol; Absent/ partial Puberty; Hearing loss
Growth failure v0.370 PROKR2 Zornitza Stark Publications for gene: PROKR2 were set to 22319038
Growth failure v0.369 PROKR2 Zornitza Stark Mode of inheritance for gene: PROKR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 RPL10 Danielle Ariti Deleted their comment
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti edited their review of gene: RPL10: Added comment: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; Changed phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, short stature, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood (Short stature), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti changed review comment from: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, severe growth restriction (IUGR), genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.; to: 9 males from 3 unrelated families reported with hemizygous missense (altering highly conserved residue) variants in RPL10 gene; one mouse model.

Patients typically present with intellectual disability, psychomotor delay, microcephaly, IUGR and severe growth restriction infancy-childhood, genitourinary abnormalities, cerebellar syndrome, seizures and dysmorphic facial features.
Growth failure v0.368 RPL10 Danielle Ariti reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Intellectual developmental disorder, X-linked, syndromic, 35 MIM# 300998, severe growth retardation, intrauterine growth restriction, dysmorphic facial features (prognathism, dental crowding, thin upper lip), microcephaly, seizures, hypotonia, genitourinary abnormalities, cerebellar hypoplasia; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature in early childhood is not a prominent feature; Changed rating: RED
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1).

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 ROR2 Danielle Ariti reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10932186, 10932187, 10986040, 19461659; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310, hypertelorism, short stature, mesomelic shortening of the limbs, hypoplastic genitalia, rib/vertebral anomalies, abnormal morphogenesis of the face, Brachydactyly, type B1 MIM# 113000, hypoplasia/aplasia of distal phalanges and nails (2-5); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.368 PROP1 Danielle Ariti reviewed gene: PROP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301521, 31090814; Phenotypes: Pituitary hormone deficiency, combined, 2 MIM# 262600, Ateliotic dwarfism with hypogonadism, growth failure, short stature, failure to thrive, absent sexual development at puberty, GH, PRL, TSH, LH, and FSH deficiency, pituitary hypoplasia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 PROKR2 Danielle Ariti changed review comment from: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; to: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure/ short stature is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/ partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their review
Growth failure v0.368 PROKR2 Danielle Ariti Deleted their comment
Growth failure v0.368 PROKR2 Danielle Ariti edited their review of gene: PROKR2: Added comment: Autosomal dominant disorder, however often association with mutations in other genes (KAL1 and FGFR1) and

Over 20 unrelated individuals with the disorder displaying heterozygous (frameshift/missense) variants.

Anosmia accompanied by GnRH deficiency and delayed puberty are the typical features.
Associated phenotypes such as cleft lip and palate, renal agenesis, and other neurological and skeletal abnormalities occur with variable frequency.

Growth failure is not a prominent feature; Changed rating: AMBER
Growth failure v0.368 PROKR2 Danielle Ariti reviewed gene: PROKR2: Rating: RED; Mode of pathogenicity: None; Publications: 18559922, 29161432, 17054399; Phenotypes: Hypogonadotropic hypogonadism 3 with or without anosmia MIM# 244200, Kallmann syndrome (KS), Normosmic idiopathic hypogonadotropic hypogonadism (nIHH), Anosmia, GnRH deficiency, cleft lip and palate, renal agenesis, Hypogonadotropic hypogonadism, low testosterone/ estradiol, Absent/partial Puberty, Hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Marked gene: WRN as ready
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.113 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Cancer Predisposition_Paediatric v0.112 WRN Zornitza Stark Publications for gene: WRN were set to
Cancer Predisposition_Paediatric v0.111 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.110 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8997 WRN Zornitza Stark Marked gene: WRN as ready
Mendeliome v0.8997 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Mendeliome v0.8997 WRN Zornitza Stark Phenotypes for gene: WRN were changed from to Werner syndrome, MIM# 277700; MONDO:0010196
Mendeliome v0.8996 WRN Zornitza Stark Publications for gene: WRN were set to
Mendeliome v0.8995 WRN Zornitza Stark Mode of inheritance for gene: WRN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8994 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.368 WRN Zornitza Stark Marked gene: WRN as ready
Growth failure v0.368 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.368 WRN Zornitza Stark Phenotypes for gene: WRN were changed from Werner syndrome to Werner syndrome, MIM# 277700; MONDO:0010196
Growth failure v0.367 WRN Zornitza Stark Publications for gene: WRN were set to
Growth failure v0.366 WRN Zornitza Stark Classified gene: WRN as Green List (high evidence)
Growth failure v0.366 WRN Zornitza Stark Gene: wrn has been classified as Green List (High Evidence).
Growth failure v0.365 WRN Zornitza Stark reviewed gene: WRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28476236, 8602509, 8968742, 9012406; Phenotypes: Werner syndrome, MIM# 277700, MONDO:0010196; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.17 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1 (613038) to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Pituitary hormone deficiency v0.16 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Pituitary hormone deficiency v0.15 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.148 CJD Bryony Thompson Marked STR: CJD as ready
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.148 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.147 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8994 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Mendeliome v0.8994 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8994 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Mendeliome v0.8993 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Mendeliome v0.8992 POU1F1 Zornitza Stark Mode of inheritance for gene: POU1F1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8991 POU1F1 Zornitza Stark reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.146 Bryony Thompson removed STR:PRNP from the panel
Repeat Disorders v0.123 CJD Bryony Thompson Marked STR: CJD as ready
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.123 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Repeat Disorders v0.123 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Repeat Disorders v0.122 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.8991 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Growth failure v0.365 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Growth failure v0.365 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from GH, PRL deficiencies; variable degree of TSH deficiency to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)
Growth failure v0.364 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Growth failure v0.363 POU1F1 Zornitza Stark Classified gene: POU1F1 as Green List (high evidence)
Growth failure v0.363 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Mendeliome v0.8991 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Mendeliome v0.8991 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.364 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Regression v0.364 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Regression v0.363 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Regression. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Growth failure v0.362 POU1F1 Danielle Ariti reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Regression v0.362 NOP56 Bryony Thompson Classified gene: NOP56 as No list
Regression v0.362 NOP56 Bryony Thompson Added comment: Comment on list classification: STR expansion is the only reported cause of disease for this gene. An STR has been added to this panel under SCA36
Regression v0.362 NOP56 Bryony Thompson Gene: nop56 has been removed from the panel.
Mendeliome v0.8990 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Literature
Repeat Disorders v0.121 OPDM2 Bryony Thompson Marked STR: OPDM2 as ready
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.121 OPDM2 Bryony Thompson Classified STR: OPDM2 as Green List (high evidence)
Repeat Disorders v0.121 OPDM2 Bryony Thompson Str: opdm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.120 OPDM2 Bryony Thompson STR: OPDM2 was added
STR: OPDM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM2 were set to 32413282; 33374016
Phenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940
Review for STR: OPDM2 was set to GREEN
STR: OPDM2 was marked as clinically relevant
Added comment: NM_005716.4:c.-211GGC[X]
>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32.
Sources: Expert list
Mendeliome v0.8989 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Mendeliome v0.8989 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Mendeliome v0.8989 GIPC1 Bryony Thompson Classified gene: GIPC1 as No list
Mendeliome v0.8989 GIPC1 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under OPDM2
Mendeliome v0.8989 GIPC1 Bryony Thompson Gene: gipc1 has been removed from the panel.
Mendeliome v0.8988 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Mendeliome v0.8988 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Marked STR: FAME3 as ready
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.119 FAME3 Bryony Thompson Classified STR: FAME3 as Green List (high evidence)
Repeat Disorders v0.119 FAME3 Bryony Thompson Str: fame3 has been classified as Green List (High Evidence).
Repeat Disorders v0.118 FAME3 Bryony Thompson STR: FAME3 was added
STR: FAME3 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME3 were set to 31664039
Phenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: FAME3 was set to GREEN
STR: FAME3 was marked as clinically relevant
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Mendeliome v0.8987 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.85 BRWD3 Chirag Patel Classified gene: BRWD3 as Green List (high evidence)
Macrocephaly_Megalencephaly v0.85 BRWD3 Chirag Patel Gene: brwd3 has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.84 BRWD3 Chirag Patel gene: BRWD3 was added
gene: BRWD3 was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: BRWD3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: BRWD3 were set to PMID: 30628072, 24462886
Phenotypes for gene: BRWD3 were set to Intellectual developmental disorder, X-linked 93; OMIM # 300659
Review for gene: BRWD3 was set to GREEN
Added comment: 10 patients (from 6 unrelated families) with ID, macrocephaly and dysmorphic facial features.
Sources: Literature
Mendeliome v0.8986 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Mendeliome v0.8986 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Mendeliome v0.8986 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Overgrowth v1.4 BRWD3 Chirag Patel Classified gene: BRWD3 as Green List (high evidence)
Overgrowth v1.4 BRWD3 Chirag Patel Gene: brwd3 has been classified as Green List (High Evidence).
Overgrowth v1.3 BRWD3 Chirag Patel reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, OMIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Genetic Epilepsy v0.1180 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.1179 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 11701600; 24114805; 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Classified gene: STARD7 as No list
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Added comment: Comment on list classification: Added to panel as an STR under FAME2
Genetic Epilepsy v0.1178 STARD7 Bryony Thompson Gene: stard7 has been removed from the panel.
Repeat Disorders v0.117 FAME2 Bryony Thompson Marked STR: FAME2 as ready
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.117 FAME2 Bryony Thompson Classified STR: FAME2 as Green List (high evidence)
Repeat Disorders v0.117 FAME2 Bryony Thompson Str: fame2 has been classified as Green List (High Evidence).
Repeat Disorders v0.116 FAME2 Bryony Thompson STR: FAME2 was added
STR: FAME2 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME2 were set to 31664034
Phenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876
Review for STR: FAME2 was set to GREEN
STR: FAME2 was marked as clinically relevant
Added comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]
158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved.
Sources: Literature
Macrocephaly_Megalencephaly v0.83 PPP2R5D Chirag Patel Classified gene: PPP2R5D as Green List (high evidence)
Macrocephaly_Megalencephaly v0.83 PPP2R5D Chirag Patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Overgrowth v1.3 PPP2R5D Chirag Patel Classified gene: PPP2R5D as Green List (high evidence)
Overgrowth v1.3 PPP2R5D Chirag Patel Gene: ppp2r5d has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.82 PPP2R5D Chirag Patel gene: PPP2R5D was added
gene: PPP2R5D was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPP2R5D were set to PMID: 26168268, 25972378, 25533962; 34448180
Phenotypes for gene: PPP2R5D were set to Mental retardation, autosomal dominant 35, MIM# 616355
Review for gene: PPP2R5D was set to GREEN
Added comment: Phenotype of macrocephaly is consistent, and multiple patients reported
Sources: Literature
Overgrowth v1.2 PPP2R5D Chirag Patel reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Repeat Disorders v0.115 FAME4 Bryony Thompson Marked STR: FAME4 as ready
Repeat Disorders v0.115 FAME4 Bryony Thompson Str: fame4 has been classified as Red List (Low Evidence).
Repeat Disorders v0.115 FAME4 Bryony Thompson STR: FAME4 was added
STR: FAME4 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME4 were set to 31539032
Phenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127
Review for STR: FAME4 was set to RED
Added comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease.
Sources: Literature
Repeat Disorders v0.114 OPML1 Bryony Thompson Marked STR: OPML1 as ready
Repeat Disorders v0.114 OPML1 Bryony Thompson Str: opml1 has been classified as Red List (Low Evidence).
Repeat Disorders v0.114 OPML1 Bryony Thompson STR: OPML1 was added
STR: OPML1 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPML1 were set to 31332380
Phenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637
Review for STR: OPML1 was set to RED
Added comment: NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Mendeliome v0.8985 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986; 24355708
Mendeliome v0.8984 PNPLA6 Zornitza Stark changed review comment from: Ataxia is part of the phenotype.
Sources: Expert list; to: Variants in this gene are associated with multiple phenotypes.

Oliver-McFarlane syndrome is a rare congenital disorder characterized by trichomegaly, severe chorioretinal atrophy and multiple pituitary hormone deficiencies, including growth hormone. At least 10 families reported.

Laurence-Moon syndrome has a clinical presentation similar to that of Oliver-McFarlane syndrome, including chorioretinopathy and pituitary dysfunction, but with childhood onset of ataxia, peripheral neuropathy, and spastic paraplegia and without trichomegaly. Single family reported.
Mendeliome v0.8984 PNPLA6 Zornitza Stark edited their review of gene: PNPLA6: Changed publications: 25480986, 33818269, 32758583, 30097146; Changed phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800
Growth failure v0.362 PNPLA6 Zornitza Stark Marked gene: PNPLA6 as ready
Growth failure v0.362 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.362 PNPLA6 Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Oliver-Mcfarlane syndrome, Trichomegaly, GH deficiency, retinal dystrophy, hypogonadotrophic hypogonadism to Oliver-McFarlane syndrome, MIM# 275400; Laurence-Moon syndrome, MIM# 245800
Growth failure v0.361 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to 25480986
Growth failure v0.360 PNPLA6 Zornitza Stark Classified gene: PNPLA6 as Green List (high evidence)
Growth failure v0.360 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Growth failure v0.359 PNPLA6 Zornitza Stark reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480986, 33818269, 32758583, 30097146; Phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8984 PI4KA Zornitza Stark Phenotypes for gene: PI4KA were changed from Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 to Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531; Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Mendeliome v0.8983 PI4KA Zornitza Stark Publications for gene: PI4KA were set to 25855803
Mendeliome v0.8982 PI4KA Zornitza Stark Classified gene: PI4KA as Green List (high evidence)
Mendeliome v0.8982 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Mendeliome v0.8981 PI4KA Zornitza Stark changed review comment from: Single family reported, aware of at least one other yet to be published family identified internally.; to: PMG: Single family reported, aware of at least one other yet to be published family identified internally.
Mendeliome v0.8981 PI4KA Zornitza Stark edited their review of gene: PI4KA: Added comment: Neurodevelopmental syndrome with hypomyelinating leukodystrophy: 10 unrelated patients harbouring biallelic variants in PI4KA reported with a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.; Changed rating: GREEN; Changed publications: 25855803, 34415322; Changed phenotypes: Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531, Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Hereditary Spastic Paraplegia v1.17 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Hereditary Spastic Paraplegia v1.17 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy v0.232 PI4KA Zornitza Stark Marked gene: PI4KA as ready
Leukodystrophy v0.232 PI4KA Zornitza Stark Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.17 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Hereditary Spastic Paraplegia v1.17 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.16 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4091 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Leukodystrophy v0.232 PI4KA Chirag Patel Classified gene: PI4KA as Green List (high evidence)
Leukodystrophy v0.232 PI4KA Chirag Patel Gene: pi4ka has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4090 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Leukodystrophy v0.231 PI4KA Chirag Patel gene: PI4KA was added
gene: PI4KA was added to Leukodystrophy - paediatric. Sources: Literature
Mode of inheritance for gene: PI4KA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PI4KA were set to PMID: 34415322
Phenotypes for gene: PI4KA were set to Neurodevelopmental syndrome with hypomyelinating leukodystrophy
Review for gene: PI4KA was set to GREEN
Added comment: Used WES/WGS to identify 10 unrelated patients harbouring biallelic variants in PI4KA, and a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.
Sources: Literature
Repeat Disorders v0.113 OPDM1 Bryony Thompson Marked STR: OPDM1 as ready
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.113 OPDM1 Bryony Thompson Classified STR: OPDM1 as Green List (high evidence)
Repeat Disorders v0.113 OPDM1 Bryony Thompson Str: opdm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.112 OPDM1 Bryony Thompson STR: OPDM1 was added
STR: OPDM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: OPDM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: OPDM1 were set to 31332380; 34047774
Phenotypes for STR: OPDM1 were set to Oculopharyngodistal myopathy 1 MIM#164310
Review for STR: OPDM1 was set to GREEN
STR: OPDM1 was marked as clinically relevant
Added comment: NM_013437.5:c.-102CGG[X]
RNA-mediated toxicity is thought to be the mechanism of disease. Sixty-five Japanese patients with oculopharyngodistal myopathy (OPDM) from 59 families with CGG repeat expansions in LRP12. This represents the most common OPDM subtype among all patients in Japan with genetically diagnosed OPDM.
Normal: 13 to 45 repeats.
Pathogenic: 85 to 289 repeats.
Sources: Expert list
Early-onset Dementia v0.145 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.145 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.144 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.143 Bryony Thompson removed STR:NIID from the panel
Hereditary Neuropathy v0.117 NIID Bryony Thompson Marked STR: NIID as ready
Hereditary Neuropathy v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy v0.117 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Hereditary Neuropathy v0.117 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Hereditary Neuropathy v0.116 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Hereditary Neuropathy - complex. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Hereditary Neuropathy v0.115 Bryony Thompson removed STR:NIID from the panel
Regression v0.361 NIID Bryony Thompson Marked STR: NIID as ready
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.361 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Regression v0.361 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Regression v0.360 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Regression. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Regression v0.359 Bryony Thompson removed STR:NIID from the panel
Mendeliome v0.8981 NIID Bryony Thompson Marked STR: NIID as ready
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8981 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Mendeliome v0.8981 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Mendeliome v0.8980 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Mendeliome. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Mendeliome v0.8979 Bryony Thompson removed STR:NIID from the panel
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Parkinson disease v0.120 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.119 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Parkinson disease v0.118 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.111 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.111 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.111 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.110 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Expert list
Repeat Disorders v0.109 Bryony Thompson removed STR:NIID from the panel
Growth failure v0.359 PITX2 Zornitza Stark Marked gene: PITX2 as ready
Growth failure v0.359 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.359 PITX2 Zornitza Stark Phenotypes for gene: PITX2 were changed from AXENFELD-RIEGER SYNDROME to Axenfeld-Rieger syndrome, type 1, MIM# 180500
Growth failure v0.358 PITX2 Zornitza Stark Classified gene: PITX2 as Green List (high evidence)
Growth failure v0.358 PITX2 Zornitza Stark Gene: pitx2 has been classified as Green List (High Evidence).
Growth failure v0.357 PITX2 Zornitza Stark reviewed gene: PITX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Axenfeld-Rieger syndrome, type 1, MIM# 180500; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8978 SUCO Bryony Thompson Marked gene: SUCO as ready
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8978 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Mendeliome v0.8978 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8977 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Literature
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Marked gene: SUCO as ready
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Classified gene: SUCO as Amber List (moderate evidence)
Osteogenesis Imperfecta and Osteoporosis v0.63 SUCO Bryony Thompson Gene: suco has been classified as Amber List (Moderate Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.62 SUCO Bryony Thompson gene: SUCO was added
gene: SUCO was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: SUCO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SUCO were set to 29620724; 20440000
Phenotypes for gene: SUCO were set to Osteogenesis imperfecta
Review for gene: SUCO was set to AMBER
Added comment: A single case with diffuse osteopenia, multiple fractures with limb deformities, and short long bones, with biallelic variants (a missense and a splice site variant). Also, a null mouse model with acute onset skeletal defects that include impaired bone formation and spontaneous fractures.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Classified gene: ANO5 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.61 ANO5 Bryony Thompson Gene: ano5 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.60 ANO5 Bryony Thompson gene: ANO5 was added
gene: ANO5 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: ANO5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANO5 were set to 30712070; 15124103; 30641283; 29175271
Phenotypes for gene: ANO5 were set to Gnathodiaphyseal dysplasia MIM#166260
Review for gene: ANO5 was set to GREEN
gene: ANO5 was marked as current diagnostic
Added comment: Bone fragility is a feature of the condition, which is an overlapping feature with OI and could be a differential diagnosis. >3 families/probands and a null mouse model reported.
Sources: Expert list
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Marked gene: XYLT2 as ready
Skeletal dysplasia v0.113 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Classified gene: XYLT2 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v0.59 XYLT2 Bryony Thompson Gene: xylt2 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v0.58 XYLT2 Bryony Thompson gene: XYLT2 was added
gene: XYLT2 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: XYLT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: XYLT2 were set to 26027496; 26987875
Phenotypes for gene: XYLT2 were set to Spondyloocular syndrome MIM#605822
Review for gene: XYLT2 was set to GREEN
gene: XYLT2 was marked as current diagnostic
Added comment: Generalised osteoporosis and recurrent fractures are a feature of the condition, which overlaps with the OI phenotype. >3 families reported.
Sources: Expert list
Growth failure v0.357 OTX2 Zornitza Stark Marked gene: OTX2 as ready
Growth failure v0.357 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.357 OTX2 Zornitza Stark Phenotypes for gene: OTX2 were changed from Microcephaly, bilateral anopthalmia, developmental delay, cleft palate to Pituitary hormone deficiency, combined, 6, MIM# 613986; Microphthalmia, syndromic 5, MIM# 610125
Growth failure v0.356 OTX2 Zornitza Stark Publications for gene: OTX2 were set to 18728160
Growth failure v0.355 OTX2 Zornitza Stark Classified gene: OTX2 as Green List (high evidence)
Growth failure v0.355 OTX2 Zornitza Stark Gene: otx2 has been classified as Green List (High Evidence).
Growth failure v0.354 OTX2 Zornitza Stark reviewed gene: OTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728160, 33950863, 15846561; Phenotypes: Pituitary hormone deficiency, combined, 6, MIM# 613986, Microphthalmia, syndromic 5, MIM# 610125; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.354 MCM5 Zornitza Stark Marked gene: MCM5 as ready
Growth failure v0.354 MCM5 Zornitza Stark Gene: mcm5 has been classified as Red List (Low Evidence).
Growth failure v0.354 MCM5 Zornitza Stark Phenotypes for gene: MCM5 were changed from ?Meier-Gorlin syndrome 8 to Meier-Gorlin syndrome 8 (MIM#617564)
Growth failure v0.353 MCM5 Zornitza Stark reviewed gene: MCM5: Rating: RED; Mode of pathogenicity: None; Publications: 28198391; Phenotypes: Meier-Gorlin syndrome 8 (MIM#617564); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.353 LIG1 Zornitza Stark Marked gene: LIG1 as ready
Growth failure v0.353 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.353 LIG1 Zornitza Stark Phenotypes for gene: LIG1 were changed from immunodeficiency, sun sensitivity, growth reatrdation to Combined immunodeficiency; Lymphopaenia; Hypogammaglobulinaemia; Recurrent bacterial and viral infections; Growth retardation; Sun sensitivity, radiation sensitivity; Macrocytosis
Growth failure v0.352 LIG1 Zornitza Stark Publications for gene: LIG1 were set to 1581963, 1351188
Growth failure v0.351 LIG1 Zornitza Stark Classified gene: LIG1 as Green List (high evidence)
Growth failure v0.351 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Growth failure v0.350 LIG1 Zornitza Stark reviewed gene: LIG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30395541; Phenotypes: Combined immunodeficiency, Lymphopaenia, Hypogammaglobulinaemia, Recurrent bacterial and viral infections, Growth retardation, Sun sensitivity, radiation sensitivity, Macrocytosis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v0.57 WNT4 Bryony Thompson gene: WNT4 was added
gene: WNT4 was added to Osteogenesis Imperfecta. Sources: Expert list
Mode of inheritance for gene: WNT4 was set to Unknown
Publications for gene: WNT4 were set to 25108526; 26733379
Phenotypes for gene: WNT4 were set to Osteoporosis
Review for gene: WNT4 was set to RED
Added comment: Mouse model where recombinant Wnt4 alleviated bone loss and inflammation by inhibiting NF-κB in vivo in mouse models of bone disease. However, no reported association with Mendelian disease. A common SNP (rs10917157) has been associated with bone mineral density.
Sources: Expert list
Mirror movements v0.0 Bryony Thompson Panel deleted
Growth failure v0.350 LHX4 Zornitza Stark Marked gene: LHX4 as ready
Growth failure v0.350 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.350 LHX4 Zornitza Stark Phenotypes for gene: LHX4 were changed from hypopituitarism to Pituitary hormone deficiency, combined, 4, MIM# 262700
Growth failure v0.349 LHX4 Zornitza Stark Publications for gene: LHX4 were set to 11567216, 18073311
Growth failure v0.348 LHX4 Zornitza Stark Classified gene: LHX4 as Green List (high evidence)
Growth failure v0.348 LHX4 Zornitza Stark Gene: lhx4 has been classified as Green List (High Evidence).
Growth failure v0.347 LHX4 Zornitza Stark reviewed gene: LHX4: Rating: GREEN; Mode of pathogenicity: None; Publications: 11567216, 17527005, 18073311; Phenotypes: Pituitary hormone deficiency, combined, 4, MIM# 262700; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.347 LHX3 Zornitza Stark Marked gene: LHX3 as ready
Growth failure v0.347 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Growth failure v0.347 LHX3 Zornitza Stark Phenotypes for gene: LHX3 were changed from GH, TSH, LH, FSH, PRL deficiencies to Pituitary hormone deficiency, combined, 3, MIM# 221750
Growth failure v0.346 LHX3 Zornitza Stark Publications for gene: LHX3 were set to
Growth failure v0.345 LHX3 Zornitza Stark Classified gene: LHX3 as Green List (high evidence)
Growth failure v0.345 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Growth failure v0.344 LHX3 Zornitza Stark reviewed gene: LHX3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10835633, 16394081, 17327381, 18407919; Phenotypes: Pituitary hormone deficiency, combined, 3, MIM# 221750; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.344 KHDC3L Zornitza Stark Marked gene: KHDC3L as ready
Growth failure v0.344 KHDC3L Zornitza Stark Gene: khdc3l has been classified as Red List (Low Evidence).
Growth failure v0.344 KHDC3L Zornitza Stark Phenotypes for gene: KHDC3L were changed from pregnancy loss; Hydatidiform mole, recurrent, 2 OMIM:614293; hydatidiform mole, recurrent, 2 MONDO:0013671; Failure to thrive; IUGR to Silver-Russell syndrome
Growth failure v0.343 KHDC3L Zornitza Stark Mode of inheritance for gene: KHDC3L was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.342 KHDC3L Zornitza Stark reviewed gene: KHDC3L: Rating: RED; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: Silver-Russell syndrome; Mode of inheritance: Other
Growth failure v0.342 Zornitza Stark removed gene:INTS8 from the panel
Growth failure v0.341 INSR Zornitza Stark Marked gene: INSR as ready
Growth failure v0.341 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Growth failure v0.341 INSR Zornitza Stark Phenotypes for gene: INSR were changed from Leprechaunism to Leprechaunism, MIM# 246200; Rabson-Mendenhall syndrome, MIM# 262190
Growth failure v0.340 INSR Zornitza Stark Publications for gene: INSR were set to
Growth failure v0.339 INSR Zornitza Stark Classified gene: INSR as Green List (high evidence)
Growth failure v0.339 INSR Zornitza Stark Gene: insr has been classified as Green List (High Evidence).
Growth failure v0.338 INSR Zornitza Stark reviewed gene: INSR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8105179, 7815442, 33995269, 33224016, 33048476, 2121734, 9449692; Phenotypes: Leprechaunism, MIM# 246200, Rabson-Mendenhall syndrome, MIM# 262190; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v0.131 Bryony Thompson removed STR:NIID from the panel
Early-onset Dementia v0.142 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.142 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.141 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.140 Bryony Thompson removed STR:NIID from the panel
Repeat Disorders v0.108 NIID Bryony Thompson Marked STR: NIID as ready
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.108 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Repeat Disorders v0.108 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Repeat Disorders v0.107 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Miscellaneous Metabolic Disorders v1.8 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.7 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Miscellaneous Metabolic Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.106 GDPAG Bryony Thompson Marked STR: GDPAG as ready
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Repeat Disorders v0.106 GDPAG Bryony Thompson Classified STR: GDPAG as Green List (high evidence)
Repeat Disorders v0.106 GDPAG Bryony Thompson Str: gdpag has been classified as Green List (High Evidence).
Miscellaneous Metabolic Disorders v1.6 Bryony Thompson removed STR:GLS from the panel
Repeat Disorders v0.105 GDPAG Bryony Thompson STR: GDPAG was added
STR: GDPAG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: GDPAG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GDPAG were set to 30970188
Phenotypes for STR: GDPAG were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GDPAG was set to GREEN
STR: GDPAG was marked as clinically relevant
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Literature
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Marked STR: FAME1_TTTGA as ready
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson Str: fame1_tttga has been classified as Red List (Low Evidence).
Repeat Disorders v0.104 FAME1_TTTGA Bryony Thompson STR: FAME1_TTTGA was added
STR: FAME1_TTTGA was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME1_TTTGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME1_TTTGA were set to 31483537
Phenotypes for STR: FAME1_TTTGA were set to familial cortical myoclonic tremor with epilepsy
Review for STR: FAME1_TTTGA was set to RED
Added comment: A single family with 2 cases and 1 asymptomatic carrier with the repeat allele (TTTTA)114-123 (TTTGA)108-116, instead of the TTTCA FAME1 repeat.
Sources: Literature
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as Amber List (moderate evidence)
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Added comment: Comment on list classification: Used the pathogenic cut-off of 400 repeats from original CANVAS repeat
Repeat Disorders v0.103 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.102 CANVAS_ACAGG Bryony Thompson STR: CANVAS_ACAGG was added
STR: CANVAS_ACAGG was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: CANVAS_ACAGG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Phenotypes for STR: CANVAS_ACAGG were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome; fasciculations; elevated serum creatine kinase levels; denervation
Review for STR: CANVAS_ACAGG was set to AMBER
Added comment: A novel RFC1 repeat expansion motif, (ACAGG)exp, identified in three affected individuals from 2 families in an Asian-Pacific cohort and one Japanese individual for CANVAS. Southern blot was used to identify the repeat was ~1000kb in one of the cases, equivalent to ~1000 repeats.
Sources: Literature
Repeat Disorders v0.101 CANVAS Bryony Thompson Marked STR: CANVAS as ready
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.101 CANVAS Bryony Thompson Classified STR: CANVAS as Green List (high evidence)
Repeat Disorders v0.101 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Repeat Disorders v0.100 CANVAS Bryony Thompson STR: CANVAS was added
STR: CANVAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS were set to 30926972; 32851396; 33237689; 31230722
Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575
Review for STR: CANVAS was set to GREEN
STR: CANVAS was marked as clinically relevant
Added comment: NM_001204747​.1:c.132+2923_2927AAAAG[X]
Simple tandem repeat (AAAAG)n replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Maori population-specific CANVAS configuration (AAAGG)10-25(AAGGG)exp. (AAAGG)n repeat alone is not pathogenic. Mechanism of disease is unknown.
Normal: AAAAG 11 repeats (allele frequency = 0.75); AAAAG 12-200 (allele frequency = 0.13); AAAGG 40-1000 (allele frequency = 0.08)
Pathogenic: AAGGG repeat expansion, most frequently ranging from 400 to more than 2000 repeats (allele frequency = 0.01-0.04)
Sources: Expert list
Mendeliome v0.8976 IGFALS Zornitza Stark Marked gene: IGFALS as ready
Mendeliome v0.8976 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Mendeliome v0.8976 IGFALS Zornitza Stark Phenotypes for gene: IGFALS were changed from to Acid-labile subunit, deficiency of, MIM# 615961
Mendeliome v0.8975 IGFALS Zornitza Stark Publications for gene: IGFALS were set to
Repeat Disorders v0.99 DBQD2 Bryony Thompson Marked STR: DBQD2 as ready
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.99 DBQD2 Bryony Thompson Classified STR: DBQD2 as Green List (high evidence)
Repeat Disorders v0.99 DBQD2 Bryony Thompson Str: dbqd2 has been classified as Green List (High Evidence).
Repeat Disorders v0.98 DBQD2 Bryony Thompson STR: DBQD2 was added
STR: DBQD2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DBQD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: DBQD2 were set to 30554721
Phenotypes for STR: DBQD2 were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: DBQD2 was set to GREEN
STR: DBQD2 was marked as clinically relevant
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Expert list
Mendeliome v0.8974 IGFALS Zornitza Stark Mode of inheritance for gene: IGFALS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8973 IGFALS Zornitza Stark reviewed gene: IGFALS: Rating: GREEN; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.338 IGFALS Zornitza Stark Marked gene: IGFALS as ready
Growth failure v0.338 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Growth failure v0.338 IGFALS Zornitza Stark Phenotypes for gene: IGFALS were changed from very low IGF-I levels; Short stature; delayed puberty to Acid-labile subunit, deficiency of, MIM# 615961
Growth failure v0.337 IGFALS Zornitza Stark Publications for gene: IGFALS were set to 14762184
Growth failure v0.336 IGFALS Zornitza Stark Classified gene: IGFALS as Green List (high evidence)
Growth failure v0.336 IGFALS Zornitza Stark Gene: igfals has been classified as Green List (High Evidence).
Growth failure v0.335 IGFALS Zornitza Stark edited their review of gene: IGFALS: Changed rating: GREEN
Growth failure v0.335 IGFALS Zornitza Stark reviewed gene: IGFALS: Rating: ; Mode of pathogenicity: None; Publications: 14762184, 21396577, 34136918; Phenotypes: Acid-labile subunit, deficiency of, MIM# 615961; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.335 IFT172 Zornitza Stark Marked gene: IFT172 as ready
Growth failure v0.335 IFT172 Zornitza Stark Gene: ift172 has been classified as Red List (Low Evidence).
Growth failure v0.335 IFT172 Zornitza Stark reviewed gene: IFT172: Rating: RED; Mode of pathogenicity: None; Publications: 25664603; Phenotypes: GH deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.335 SAMD9 Zornitza Stark Marked gene: SAMD9 as ready
Growth failure v0.335 SAMD9 Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence).
Growth failure v0.335 SAMD9 Zornitza Stark Classified gene: SAMD9 as Green List (high evidence)
Growth failure v0.335 SAMD9 Zornitza Stark Gene: samd9 has been classified as Green List (High Evidence).
Growth failure v0.334 SAMD9 Zornitza Stark reviewed gene: SAMD9: Rating: GREEN; Mode of pathogenicity: None; Publications: 27182967; Phenotypes: MIRAGE syndrome, MIM#617053; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Repeat Disorders v0.97 FAME7 Bryony Thompson Marked STR: FAME7 as ready
Repeat Disorders v0.97 FAME7 Bryony Thompson Str: fame7 has been classified as Red List (Low Evidence).
Repeat Disorders v0.97 FAME7 Bryony Thompson STR: FAME7 was added
STR: FAME7 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME7 were set to 29507423
Phenotypes for STR: FAME7 were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: FAME7 was set to RED
Added comment: The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Repeat Disorders v0.96 FAME6 Bryony Thompson Marked STR: FAME6 as ready
Repeat Disorders v0.96 FAME6 Bryony Thompson Str: fame6 has been classified as Red List (Low Evidence).
Repeat Disorders v0.96 FAME6 Bryony Thompson STR: FAME6 was added
STR: FAME6 was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: FAME6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FAME6 were set to 29507423
Phenotypes for STR: FAME6 were set to Epilepsy, familial adult myoclonic, 6 MIM#618074
Review for STR: FAME6 was set to RED
Added comment: The expanded (TTTTA)22(TTTCA)exp(TTTTA)exp allele was identified 5 affected carriers in a single family. (TTTTA)18 is the reference repeats. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Incidentalome v0.78 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Incidentalome v0.78 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Incidentalome v0.78 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Incidentalome v0.78 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Incidentalome v0.77 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Incidentalome. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Incidentalome v0.76 C9orf72 Bryony Thompson Classified gene: C9orf72 as No list
Incidentalome v0.76 C9orf72 Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FTDALS
Incidentalome v0.76 C9orf72 Bryony Thompson Gene: c9orf72 has been removed from the panel.
Mendeliome v0.8973 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Mendeliome v0.8973 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Mendeliome v0.8973 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Mendeliome v0.8973 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Mendeliome v0.8972 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Mendeliome v0.8971 SAMD12 Bryony Thompson Classified gene: SAMD12 as No list
Mendeliome v0.8971 SAMD12 Bryony Thompson Added comment: Comment on list classification: Added as an STR to panel under FAME1.
Mendeliome v0.8971 SAMD12 Bryony Thompson Gene: samd12 has been removed from the panel.
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Classified gene: SAMD12 as No list
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel.
Genetic Epilepsy v0.1171 SAMD12 Bryony Thompson Gene: samd12 has been removed from the panel.
Repeat Disorders v0.95 FAME1 Bryony Thompson changed review comment from: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list; to: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100-3680 repeats reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Repeat Disorders v0.95 FAME1 Bryony Thompson Marked STR: FAME1 as ready
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.95 FAME1 Bryony Thompson Classified STR: FAME1 as Green List (high evidence)
Repeat Disorders v0.95 FAME1 Bryony Thompson Str: fame1 has been classified as Green List (High Evidence).
Repeat Disorders v0.94 FAME1 Bryony Thompson STR: FAME1 was added
STR: FAME1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FAME1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for STR: FAME1 were set to 30194086; 29507423
Phenotypes for STR: FAME1 were set to Epilepsy, familial adult myoclonic, 1 MIM#601068
Review for STR: FAME1 was set to GREEN
STR: FAME1 was marked as clinically relevant
Added comment: NC_000008.10:g.119379055_119379157TGAAA[X]TAAAA[X]
A heterozygous or homozygous 5-bp expanded TTTCA(n) insertion associated with an upstream 5-bp TTTTA(n) repeat expansion in a noncoding region within intron 4 of the SAMD12 gene, was identified in over 50 Chinese and Japanese families. 4 homozygous cases from 3 families had a more severe phenotype. The TTTTA repeat was present in controls, while the TTTCA was absent and only present in cases (100 repeats the smallest number reported). RNA toxicity is expected to be the mechanism of disease.
Sources: Expert list
Growth failure v0.334 HESX1 Zornitza Stark Marked gene: HESX1 as ready
Growth failure v0.334 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Growth failure v0.334 HESX1 Zornitza Stark Phenotypes for gene: HESX1 were changed from Septo-optic dysplasia; variable involvement of pituitary hormones to Septooptic dysplasia, MIM# 182230; Growth hormone deficiency with pituitary anomalies, MIM#182230
Growth failure v0.333 HESX1 Zornitza Stark Publications for gene: HESX1 were set to
Growth failure v0.332 HESX1 Zornitza Stark Classified gene: HESX1 as Green List (high evidence)
Growth failure v0.332 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Growth failure v0.331 HESX1 Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14561704, 26781211, 11136712, 16940453; Phenotypes: Septooptic dysplasia, MIM# 182230, Growth hormone deficiency with pituitary anomalies, MIM#182230; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.331 H19 Zornitza Stark Marked gene: H19 as ready
Growth failure v0.331 H19 Zornitza Stark Gene: h19 has been classified as Red List (Low Evidence).
Growth failure v0.331 H19 Zornitza Stark Phenotypes for gene: H19 were changed from Russell-Silver syndrome to Silver-Russell syndrome, MIM# 180860
Growth failure v0.330 H19 Zornitza Stark Mode of inheritance for gene: H19 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Growth failure v0.329 H19 Zornitza Stark reviewed gene: H19: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Silver-Russell syndrome, MIM# 180860; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Growth failure v0.329 GPR161 Zornitza Stark Marked gene: GPR161 as ready
Growth failure v0.329 GPR161 Zornitza Stark Gene: gpr161 has been classified as Red List (Low Evidence).
Growth failure v0.329 GPR161 Zornitza Stark Phenotypes for gene: GPR161 were changed from Short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk to Pituitary stalk interruption syndrome
Growth failure v0.328 GPR161 Zornitza Stark changed review comment from: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyl. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.; to: Two sisters reported with homozygous variant in this gene and short stature with hypopituitarism, intellectual disability, sparse or absent hair in the frontal area, hypotelorism, broad nasal root, thick alae nasi, nail hypoplasia, short fifth finger, 2-3 toe syndactyly. MRI showed hypoplastic pituitary gland, empty sella, ectopic neurohypophysis, and interrupted pituitary stalk.
Growth failure v0.328 GPR161 Zornitza Stark reviewed gene: GPR161: Rating: RED; Mode of pathogenicity: None; Publications: 25322266; Phenotypes: Pituitary stalk interruption syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.319 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Callosome v0.319 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Callosome v0.318 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Callosome v0.317 Bryony Thompson removed STR:DAB1 from the panel
Callosome v0.316 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Callosome v0.316 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Callosome v0.316 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Callosome v0.316 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Callosome v0.315 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Callosome v0.314 ATXN10 Bryony Thompson Classified gene: ATXN10 as No list
Callosome v0.314 ATXN10 Bryony Thompson Added comment: Comment on list classification: STR is the only reported cause of disease. Added as an STR to the panel.
Callosome v0.314 ATXN10 Bryony Thompson Gene: atxn10 has been removed from the panel.
Repeat Disorders v0.93 SPD1 Bryony Thompson Marked STR: SPD1 as ready
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.93 SPD1 Bryony Thompson Classified STR: SPD1 as Green List (high evidence)
Repeat Disorders v0.93 SPD1 Bryony Thompson Str: spd1 has been classified as Green List (High Evidence).
Repeat Disorders v0.92 SPD1 Bryony Thompson STR: SPD1 was added
STR: SPD1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SPD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SPD1 were set to 8817328; 33811808; 33533119
Phenotypes for STR: SPD1 were set to Synpolydactyly 1 MIM#186000
Review for STR: SPD1 was set to GREEN
STR: SPD1 was marked as clinically relevant
Added comment: NM_000523.4(HOXD13):c.212_213GCG[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
Normal repeat number: 15
Pathogenic repeat number: 24
Truncation of repeat also reported
Sources: Expert list
Repeat Disorders v0.91 Bryony Thompson removed STR:SPD1 from the panel
Callosome v0.313 DAB1 Bryony Thompson Marked STR: DAB1 as ready
Callosome v0.313 DAB1 Bryony Thompson Str: dab1 has been classified as Green List (High Evidence).
Callosome v0.313 DAB1 Bryony Thompson Classified STR: DAB1 as Green List (high evidence)
Callosome v0.313 DAB1 Bryony Thompson Str: dab1 has been classified as Green List (High Evidence).
Callosome v0.312 DAB1 Bryony Thompson STR: DAB1 was added
STR: DAB1 was added to Callosome. Sources: Expert list
Mode of inheritance for STR: DAB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DAB1 were set to 28686858; 31145571
Phenotypes for STR: DAB1 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: DAB1 was set to GREEN
STR: DAB1 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Repeat Disorders v0.90 SCA37 Bryony Thompson Marked STR: SCA37 as ready
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.90 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Repeat Disorders v0.90 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Repeat Disorders v0.89 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides. RNA toxicity is the mechanism of disease.
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Expert list
Callosome v0.311 DAB1 Bryony Thompson Classified gene: DAB1 as No list
Callosome v0.311 DAB1 Bryony Thompson Added comment: Comment on list classification: STR expansion is the mechanism of disease for this gene. It has been added as an STR to this panel.
Callosome v0.311 DAB1 Bryony Thompson Gene: dab1 has been removed from the panel.
Repeat Disorders v0.88 XDP Bryony Thompson changed review comment from: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list; to: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within intron 32. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Repeat Disorders v0.88 XDP Bryony Thompson Marked STR: XDP as ready
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Classified gene: TAF1 as No list
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Added comment: Comment on list classification: Added as an STR to the panel
Early-onset Parkinson disease v0.117 TAF1 Bryony Thompson Gene: taf1 has been removed from the panel.
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Marked STR: XDP as ready
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Early-onset Parkinson disease v0.116 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.115 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Early-onset Parkinson disease. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Growth failure v0.328 GLI3 Zornitza Stark Marked gene: GLI3 as ready
Growth failure v0.328 GLI3 Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence).
Growth failure v0.328 GLI3 Zornitza Stark Phenotypes for gene: GLI3 were changed from Pallister-Hall syndrome to Pallister-Hall syndrome, MIM# 146510
Growth failure v0.327 GLI3 Zornitza Stark Publications for gene: GLI3 were set to 9054938
Growth failure v0.326 GLI3 Zornitza Stark Classified gene: GLI3 as Green List (high evidence)
Growth failure v0.326 GLI3 Zornitza Stark Gene: gli3 has been classified as Green List (High Evidence).
Growth failure v0.325 GLI3 Zornitza Stark reviewed gene: GLI3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9054938, 10945658, 11693785; Phenotypes: Pallister-Hall syndrome, MIM# 146510; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.325 TRIM37 Zornitza Stark Marked gene: TRIM37 as ready
Growth failure v0.325 TRIM37 Zornitza Stark Gene: trim37 has been classified as Green List (High Evidence).
Growth failure v0.325 TRIM37 Zornitza Stark Phenotypes for gene: TRIM37 were changed from Mulibrey nanism; Mulibery Nanism, 253250 to Mulibery nanism, MIM#253250
Growth failure v0.324 TRIM37 Zornitza Stark Publications for gene: TRIM37 were set to
Repeat Disorders v0.88 XDP Bryony Thompson Classified STR: XDP as Green List (high evidence)
Repeat Disorders v0.88 XDP Bryony Thompson Str: xdp has been classified as Green List (High Evidence).
Repeat Disorders v0.87 XDP Bryony Thompson STR: XDP was added
STR: XDP was added to Repeat Disorders. Sources: Expert list
founder tags were added to STR: XDP.
Mode of inheritance for STR: XDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: XDP were set to 17273961; 29229810
Phenotypes for STR: XDP were set to Dystonia-Parkinsonism, X-linked MIM#314250
Review for STR: XDP was set to GREEN
STR: XDP was marked as clinically relevant
Added comment: Founder Filipino variant. Associated with an antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron. The number of repeats in these cases ranged from 35 to 52 and showed a highly significant inverse correlation with age at disease onset. The mechanism of disease is unknown, possibly this intronic retroelement may induce transcriptional interference in TAF1 expression.
Sources: Expert list
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Corneal Dystrophy v1.5 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Corneal Dystrophy v1.4 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Corneal Dystrophy. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Classified gene: TCF4 as No list
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Added comment: Comment on list classification: Added as an STR to this panel.
Corneal Dystrophy v1.3 TCF4 Bryony Thompson Gene: tcf4 has been removed from the panel.
Repeat Disorders v0.86 FECD3 Bryony Thompson Marked STR: FECD3 as ready
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.86 FECD3 Bryony Thompson Classified STR: FECD3 as Green List (high evidence)
Repeat Disorders v0.86 FECD3 Bryony Thompson Str: fecd3 has been classified as Green List (High Evidence).
Repeat Disorders v0.85 FECD3 Bryony Thompson STR: FECD3 was added
STR: FECD3 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FECD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FECD3 were set to 25722209; 24255041
Phenotypes for STR: FECD3 were set to Corneal dystrophy, Fuchs endothelial, 3 MIM#613267
Review for STR: FECD3 was set to GREEN
STR: FECD3 was marked as clinically relevant
Added comment: NG_011716.2:g.54765TGC[X]
Intronic CTG repeat expansion, with RNA nuclear foci expected to be the mechanism of disease. The expanded CTG 18.1 allele conferring significant risk for FECD (>30-fold increase). The expanded allele cosegregates with the trait with complete penetrance in a majority of families, but we also document cases of incomplete penetrance.
Normal: 5-31 repeats
Pathogenic: >50 repeats
Sources: Expert list
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Dystonia and Chorea v0.192 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Dystonia and Chorea v0.191 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 26166205; 24363131; 26187722; 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Dystonia and Chorea v0.190 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Parkinson disease v0.114 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.113 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778; 31779815
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Parkinson disease v0.112 Bryony Thompson removed STR:C9orf72 from the panel
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Motor Neurone Disease v0.130 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.129 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Motor Neurone Disease. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.139 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Motor Neurone Disease v0.128 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Dementia v0.139 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Dementia v0.138 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.137 Bryony Thompson removed STR:C9orf72 from the panel
Repeat Disorders v0.84 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.84 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Repeat Disorders v0.84 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Repeat Disorders v0.83 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Repeat Disorders v0.82 SCA12 Bryony Thompson Publications for STR: SCA12 were set to 27864267; 33811808
Repeat Disorders v0.81 SCA12 Bryony Thompson edited their review of STR: SCA12: Changed publications: 27864267, 33811808, 10581021
Repeat Disorders v0.81 SCA8 Bryony Thompson Publications for STR: SCA8 were set to 20301445
Repeat Disorders v0.80 SCA8 Bryony Thompson edited their review of STR: SCA8: Changed publications: 20301445, 10192387
Repeat Disorders v0.80 FXPOI Bryony Thompson Publications for STR: FXPOI were set to 20301558
Repeat Disorders v0.79 FXPOI Bryony Thompson edited their review of STR: FXPOI: Changed publications: 20301558, 9647544
Repeat Disorders v0.79 EPM1 Bryony Thompson Publications for STR: EPM1 were set to 29325606; 20301321
Repeat Disorders v0.78 EPM1 Bryony Thompson edited their review of STR: EPM1: Changed publications: 29325606, 20301321, 9126745
Repeat Disorders v0.78 FRDA Bryony Thompson Publications for STR: FRDA were set to 20301458
Repeat Disorders v0.77 FRDA Bryony Thompson edited their review of STR: FRDA: Changed publications: 20301458, 8596916
Repeat Disorders v0.77 DM1 Bryony Thompson Publications for STR: DM1 were set to 20301344; 29325606
Repeat Disorders v0.76 DM1 Bryony Thompson edited their review of STR: DM1: Changed publications: 20301344, 29325606, 1546325
Repeat Disorders v0.76 FXS Bryony Thompson Publications for STR: FXS were set to 33795824; 25227148
Repeat Disorders v0.75 FXS Bryony Thompson edited their review of STR: FXS: Changed publications: 33795824, 25227148, 1710175, 2031184
Mendeliome v0.8970 SCA36 Bryony Thompson Publications for STR: SCA36 were set to 25101480
Mendeliome v0.8969 SCA36 Bryony Thompson edited their review of STR: SCA36: Changed publications: 21683323
Repeat Disorders v0.75 SCA36 Bryony Thompson Marked STR: SCA36 as ready
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.75 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Repeat Disorders v0.75 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Repeat Disorders v0.74 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 21683323
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Early-onset Parkinson disease v0.111 PSAP Zornitza Stark Phenotypes for gene: PSAP were changed from Parkinson Disease, AD to Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491
Early-onset Parkinson disease v0.110 PSAP Zornitza Stark reviewed gene: PSAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491; Mode of inheritance: None
Mirror movements v0.0 Bryony Thompson Added Panel Osteoporosis
Set panel types to: Royal Melbourne Hospital; Rare Disease
Mendeliome v0.8969 MYO1H Zornitza Stark Marked gene: MYO1H as ready
Mendeliome v0.8969 MYO1H Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence).
Mendeliome v0.8969 MYO1H Zornitza Stark gene: MYO1H was added
gene: MYO1H was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1H were set to 28779001
Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482
Review for gene: MYO1H was set to RED
Added comment: Single family reported with three affected children, homozygous LoF variant.
Sources: Literature
Central Hypoventilation v1.1 MYO1H Zornitza Stark Marked gene: MYO1H as ready
Central Hypoventilation v1.1 MYO1H Zornitza Stark Gene: myo1h has been classified as Red List (Low Evidence).
Central Hypoventilation v1.1 MYO1H Zornitza Stark gene: MYO1H was added
gene: MYO1H was added to Central Hypoventilation. Sources: Literature
Mode of inheritance for gene: MYO1H was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1H were set to 28779001
Phenotypes for gene: MYO1H were set to Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction, MIM#619482
Review for gene: MYO1H was set to RED
Added comment: Single family reported with three affected children, homozygous LoF variant.
Sources: Literature
Repeat Disorders v0.73 SCA31 Bryony Thompson Marked STR: SCA31 as ready
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.73 SCA31 Bryony Thompson Classified STR: SCA31 as Green List (high evidence)
Repeat Disorders v0.73 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Repeat Disorders v0.72 SCA31 Bryony Thompson STR: SCA31 was added
STR: SCA31 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA31 were set to 19878914; 31755042
Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210
Review for STR: SCA31 was set to GREEN
STR: SCA31 was marked as clinically relevant
Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested.
2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease
Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042)
Sources: Expert list
Repeat Disorders v0.71 FXTAS Bryony Thompson Marked STR: FXTAS as ready
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.71 FXTAS Bryony Thompson Classified STR: FXTAS as Green List (high evidence)
Repeat Disorders v0.71 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Repeat Disorders v0.70 FXTAS Bryony Thompson STR: FXTAS was added
STR: FXTAS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXTAS were set to 23765048; 25227148; 11445641
Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623
Review for STR: FXTAS was set to GREEN
STR: FXTAS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list
Repeat Disorders v0.69 DM2 Bryony Thompson Marked STR: DM2 as ready
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.69 DM2 Bryony Thompson Classified STR: DM2 as Green List (high evidence)
Repeat Disorders v0.69 DM2 Bryony Thompson Str: dm2 has been classified as Green List (High Evidence).
Repeat Disorders v0.68 DM2 Bryony Thompson STR: DM2 was added
STR: DM2 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM2 were set to 20301639; 11486088
Phenotypes for STR: DM2 were set to Myotonic dystrophy 2 MIM#602668
Review for STR: DM2 was set to GREEN
STR: DM2 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Repeat Disorders v0.67 SCA10 Bryony Thompson Marked STR: SCA10 as ready
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.67 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Repeat Disorders v0.67 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Repeat Disorders v0.66 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354; 11017075
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
Review for STR: SCA10 was set to GREEN
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Marked gene: FBXW7 as ready
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.110 FBXW7 Zornitza Stark Phenotypes for gene: FBXW7 were changed from to Predisposition to cancer
Cancer Predisposition_Paediatric v0.109 FBXW7 Zornitza Stark Classified gene: FBXW7 as Green List (high evidence)
Cancer Predisposition_Paediatric v0.109 FBXW7 Zornitza Stark Gene: fbxw7 has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Marked gene: BLM as ready
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Cancer Predisposition_Paediatric v0.108 BLM Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies
Cancer Predisposition_Paediatric v0.107 BLM Zornitza Stark Publications for gene: BLM were set to
Cancer Predisposition_Paediatric v0.106 BLM Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cancer Predisposition_Paediatric v0.105 BLM Zornitza Stark reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8968 BLM Zornitza Stark Marked gene: BLM as ready
Mendeliome v0.8968 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Mendeliome v0.8968 BLM Zornitza Stark Phenotypes for gene: BLM were changed from to Bloom Syndrome MIM# 210900; Short stature, dysmorphic facies; sun-sensitive; immunoglobulin deficiency (IgA, IgG, IgM); erythema; marrow failure; leukaemia; lymphoma; chromosomal instability; predisposition to malignancies
Mendeliome v0.8967 BLM Zornitza Stark Publications for gene: BLM were set to
Mendeliome v0.8966 BLM Zornitza Stark Mode of inheritance for gene: BLM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8965 PRKDC Zornitza Stark Marked gene: PRKDC as ready
Mendeliome v0.8965 PRKDC Zornitza Stark Gene: prkdc has been classified as Green List (High Evidence).
Mendeliome v0.8965 PRKDC Zornitza Stark Phenotypes for gene: PRKDC were changed from to Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966; Absent T and B cells; normal NK cells; SCID; recurrent respiratory infections; microcephaly; seizures; developmental delay
Mendeliome v0.8964 PRKDC Zornitza Stark Publications for gene: PRKDC were set to
Mendeliome v0.8963 PRKDC Zornitza Stark Mode of inheritance for gene: PRKDC was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8962 PRKDC Zornitza Stark reviewed gene: PRKDC: Rating: GREEN; Mode of pathogenicity: None; Publications: 19075392, 23722905; Phenotypes: Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966, Absent T and B cells, normal NK cells, SCID, recurrent respiratory infections, microcephaly, seizures, developmental delay; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v1.0 Zornitza Stark promoted panel to version 1.0
Combined Immunodeficiency v0.394 WAS Zornitza Stark Marked gene: WAS as ready
Combined Immunodeficiency v0.394 WAS Zornitza Stark Gene: was has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.394 WAS Zornitza Stark Phenotypes for gene: WAS were changed from to Neutropaenia, severe congenital, X-linked MIM# 300299; Wiskott-Aldrich syndrome MIM# 301000; Thrombocytopaenia, X-linked MIM# 313900
Combined Immunodeficiency v0.393 WAS Zornitza Stark Publications for gene: WAS were set to
Combined Immunodeficiency v0.392 WAS Zornitza Stark Mode of pathogenicity for gene: WAS was changed from to Other
Combined Immunodeficiency v0.391 WAS Zornitza Stark Mode of inheritance for gene: WAS was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8962 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Mendeliome v0.8962 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Mendeliome v0.8962 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity
Mendeliome v0.8961 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Mendeliome v0.8960 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8959 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Mendeliome v0.8959 TBX1 Zornitza Stark reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Tag SV/CNV tag was added to gene: TBX1.
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.390 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome MIM# 188400; Velocardiofacial syndrome MIM# 192430; Decreased T cells; Hypoparathyroidism; Conotruncal cardiac malformation; velopalatal insufficiency; abnormal facies (cleft palate, prominent tubular nose etc); intellectual disability; Immunodeficiency; thymic hypoplasia or aplasia with resultant T‐cell dysfunction; renal anomalies; autoimmunity
Combined Immunodeficiency v0.389 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Combined Immunodeficiency v0.388 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8959 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Mendeliome v0.8959 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Mendeliome v0.8959 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373
Mendeliome v0.8958 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Mendeliome v0.8957 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8956 RTEL1 Zornitza Stark reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.387 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from to Dyskeratosis congenita, autosomal dominant 4 MIM# 615190; Dyskeratosis congenita, autosomal recessive 5 MIM# 615190; Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373
Combined Immunodeficiency v0.386 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Combined Immunodeficiency v0.385 RTEL1 Zornitza Stark Mode of inheritance for gene: RTEL1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8956 RMRP Zornitza Stark changed review comment from: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models

Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function.
*Founder variant g.70A>G (Amish and Finnish populations)

CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.; to: Over 60 pathogenic RMRP variants have been reported resulting in CHH phenotypes; multiple mouse models

Homozygous and Compound heterozygous (insertions, duplications and missense) variants have been reported resulting in loss of function.
*Founder variant g.70A>G (Amish and Finnish populations)

CHH individuals present with variable features that may include: shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities and a spectrum of combined immunodeficiency.

Anauxetic dysplasia 1, MIM# 607095 is a more severe phenotype, whereas Metaphyseal dysplasia without hypotrichosis, MIM# 250460 is milder.
Mendeliome v0.8956 RMRP Zornitza Stark edited their review of gene: RMRP: Changed publications: 16244706, 21396580, 22420014, 11940090, 16252239
Mendeliome v0.8956 RMRP Zornitza Stark edited their review of gene: RMRP: Changed phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, Anauxetic dysplasia 1, MIM# 607095, Metaphyseal dysplasia without hypotrichosis, MIM# 250460
Mendeliome v0.8956 RMRP Zornitza Stark Marked gene: RMRP as ready
Mendeliome v0.8956 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Mendeliome v0.8956 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage-hair hypoplasia MIM#250250
Mendeliome v0.8955 RMRP Zornitza Stark Publications for gene: RMRP were set to
Mendeliome v0.8954 RMRP Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8953 RMRP Zornitza Stark reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Marked gene: RMRP as ready
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.384 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from to Cartilage hair hypoplasia (CHH) MIM#250250; shortened limbs; short stature; metaphysical dysplasia; fine, sparse and/or light-coloured hair; hematologic abnormalities; CID; impaired lymphocyte proliferation; low Ig levels; antibodies variably decreased; bone marrow failure; autoimmunity; susceptibility to lymphoma and other cancers; impaired spermatogenesis; neuronal dysplasia of the intestine
Combined Immunodeficiency v0.383 RMRP Zornitza Stark Publications for gene: RMRP were set to
Combined Immunodeficiency v0.382 RMRP Zornitza Stark Mode of inheritance for gene: RMRP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8953 BLM Danielle Ariti reviewed gene: BLM: Rating: GREEN; Mode of pathogenicity: None; Publications: 17407155, 9285778, 7585968, 8079989, 12242442, 11101838; Phenotypes: Bloom Syndrome MIM# 210900, Short stature, dysmorphic facies, sun-sensitive, immunoglobulin deficiency (IgA, IgG, IgM), erythema, marrow failure, leukaemia, lymphoma, chromosomal instability, predisposition to malignancies; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Severe Combined Immunodeficiency v0.28 IL7R Danielle Ariti reviewed gene: IL7R: Rating: GREEN; Mode of pathogenicity: None; Publications: 9843216, 19890784, 26123418, 11023514, 7964471; Phenotypes: Severe combined immunodeficiency, T-cell negative, B-cell/natural killer cell-positive type MIM# 608971, low T-cell numbers, normal-high B and NK-cell numbers, fever, rash, failure to thrive, recurrent respiratory and gastric infections, Hepatomegaly, Splenomegaly, diarrhoea, lymphadenopathy, pneumonitis, Pancytopaenia, decreased immunoglobulins; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 LIG4 Danielle Ariti edited their review of gene: LIG4: Changed phenotypes: LIG4 syndrome MIM# 606593, T-/B- lymphocytopaenia, Normal NK, radiation sensitivity, Microcephaly, low/ absent B and T cells, low Ig, raised IgM, failure to thrive, bacterial/viral/fungal infections, hypogammaglobulinaemia, neurodevelopmental delay, microcephaly, pancytopaenia
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 11242109, 11047757, 29855039, 15833888, 28993958, 15577852; Phenotypes: Ectodermal dysplasia and immunodeficiency 1 MIM# 300291, Immunodeficiency 33 MIM# 300636; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti Deleted their review
Combined Immunodeficiency v0.381 IKBKG Danielle Ariti edited their review of gene: IKBKG: Added comment: Ectodermal dysplasia with immunodeficiency
Over 12 families have been identified with IKBKG variants
Individuals typically present within the first year of life with recurrent infections (pneumonia, bacterial infections of the bone and soft tissue), elevated IgM and ectodermal dysplasia features (sparse scalp and body hair, reduced ability to sweat, and conical teeth)
------
Immunodeficiency-33 and no ectodermal dysplasia
10 unrelated individuals been reported with IKBKG variants
Characterised by early-onset severe infections, hypogammaglobulinaemia, decreased IgG and impaired antibody response to multiple vaccinations.
-------
Multiple null IKBKG mouse models demonstrating both disease phenotypes AND
Hemizygous (insertion, slice site, deletion and missense) variants have been reported in association with both diseases, causing premature stop codons; most common variants are splice-site; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.381 CD40LG Danielle Ariti changed review comment from: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome.
Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119)

Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF.

Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.; to: Well-established gene-disease association; more than 20 unrelated individuals and multiple CD40LG deficient mouse models demonstrate an association with X-linked recessive hyper IgM syndrome.
Heterozygous females are characteristically asymptomatic (normal immunoglobulin levels); however, there have been rare cases of affected females expressing clinical phenotypes due to skewed X-chromosome inactivation (PMID: 16311023 & 9933119)

Variants identified include missense, in-frame indel, nonsense, frameshift, large deletion and complex rearrangements resulting in LOF.

Typical immunological profile includes decreased IgG/IgA/IgE levels with normal-increased IgM levels, resulting in susceptibility to severe and opportunistic viral/bacterial infections.
Combined Immunodeficiency v0.381 WAS Danielle Ariti reviewed gene: WAS: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11242115, 19006568, 16804117, 8069912, 10575547, 7579329, 7795648, 23807894; Phenotypes: Neutropenia, severe congenital, X-linked MIM# 300299, Wiskott-Aldrich syndrome MIM# 301000, Thrombocytopenia, X-linked MIM# 313900; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.8953 RFX5 Zornitza Stark Marked gene: RFX5 as ready
Mendeliome v0.8953 RFX5 Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence).
Mendeliome v0.8953 RFX5 Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920
Mendeliome v0.8952 RFX5 Zornitza Stark Publications for gene: RFX5 were set to
Mendeliome v0.8951 RFX5 Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8950 RFX5 Zornitza Stark reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Marked gene: RFX5 as ready
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Gene: rfx5 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.381 RFX5 Zornitza Stark Phenotypes for gene: RFX5 were changed from to Bare lymphocyte syndrome, type II, complementation group C MIM# 209920; Bare lymphocyte syndrome, type II, complementation group E MIM# 209920
Combined Immunodeficiency v0.380 RFX5 Zornitza Stark Publications for gene: RFX5 were set to
Combined Immunodeficiency v0.379 RFX5 Zornitza Stark Mode of inheritance for gene: RFX5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 TBX1 Danielle Ariti changed review comment from: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models

Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc).

Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.; to: Well-established disease-gene association with DiGeorge syndrome and Velocardiofacial syndrome; multiple mouse models

Most common micro-deletion syndrome (22q11.2 Deletion Syndrome) which can lead to diverse clinical features comprising a triad of immunodeficiency, hypoparathyroidism, and congenital heart defect in addition to renal anomalies, autoimmunity etc. Velocardiofacial syndrome presenting with the majority of physical malformations (cleft palate, prominent tubular nose, narrow palpebral fissures, and retruded mandible etc).

Immunodeficiency is present in the majority of patients with 22q11.2 Deletion Syndrome and is the second leading cause of death in these patients.
Combined Immunodeficiency v0.378 TBX1 Danielle Ariti reviewed gene: TBX1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301696, 31830774, 16684884; Phenotypes: DiGeorge syndrome MIM# 188400, Velocardiofacial syndrome MIM# 192430, Decreased T cells, Hypoparathyroidism, Conotruncal cardiac malformation, velopalatal insufficiency, abnormal facies (cleft palate, prominent tubular nose etc), intellectual disability, Immunodeficiency, thymic hypoplasia or aplasia with resultant T‐cell dysfunction, renal anomalies, autoimmunity; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Combined Immunodeficiency v0.378 RTEL1 Danielle Ariti reviewed gene: RTEL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301779, 23329068, 15210109, 23453664, 19461895, 25848748, 25607374; Phenotypes: Dyskeratosis congenita, autosomal dominant 4 MIM# 615190, Dyskeratosis congenita, autosomal recessive 5 MIM# 615190, Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RMRP Danielle Ariti reviewed gene: RMRP: Rating: GREEN; Mode of pathogenicity: None; Publications: 16244706, 21396580, 22420014; Phenotypes: Cartilage hair hypoplasia (CHH) MIM#250250, shortened limbs, short stature, metaphysical dysplasia, fine, sparse and/or light-coloured hair, hematologic abnormalities, CID, impaired lymphocyte proliferation, low Ig levels, antibodies variably decreased, bone marrow failure, autoimmunity, susceptibility to lymphoma and other cancers, impaired spermatogenesis, neuronal dysplasia of the intestine; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RFX5 Danielle Ariti reviewed gene: RFX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 9401005, 29527204, 30170160, 7990905, 8642248, 7699327; Phenotypes: Bare lymphocyte syndrome, type II, complementation group C MIM# 209920, Bare lymphocyte syndrome, type II, complementation group E MIM# 209920; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v1.90 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500
Deafness_IsolatedAndComplex v1.89 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Mendeliome v0.8950 ELMOD3 Zornitza Stark Phenotypes for gene: ELMOD3 were changed from Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant to Deafness, autosomal recessive 88, MIM# 615429; Deafness, autosomal dominant 81, MIM# 619500
Mendeliome v0.8949 ELMOD3 Zornitza Stark edited their review of gene: ELMOD3: Changed phenotypes: Deafness, autosomal recessive 88, MIM# 615429, Deafness, autosomal dominant 81, MIM# 619500
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Marked gene: TYK2 as ready
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence).
Defects of intrinsic and innate immunity v0.80 TYK2 Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521
Defects of intrinsic and innate immunity v0.79 TYK2 Zornitza Stark Publications for gene: TYK2 were set to
Defects of intrinsic and innate immunity v0.78 TYK2 Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Defects of intrinsic and innate immunity v0.77 TYK2 Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8949 TYK2 Zornitza Stark Marked gene: TYK2 as ready
Mendeliome v0.8949 TYK2 Zornitza Stark Gene: tyk2 has been classified as Green List (High Evidence).
Mendeliome v0.8949 TYK2 Zornitza Stark Phenotypes for gene: TYK2 were changed from to Immunodeficiency 35, MIM# 611521
Mendeliome v0.8948 TYK2 Zornitza Stark Publications for gene: TYK2 were set to
Mendeliome v0.8947 TYK2 Zornitza Stark Mode of inheritance for gene: TYK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8946 TYK2 Zornitza Stark reviewed gene: TYK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17088085, 17521577, 26304966; Phenotypes: Immunodeficiency 35, MIM# 611521; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8946 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Mendeliome v0.8946 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Mendeliome v0.8946 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Mendeliome v0.8945 RAG1 Zornitza Stark Publications for gene: RAG1 were set to
Mendeliome v0.8944 RAG1 Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8943 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Mendeliome v0.8943 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Mendeliome v0.8943 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650
Mendeliome v0.8942 RAG2 Zornitza Stark Publications for gene: RAG2 were set to
Mendeliome v0.8941 RAG2 Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4089 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Intellectual disability syndromic and non-syndromic v0.4088 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Mendeliome v0.8940 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Mendeliome v0.8939 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Congenital Disorders of Glycosylation v1.17 EDEM3 Zornitza Stark Phenotypes for gene: EDEM3 were changed from Congenital disorder of glycosylation; Developmental delay to Congenital disorder of glycosylation, type 2V, MIM# 619493
Congenital Disorders of Glycosylation v1.16 EDEM3 Zornitza Stark edited their review of gene: EDEM3: Changed rating: GREEN
Congenital Disorders of Glycosylation v1.16 EDEM3 Zornitza Stark reviewed gene: EDEM3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type 2V, MIM# 619493; Mode of inheritance: None
Mendeliome v0.8939 RAG2 Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8939 RAC2 Zornitza Stark Marked gene: RAC2 as ready
Mendeliome v0.8939 RAC2 Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence).
Mendeliome v0.8939 RAC2 Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986
Mendeliome v0.8938 RAC2 Zornitza Stark Publications for gene: RAC2 were set to
Mendeliome v0.8937 RAG1 Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8937 RAC2 Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other
Mendeliome v0.8936 RAC2 Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.378 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from to Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457; Combined cellular and humoral immune defects with granulomas MIM# 233650
Combined Immunodeficiency v0.377 RAG2 Zornitza Stark Publications for gene: RAG2 were set to
Combined Immunodeficiency v0.376 RAG2 Zornitza Stark Mode of inheritance for gene: RAG2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.375 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Combined Immunodeficiency v0.374 RAG1 Zornitza Stark Publications for gene: RAG1 were set to
Combined Immunodeficiency v0.373 RAG1 Zornitza Stark Mode of inheritance for gene: RAG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8935 RAC2 Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Marked gene: RAC2 as ready
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Gene: rac2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Phenotypes for gene: RAC2 were changed from to Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203; Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987; Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986
Combined Immunodeficiency v0.372 RAC2 Zornitza Stark Publications for gene: RAC2 were set to 21167572; 10758162; 10072071; 25512081; 32542921; 31919089
Combined Immunodeficiency v0.371 RAC2 Zornitza Stark Publications for gene: RAC2 were set to
Combined Immunodeficiency v0.370 RAC2 Zornitza Stark Mode of pathogenicity for gene: RAC2 was changed from to Other
Combined Immunodeficiency v0.369 RAC2 Zornitza Stark Mode of inheritance for gene: RAC2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Marked gene: MTHFD1 as ready
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.368 MTHFD1 Zornitza Stark Phenotypes for gene: MTHFD1 were changed from to Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780; Decreased Ig levels; poor antibody responses to conjugated polysaccharide antigens; low B/T/NK cells; Recurrent bacterial infection; megaloblastic anaemia; failure to thrive; neutropenia; seizures; intellectual disability; folate-responsive; Lymphopaenia
Mendeliome v0.8935 MTHFD1 Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Phenotypes: 32414565, 19033438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.367 MTHFD1 Zornitza Stark Publications for gene: MTHFD1 were set to
Combined Immunodeficiency v0.366 MTHFD1 Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.366 MTHFD1 Zornitza Stark Mode of inheritance for gene: MTHFD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8935 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Mendeliome v0.8935 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Mendeliome v0.8935 GLI2 Zornitza Stark Phenotypes for gene: GLI2 were changed from to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082)
Mendeliome v0.8934 GLI2 Zornitza Stark Publications for gene: GLI2 were set to
Mendeliome v0.8933 GLI2 Zornitza Stark Mode of inheritance for gene: GLI2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8932 GLI2 Zornitza Stark changed review comment from: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported, short stature is a feature as a result of GH deficiency.

Variants in GLI2 are also associated with HPE, at least 5 families reported. Short stature is observed more rarely, as a result of midline defect.; to: Culler-Jones syndrome (CJS) is characterized by hypopituitarism, mainly growth hormone deficiency, and/or postaxial polydactyly. The phenotype is highly variable, and some individuals may have midline facial defects and developmental delay. The disorder shows incomplete penetrance and variable expressivity. Multiple families reported.

Variants in GLI2 are also associated with HPE, at least 5 families reported.
Mendeliome v0.8932 GLI2 Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.323 GLI2 Zornitza Stark Marked gene: GLI2 as ready
Growth failure v0.323 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Growth failure v0.323 GLI2 Zornitza Stark Phenotypes for gene: GLI2 were changed from Holoprosencephaly, hypopituitarism to Culler-Jones syndrome, MIM#615849; Holoprosencephaly 9, MIM# 61082
Growth failure v0.322 GLI2 Zornitza Stark Publications for gene: GLI2 were set to
Growth failure v0.321 GLI2 Zornitza Stark Classified gene: GLI2 as Green List (high evidence)
Growth failure v0.321 GLI2 Zornitza Stark Gene: gli2 has been classified as Green List (High Evidence).
Growth failure v0.320 GLI2 Zornitza Stark reviewed gene: GLI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 14581620, 17096318, 33235745, 27585885, 15994174, 20685856, 30629636, 30583238; Phenotypes: Culler-Jones syndrome, MIM#615849, Holoprosencephaly 9, MIM# 61082); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Marked gene: GHSR as ready
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Pituitary hormone deficiency v0.15 GHSR Zornitza Stark Publications for gene: GHSR were set to 19789204; 25557026
Pituitary hormone deficiency v0.14 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Pituitary hormone deficiency v0.14 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Pituitary hormone deficiency v0.13 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8932 GHSR Zornitza Stark Marked gene: GHSR as ready
Mendeliome v0.8932 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8932 GHSR Zornitza Stark Phenotypes for gene: GHSR were changed from to Growth hormone deficiency, isolated partial, MIM# 615925
Mendeliome v0.8931 GHSR Zornitza Stark Publications for gene: GHSR were set to
Mendeliome v0.8930 GHSR Zornitza Stark Mode of inheritance for gene: GHSR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8929 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Mendeliome v0.8929 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8928 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204, 16511605; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.320 GHSR Zornitza Stark edited their review of gene: GHSR: Changed publications: 25557026, 19789204, 16511605
Growth failure v0.320 GHSR Zornitza Stark Marked gene: GHSR as ready
Growth failure v0.320 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Growth failure v0.320 GHSR Zornitza Stark Phenotypes for gene: GHSR were changed from Idiopathic short stature, GH deficiency to Growth hormone deficiency, isolated partial, MIM# 615925
Growth failure v0.319 GHSR Zornitza Stark Publications for gene: GHSR were set to 16511605
Growth failure v0.318 GHSR Zornitza Stark Classified gene: GHSR as Amber List (moderate evidence)
Growth failure v0.318 GHSR Zornitza Stark Gene: ghsr has been classified as Amber List (Moderate Evidence).
Growth failure v0.317 GHSR Zornitza Stark reviewed gene: GHSR: Rating: AMBER; Mode of pathogenicity: None; Publications: 25557026, 19789204; Phenotypes: Growth hormone deficiency, isolated partial, MIM# 615925; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAG2 Danielle Ariti reviewed gene: RAG2: Rating: GREEN; Mode of pathogenicity: None; Publications: 9630231, 11313270, 31885011, 8810255, 15025726, 18463379; Phenotypes: Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457, Combined cellular and humoral immune defects with granulomas MIM# 233650; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAC2 Danielle Ariti changed review comment from: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis
2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies

Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function.

Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia.
--------
Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia
Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model.

They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function.

Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism.

Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID.
---------
Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia
13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models

Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R)

These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia.
-----
Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (loss of function)
Amber- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (loss of function)
Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (gain of function); to: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis
2 unrelated individuals; mono-allelic; loss of function; One mouse model; functional studies

Both individuals carried a de novo heterozygous missense variant (p.Asp57Asn), resulting in an impaired GTP binding domain and loss of function.

Both individuals presented from birth with recurrent perirectal/ paratracheal abscesses, failure to heal surgical wounds, and the absence of pus in infected areas, in addition to leukocytosis and neutrophilia.
--------
Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia
Only one family (2 sibs) has been reported; bi-allelic; loss of function; one mouse model.

They were homozygous for a nonsense variant p.Trp56Ter (W56X), resulting in premature termination and loss of function.

Clinical history included recurrent respiratory infections leading to the development of bronchiectasis, urticaria, factor XI deficiency, and hypothyroidism.

Their immunologic presentation showed a progression from selective IgA deficiency to Hypogammaglobulinaemia of all classes leading to a diagnosis of CVID.
---------
Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia
13 individuals from 8 unrelated families; mono-allelic; gain of function; multiple mouse models

Mono-allelic missense variants were reported in each individual (5 x De Novo) and resulted in a gain-of -function. (E62K, P34H, N92T, G12R)

These individuals typically presented in infancy with frequent infections, profound leukopaenia, lymphopaenia diarrhoea and hypogammaglobulinaemia.
-----
Amber- Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis (Mono-allelic; loss of function)
Red- Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia (Bi-allelic; loss of function)
Green- Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia (Mono-allelic; gain of function)
Intellectual disability syndromic and non-syndromic v0.4088 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4088 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark changed review comment from: Two families and functional data.; to: Two families and good functional data.
Intellectual disability syndromic and non-syndromic v0.4087 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Polydactyly v0.236 PDE6D Zornitza Stark changed review comment from: Comment on publications: Second family identified; to: Comment on publications: Second family identified.
Polydactyly v0.236 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: AMBER
Polydactyly v0.236 PDE6D Zornitza Stark Deleted their comment
Mendeliome v0.8928 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed publications: 30423442, 24166846
Mendeliome v0.8928 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Mendeliome v0.8928 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Mendeliome v0.8927 PDE6D Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified in the literature.; to: Comment when marking as ready: Second family identified in the literature. Good functional data.
Mendeliome v0.8927 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Ciliopathies v1.11 PDE6D Zornitza Stark Classified gene: PDE6D as Green List (high evidence)
Ciliopathies v1.11 PDE6D Zornitza Stark Gene: pde6d has been classified as Green List (High Evidence).
Ciliopathies v1.10 PDE6D Zornitza Stark changed review comment from: Comment when marking as ready: Second family identified PMID 30423442; to: Comment when marking as ready: Second family identified PMID 30423442. Good functional data.
Ciliopathies v1.10 PDE6D Zornitza Stark edited their review of gene: PDE6D: Changed rating: GREEN
Mendeliome v0.8927 GHRHR Zornitza Stark Marked gene: GHRHR as ready
Mendeliome v0.8927 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Mendeliome v0.8927 GHRHR Zornitza Stark Phenotypes for gene: GHRHR were changed from to Growth hormone deficiency, isolated, type IV, MIM# 618157
Mendeliome v0.8926 GHRHR Zornitza Stark Publications for gene: GHRHR were set to
Mendeliome v0.8925 GHRHR Zornitza Stark Mode of inheritance for gene: GHRHR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8924 GHRHR Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.317 GHRHR Zornitza Stark Marked gene: GHRHR as ready
Growth failure v0.317 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Growth failure v0.317 GHRHR Zornitza Stark Phenotypes for gene: GHRHR were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IV, MIM# 618157
Growth failure v0.316 GHRHR Zornitza Stark Publications for gene: GHRHR were set to
Growth failure v0.315 GHRHR Zornitza Stark Classified gene: GHRHR as Green List (high evidence)
Growth failure v0.315 GHRHR Zornitza Stark Gene: ghrhr has been classified as Green List (High Evidence).
Growth failure v0.314 GHRHR Zornitza Stark reviewed gene: GHRHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 8528260, 10084571, 11232012; Phenotypes: Growth hormone deficiency, isolated, type IV, MIM# 618157; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8924 GHR Zornitza Stark Marked gene: GHR as ready
Mendeliome v0.8924 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Mendeliome v0.8924 GHR Zornitza Stark Phenotypes for gene: GHR were changed from to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500
Mendeliome v0.8923 GHR Zornitza Stark Publications for gene: GHR were set to
Mendeliome v0.8922 GHR Zornitza Stark Mode of inheritance for gene: GHR was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8921 GHR Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.314 GHR Zornitza Stark Marked gene: GHR as ready
Growth failure v0.314 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Growth failure v0.314 GHR Zornitza Stark Phenotypes for gene: GHR were changed from Laron syndrome to Growth hormone insensitivity, partial, MIM# 604271; Laron dwarfism, MIM# 262500
Growth failure v0.313 GHR Zornitza Stark Publications for gene: GHR were set to
Growth failure v0.312 GHR Zornitza Stark Mode of inheritance for gene: GHR was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.311 GHR Zornitza Stark Classified gene: GHR as Green List (high evidence)
Growth failure v0.311 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Growth failure v0.310 GHR Zornitza Stark reviewed gene: GHR: Rating: GREEN; Mode of pathogenicity: None; Publications: 1999489, 8488849, 7565946; Phenotypes: Growth hormone insensitivity, partial, MIM# 604271, Laron dwarfism, MIM# 262500; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAG1 Danielle Ariti reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 16276422, 18463379, 20489056, 9630231, 11313270, 17476359, 8810255, 6823332; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 RAC2 Danielle Ariti reviewed gene: RAC2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 21167572, 10758162, 10072071, 25512081, 32542921, 31919089; Phenotypes: Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203, Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987, Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.365 MTHFD1 Danielle Ariti reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32414565, 19033438; Phenotypes: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780, Decreased Ig levels, poor antibody responses to conjugated polysaccharide antigens, low B/T/NK cells, Recurrent bacterial infection, megaloblastic anaemia, failure to thrive, neutropenia, seizures, intellectual disability, folate-responsive, Lymphopaenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Joubert syndrome and other neurological ciliopathies v1.12 PDE6D Chirag Patel Classified gene: PDE6D as Green List (high evidence)
Joubert syndrome and other neurological ciliopathies v1.12 PDE6D Chirag Patel Gene: pde6d has been classified as Green List (High Evidence).
Joubert syndrome and other neurological ciliopathies v1.11 PDE6D Chirag Patel reviewed gene: PDE6D: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24166846; Phenotypes: Joubert syndrome 22, OMIM #615665; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8921 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Mendeliome v0.8921 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Mendeliome v0.8921 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Mendeliome v0.8921 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Mendeliome v0.8920 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Hereditary Spastic Paraplegia v1.15 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Hereditary Spastic Paraplegia v1.14 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Dystonia and Chorea v0.189 RNU7-1 Zornitza Stark Marked gene: RNU7-1 as ready
Dystonia and Chorea v0.189 RNU7-1 Zornitza Stark Gene: rnu7-1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.189 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Dystonia and Chorea v0.188 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4087 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Intellectual disability syndromic and non-syndromic v0.4086 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Regression v0.358 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Regression v0.357 RNU7-1 Zornitza Stark edited their review of gene: RNU7-1: Changed phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487
Mendeliome v0.8919 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Mendeliome v0.8918 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Brain Calcification v1.12 RNU7-1 Zornitza Stark Phenotypes for gene: RNU7-1 were changed from Aicardi–Goutières syndrome-like to Aicardi-Goutieres syndrome 9, MIM# 619487
Brain Calcification v1.11 RNU7-1 Zornitza Stark reviewed gene: RNU7-1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 9, MIM# 619487; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.4086 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Intellectual disability syndromic and non-syndromic v0.4085 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Regression v0.357 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Regression v0.356 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Mendeliome v0.8918 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Mendeliome v0.8917 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Brain Calcification v1.11 LSM11 Zornitza Stark Phenotypes for gene: LSM11 were changed from type I interferonopathy Aicardi–Goutières syndrome to Aicardi-Goutieres syndrome 8, MIM# 619486
Brain Calcification v1.10 LSM11 Zornitza Stark reviewed gene: LSM11: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 8, MIM# 619486; Mode of inheritance: None
Microcephaly v1.44 WDR11 Zornitza Stark Marked gene: WDR11 as ready
Microcephaly v1.44 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Microcephaly v1.44 WDR11 Zornitza Stark Classified gene: WDR11 as Green List (high evidence)
Microcephaly v1.44 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Microcephaly v1.43 WDR11 Zornitza Stark gene: WDR11 was added
gene: WDR11 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: WDR11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR11 were set to 34413497
Phenotypes for gene: WDR11 were set to Intellectual disability; Microcephaly; Short stature
Review for gene: WDR11 was set to GREEN
Added comment: Haag et al (2021 - PMID: 34413497) report on 6 individuals from 3 unrelated families, harboring biallelic LoF WDR11 variants.

Common features included microcephaly (6/6 - range: -2.43 SD to -4.93SD) and intellectual disability (6/6, in 5 cases mild, in 1 severe) with some individuals presenting also with mild short stature.

Homozygosity or compound heterozygosity for LoF variants in affected individuals was identified following exome sequencing (fam1: NM_018117.12:c.1255C>T/p.Q419* hmz, fam2:c.3033_3036del/D1011Efs*21 in trans with c.1439del/p.N480Tfs*32, fam3:c.2931+1G>A hmz).

Segregation studies supported carrier state of parents and unaffected sibs (or homozygosity for wt allele in the latter).

Variable previous investigations incl. standard karyotype and CMA were normal in several subjects (notably index cases from each family).
-----
As the authors comment WDR11 encodes for the WD repeat domain 11 protein and has broad expression in the developing mouse CNS. Mutations in other genes encoding for WD repeat proteins have been associated with neurological, endocrine or other disorders incl. ciliopathies.

Heterozygous missense WDR11 variants are associated with hypogonadotropic hypogonadism (HH) 14 with or without anosmia (MIM #614858). [Gene2Phenotype : monoallelic, all missense/in-frame].

The authors performed extensive hormonal studies and argue that the phenotype associated with biallelic variants differs significantly from the dominantly inherited variants (HH) suggesting that biallelic variants result in a clinically distinct entity. In addition, carrier parents of the individuals reported by Haag et al had no obvious signs of congenital HH. However, there was no endocrinological examination performed.
-----
Variant effect:
Immunofluorescence studies demonstrated strong juxtanuclear WDR11 staining in control fibroblasts , but only cell-ubiquitous background labeling in patient fibroblasts (for Q419*). There was also evidence for colocalization of wt WDR11 to the trans-Golgi network (TGN) with loss of this pattern in patient fibroblasts (Q419*).

Western blot in whole cell lysates of cultured patient fibroblasts (same variant) proved loss of WDR11 irrespectively of the antibody used (against N- or C-terminal epitopes of WDR11). There was no indication of a truncated protein.
-----
Animal models:
The authors discuss previous evidence from mice/zebrafish models suggesting abnormal Hedgehog signaling in the primary cilium and impaired ciliogenesis due to loss of WDR11.

Wdr11-null mice display features of holoprosencephaly incl. microcephaly, hypotelorism, micro/anophthalmia, abnormal pituitary gland, growth retardation, heart defects, hypoplasia of reproductive organs and infertility. There was evidence of reduced length of the ciliary axoneme and reduced frequency of ciliated cells.

Knockdown of wdr11 in zebrafish led to microcephaly, aberrant head cartilage formation, microphthalmia, curved body axis, motility defects.

Overall the authors consider that the phenotype of microcephaly, variable growth delay and/or some visual/skeletal anomalies are recapitulated to some degree in animal models, although a more severe phenotype is observed in mice.

In the cohort presented by Haag et al there was no evidence of congenital heart defects, brain malformations, abnormal sexual hormone profiles or pituitary (MRI) abnormalities based on the investigations performed.
-----
The authors discuss briefly on the previously proposed role for WDR11 in endosome to trans Golgi network vesicular trafficking which might also be supported by their colocalization experiments in patient fibroblasts.
Sources: Literature
Mendeliome v0.8917 WDR11 Zornitza Stark Marked gene: WDR11 as ready
Mendeliome v0.8917 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Mendeliome v0.8917 WDR11 Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858
Mendeliome v0.8916 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Mendeliome v0.8915 WDR11 Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8914 WDR11 Zornitza Stark reviewed gene: WDR11: Rating: GREEN; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4085 WDR11 Zornitza Stark Phenotypes for gene: WDR11 were changed from to Intellectual disability; Microcephaly; Short stature
Intellectual disability syndromic and non-syndromic v0.4084 WDR11 Zornitza Stark Publications for gene: WDR11 were set to
Intellectual disability syndromic and non-syndromic v0.4083 WDR11 Zornitza Stark Mode of inheritance for gene: WDR11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4082 WDR11 Zornitza Stark Classified gene: WDR11 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4082 WDR11 Zornitza Stark Gene: wdr11 has been classified as Green List (High Evidence).
Mendeliome v0.8914 Bryony Thompson removed STR:SCA12 from the panel
Repeat Disorders v0.65 SCA12 Bryony Thompson Marked STR: SCA12 as ready
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.65 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Repeat Disorders v0.65 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Repeat Disorders v0.64 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 27864267; 33811808
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4081 WDR11 Konstantinos Varvagiannis reviewed gene: WDR11: Rating: AMBER; Mode of pathogenicity: None; Publications: 34413497; Phenotypes: Intellectual disability, Microcephaly, Short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8913 GH1 Zornitza Stark Marked gene: GH1 as ready
Mendeliome v0.8913 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Mendeliome v0.8913 GH1 Zornitza Stark Phenotypes for gene: GH1 were changed from to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650
Mendeliome v0.8912 GH1 Zornitza Stark Publications for gene: GH1 were set to
Mendeliome v0.8911 GH1 Zornitza Stark Mode of inheritance for gene: GH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8910 GH1 Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.310 GH1 Zornitza Stark Marked gene: GH1 as ready
Growth failure v0.310 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Growth failure v0.310 GH1 Zornitza Stark Phenotypes for gene: GH1 were changed from Growth hormone deficiency to Growth hormone deficiency, isolated, type IA, MIM# 262400; Growth hormone deficiency, isolated, type II, MIM# 173100; Kowarski syndrome, MIM# 262650
Growth failure v0.309 GH1 Zornitza Stark Publications for gene: GH1 were set to
Growth failure v0.308 GH1 Zornitza Stark Classified gene: GH1 as Green List (high evidence)
Growth failure v0.308 GH1 Zornitza Stark Gene: gh1 has been classified as Green List (High Evidence).
Growth failure v0.307 GH1 Zornitza Stark reviewed gene: GH1: Rating: GREEN; Mode of pathogenicity: None; Publications: 2840669, 1603635, 12655557, 15671105, 8552145, 9276733, 15713716; Phenotypes: Growth hormone deficiency, isolated, type IA, MIM# 262400, Growth hormone deficiency, isolated, type II, MIM# 173100, Kowarski syndrome, MIM# 262650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.307 Zornitza Stark removed gene:FGFR1 from the panel
Growth failure v0.306 Zornitza Stark removed gene:FGF8 from the panel
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Monogenic Diabetes v0.23 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Monogenic Diabetes v0.22 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Monogenic Diabetes. Sources: Literature
Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHX1 were set to 34342583
Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes
Review for gene: EPHX1 was set to AMBER
Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts.
Sources: Literature
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Lipodystrophy_Lipoatrophy v1.3 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Growth failure v0.305 Zornitza Stark removed gene:EPHX1 from the panel
Mendeliome v0.8910 EPHX1 Zornitza Stark Marked gene: EPHX1 as ready
Mendeliome v0.8910 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Lipodystrophy_Lipoatrophy v1.2 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Lipodystrophy_Lipoatrophy. Sources: Literature
Mode of inheritance for gene: EPHX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: EPHX1 were set to 34342583
Phenotypes for gene: EPHX1 were set to Lipoatrophic diabetes
Review for gene: EPHX1 was set to AMBER
Added comment: Two individuals reported with de novo variants in this gene and lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts.
Sources: Literature
Mendeliome v0.8910 EPHX1 Zornitza Stark Phenotypes for gene: EPHX1 were changed from to Lipoatrophic diabetes
Mendeliome v0.8909 EPHX1 Zornitza Stark Publications for gene: EPHX1 were set to
Mendeliome v0.8908 EPHX1 Zornitza Stark Mode of inheritance for gene: EPHX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8907 EPHX1 Zornitza Stark Classified gene: EPHX1 as Amber List (moderate evidence)
Mendeliome v0.8907 EPHX1 Zornitza Stark Gene: ephx1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8906 EPHX1 Zornitza Stark reviewed gene: EPHX1: Rating: AMBER; Mode of pathogenicity: None; Publications: 34342583; Phenotypes: Lipoatrophic diabetes; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.304 EP300 Zornitza Stark Marked gene: EP300 as ready
Growth failure v0.304 EP300 Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence).
Growth failure v0.304 EP300 Zornitza Stark Phenotypes for gene: EP300 were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 2, MIM# 613684; Menke-Hennekam syndrome , MIM#2 618333
Growth failure v0.303 EP300 Zornitza Stark Publications for gene: EP300 were set to
Growth failure v0.302 EP300 Zornitza Stark Classified gene: EP300 as Green List (high evidence)
Growth failure v0.302 EP300 Zornitza Stark Gene: ep300 has been classified as Green List (High Evidence).
Growth failure v0.301 EP300 Zornitza Stark reviewed gene: EP300: Rating: GREEN; Mode of pathogenicity: None; Publications: 29506490, 29460469; Phenotypes: Rubinstein-Taybi syndrome 2, MIM# 613684, Menke-Hennekam syndrome , MIM#2 618333; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.301 Zornitza Stark removed gene:COL1A1 from the panel
Growth failure v0.300 Zornitza Stark removed gene:DOK7 from the panel
Growth failure v0.299 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Growth failure v0.299 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Growth failure v0.299 DHCR7 Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith Lemli Opitz to Smith-Lemli-Opitz syndrome, MIM#270400
Growth failure v0.298 DHCR7 Zornitza Stark Classified gene: DHCR7 as Green List (high evidence)
Growth failure v0.298 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Growth failure v0.297 DHCR7 Zornitza Stark reviewed gene: DHCR7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Smith-Lemli-Opitz syndrome, MIM#270400; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.297 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Growth failure v0.297 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Growth failure v0.297 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from Rubenstein Taybi to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Growth failure v0.296 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Growth failure v0.295 CREBBP Zornitza Stark Classified gene: CREBBP as Green List (high evidence)
Growth failure v0.295 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Growth failure v0.294 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8906 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Mendeliome v0.8906 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Mendeliome v0.8906 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Growth failure v0.294 ATRX Zornitza Stark Marked gene: ATRX as ready
Growth failure v0.294 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Growth failure v0.294 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from SGA, which is sometimes called intrauterine growth restriction (IUGR), to Alpha-thalassemia/mental retardation syndrome, MIM# 301040; Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580
Growth failure v0.293 ATRX Zornitza Stark Publications for gene: ATRX were set to
Growth failure v0.292 ATRX Zornitza Stark Mode of inheritance for gene: ATRX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.291 ATRX Zornitza Stark Classified gene: ATRX as Green List (high evidence)
Growth failure v0.291 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Growth failure v0.290 ATRX Zornitza Stark reviewed gene: ATRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301622; Phenotypes: Alpha-thalassemia/mental retardation syndrome, MIM# 301040, Mental retardation-hypotonic facies syndrome, X-linked, MIM# 309580; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.290 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Growth failure v0.290 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Growth failure v0.290 ZBTB24 Zornitza Stark Classified gene: ZBTB24 as Green List (high evidence)
Growth failure v0.290 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Growth failure v0.289 ZBTB24 Zornitza Stark gene: ZBTB24 was added
gene: ZBTB24 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ZBTB24 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZBTB24 were set to 21596365; 21906047; 23486536
Phenotypes for gene: ZBTB24 were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069; MONDO:0013553
Review for gene: ZBTB24 was set to GREEN
Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is characterized by facial dysmorphism, immunoglobulin deficiency resulting in recurrent infections, and intellectual disability. Laboratory studies of patient cells show hypomethylation of satellite regions of chromosomes 1, 9, and 16, as well as pericentromeric chromosomal instability in response to phytohaemagglutinin stimulation.

20 unrelated families reported. Short stature is a feature.
Sources: Expert Review
Growth failure v0.288 SPRTN Zornitza Stark Marked gene: SPRTN as ready
Growth failure v0.288 SPRTN Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence).
Growth failure v0.288 SPRTN Zornitza Stark Classified gene: SPRTN as Green List (high evidence)
Growth failure v0.288 SPRTN Zornitza Stark Gene: sprtn has been classified as Green List (High Evidence).
Growth failure v0.287 SPRTN Zornitza Stark gene: SPRTN was added
gene: SPRTN was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: SPRTN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SPRTN were set to 25261934
Phenotypes for gene: SPRTN were set to Ruijs-Aalfs syndrome, MIM# 616200; MONDO:0014527
Review for gene: SPRTN was set to GREEN
Added comment: Two families with functional evidence for a DNA repair disorder; progeroid features and hepatocellular carcinoma reported as key features, as is short stature.
Sources: Expert Review
Growth failure v0.286 RNF168 Zornitza Stark Marked gene: RNF168 as ready
Growth failure v0.286 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Growth failure v0.286 RNF168 Zornitza Stark Classified gene: RNF168 as Green List (high evidence)
Growth failure v0.286 RNF168 Zornitza Stark Gene: rnf168 has been classified as Green List (High Evidence).
Growth failure v0.285 RNF168 Zornitza Stark gene: RNF168 was added
gene: RNF168 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RNF168 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF168 were set to 19203578; 21394101; 29255463; 21552324
Phenotypes for gene: RNF168 were set to RIDDLE syndrome MIM# 611943; Radiosensitivity; Immune Deficiency; Dysmorphic Features; Learning difficulties; Low IgG or IgA; Short stature; mild defect of motor control to ataxia; normal intelligence to learning difficulties; mild facial dysmorphism to microcephaly
Review for gene: RNF168 was set to GREEN
Added comment: 4 individuals from 3 unrelated families have been reported with RNF168 variants and display RIDDLE syndrome phenotype.

One mouse model; demonstrated RNF168 deficient mice are immunodeficient and exhibit increased radiosensitivity.

Homozygous and Compound heterozygous (duplications, deletions and nonsense) variants identified resulting in frameshift, aberrant protein and alteration of binding motifs.

Typically presents with increased radiosensitivity, immunodeficiency (decrease IgA), mild motor control and learning difficulties, facial dysmorphism, and short stature.
Sources: Expert Review
Growth failure v0.284 RECQL4 Zornitza Stark Marked gene: RECQL4 as ready
Growth failure v0.284 RECQL4 Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence).
Growth failure v0.284 RECQL4 Zornitza Stark Classified gene: RECQL4 as Green List (high evidence)
Growth failure v0.284 RECQL4 Zornitza Stark Gene: recql4 has been classified as Green List (High Evidence).
Growth failure v0.283 RECQL4 Zornitza Stark gene: RECQL4 was added
gene: RECQL4 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RECQL4 were set to 10319867; 12952869; 15964893
Phenotypes for gene: RECQL4 were set to Rothmund-Thomson syndrome, type 2, MIM# 268400; RAPADILINO syndrome, MIM# 266280; Baller-Gerold syndrome, MIM# 218600
Review for gene: RECQL4 was set to GREEN
Added comment: Gene encodes DNA helicase involved in DNA repair. Bi-allelic variants associated with a range of phenotypes. Short stature is a feature of these disorders.
Sources: Expert Review
Growth failure v0.282 RAD51C Zornitza Stark Marked gene: RAD51C as ready
Growth failure v0.282 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Growth failure v0.282 RAD51C Zornitza Stark Classified gene: RAD51C as Green List (high evidence)
Growth failure v0.282 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Growth failure v0.281 RAD51C Zornitza Stark gene: RAD51C was added
gene: RAD51C was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD51C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAD51C were set to 20400963; 29278735
Phenotypes for gene: RAD51C were set to Fanconi anaemia, complementation group O, MIM# 613390
Review for gene: RAD51C was set to GREEN
Added comment: Two unrelated families reported, excellent biological candidate for FA.
Sources: Expert Review
Growth failure v0.280 RAD51 Zornitza Stark Marked gene: RAD51 as ready
Growth failure v0.280 RAD51 Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence).
Growth failure v0.280 RAD51 Zornitza Stark Classified gene: RAD51 as Green List (high evidence)
Growth failure v0.280 RAD51 Zornitza Stark Gene: rad51 has been classified as Green List (High Evidence).
Growth failure v0.279 RAD51 Zornitza Stark gene: RAD51 was added
gene: RAD51 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD51 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD51 were set to 26253028; 26681308; 30907510
Phenotypes for gene: RAD51 were set to Fanconi anaemia, complementation group R, MIM# 617244
Review for gene: RAD51 was set to GREEN
Added comment: Three unrelated individuals reported with de novo missense variants in this gene.
Sources: Expert Review
Growth failure v0.278 RAD50 Zornitza Stark Marked gene: RAD50 as ready
Growth failure v0.278 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Growth failure v0.278 RAD50 Zornitza Stark Classified gene: RAD50 as Green List (high evidence)
Growth failure v0.278 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Growth failure v0.277 RAD50 Zornitza Stark gene: RAD50 was added
gene: RAD50 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RAD50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RAD50 were set to 19409520; 32212377; 33378670
Phenotypes for gene: RAD50 were set to Nijmegen breakage syndrome-like disorder, MIM# 613078; MONDO:0013118
Review for gene: RAD50 was set to GREEN
Added comment: Three unrelated families reported, short stature is a key feature.
Sources: Expert Review
Growth failure v0.276 NHEJ1 Zornitza Stark Marked gene: NHEJ1 as ready
Growth failure v0.276 NHEJ1 Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence).
Growth failure v0.276 NHEJ1 Zornitza Stark Classified gene: NHEJ1 as Green List (high evidence)
Growth failure v0.276 NHEJ1 Zornitza Stark Gene: nhej1 has been classified as Green List (High Evidence).
Growth failure v0.275 NHEJ1 Zornitza Stark gene: NHEJ1 was added
gene: NHEJ1 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NHEJ1 were set to 16439204; 16439205
Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation, MIM# 611291; MONDO:0012650
Review for gene: NHEJ1 was set to GREEN
Added comment: More than 5 unrelated families reported, poor growth is a key feature.
Sources: Expert Review
Growth failure v0.274 MPLKIP Zornitza Stark Marked gene: MPLKIP as ready
Growth failure v0.274 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Growth failure v0.274 MPLKIP Zornitza Stark Classified gene: MPLKIP as Green List (high evidence)
Growth failure v0.274 MPLKIP Zornitza Stark Gene: mplkip has been classified as Green List (High Evidence).
Growth failure v0.273 MPLKIP Zornitza Stark gene: MPLKIP was added
gene: MPLKIP was added to Growth failure in early childhood. Sources: Expert list
Mode of inheritance for gene: MPLKIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MPLKIP were set to 15645389; 16977596
Phenotypes for gene: MPLKIP were set to Trichothiodystrophy 4, nonphotosensitive, MIM# 234050; MONDO:0021013
Review for gene: MPLKIP was set to GREEN
Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections.

Gene previously known as c7orf11.

More than 5 unrelated families reported.
Sources: Expert list
Growth failure v0.272 GTF2H5 Zornitza Stark Marked gene: GTF2H5 as ready
Growth failure v0.272 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Growth failure v0.272 GTF2H5 Zornitza Stark Classified gene: GTF2H5 as Green List (high evidence)
Growth failure v0.272 GTF2H5 Zornitza Stark Gene: gtf2h5 has been classified as Green List (High Evidence).
Growth failure v0.271 GTF2H5 Zornitza Stark gene: GTF2H5 was added
gene: GTF2H5 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTF2H5 were set to 15220921; 30359777; 24986372
Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy 3, photosensitive, MIM# 616395; MONDO:0014619
Review for gene: GTF2H5 was set to GREEN
Added comment: Trichothiodystrophy is a rare autosomal recessive disorder in which patients have brittle, sulfur-deficient hair that displays a diagnostic alternating light and dark banding pattern, called 'tiger tail banding,' under polarizing microscopy. TTD patients display a wide variety of clinical features, including cutaneous, neurologic, and growth abnormalities. Common additional clinical features are ichthyosis, intellectual/developmental disabilities, decreased fertility, abnormal characteristics at birth, ocular abnormalities, short stature, and infections.

Established gene-disease association, at least 5 families reported.
Sources: Expert Review
Growth failure v0.270 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Growth failure v0.270 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Growth failure v0.270 ERCC5 Zornitza Stark Classified gene: ERCC5 as Green List (high evidence)
Growth failure v0.270 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Growth failure v0.269 ERCC5 Zornitza Stark gene: ERCC5 was added
gene: ERCC5 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC5 were set to 7951246; 9096355; 9096355; 24700531; 33766032; 33219753
Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216
Review for gene: ERCC5 was set to GREEN
Added comment: Well established gene-disease association, spectrum of severity. Poor growth is a feature of COFS but is also present in some individuals with xeroderma pigmentosa.
Sources: Expert Review
Growth failure v0.268 ERCC3 Zornitza Stark Marked gene: ERCC3 as ready
Growth failure v0.268 ERCC3 Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence).
Growth failure v0.268 ERCC3 Zornitza Stark Classified gene: ERCC3 as Green List (high evidence)
Growth failure v0.268 ERCC3 Zornitza Stark Gene: ercc3 has been classified as Green List (High Evidence).
Growth failure v0.267 ERCC3 Zornitza Stark gene: ERCC3 was added
gene: ERCC3 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC3 were set to 2167179; 10447254; 16947863; 9012405; 32557569; 27004399
Phenotypes for gene: ERCC3 were set to Trichothiodystrophy 2, photosensitive, MIM# 616390; Xeroderma pigmentosum, group B 61, MIM#0651
Review for gene: ERCC3 was set to GREEN
Added comment: Nucleotide excision repair disorder, variable severity, short stature associated with both disorders.
Sources: Expert Review
Growth failure v0.266 ERCC2 Zornitza Stark Marked gene: ERCC2 as ready
Growth failure v0.266 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Growth failure v0.266 ERCC2 Zornitza Stark Classified gene: ERCC2 as Green List (high evidence)
Growth failure v0.266 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Growth failure v0.265 ERCC2 Zornitza Stark gene: ERCC2 was added
gene: ERCC2 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ERCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC2 were set to 7849702; 9758621; 11443545; 33733458
Phenotypes for gene: ERCC2 were set to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675
Review for gene: ERCC2 was set to GREEN
Added comment: Bi-allelic inactivation of XPD protein, a nucleotide excision repair (NER) signaling pathway component encoded by ERCC2 gene, has been associated with several defective DNA repair phenotypes, of which photosensitive trichothiodystrophy and cerebro-oculo-facio-skeletal syndrome have short stature as a feature.
Sources: Expert Review
Growth failure v0.264 DNMT3B Zornitza Stark Marked gene: DNMT3B as ready
Growth failure v0.264 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Growth failure v0.264 DNMT3B Zornitza Stark Classified gene: DNMT3B as Green List (high evidence)
Growth failure v0.264 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Growth failure v0.263 DNMT3B Zornitza Stark gene: DNMT3B was added
gene: DNMT3B was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNMT3B were set to 10647011; 23486536
Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1, MIM# 242860
Review for gene: DNMT3B was set to GREEN
Added comment: Immunodeficiency, centromeric instability, and facial dysmorphism (ICF) syndrome is a rare autosomal recessive disease characterized by facial dysmorphism, immunoglobulin deficiency, and branching of chromosomes 1, 9, and 16 after phytohemagglutinin (PHA) stimulation of lymphocytes.

More than 20 unrelated families reported.

Short stature is a feature.
Sources: Expert Review
Growth failure v0.262 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Growth failure v0.262 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Growth failure v0.262 DDX11 Zornitza Stark Classified gene: DDX11 as Green List (high evidence)
Growth failure v0.262 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Growth failure v0.261 DDX11 Zornitza Stark gene: DDX11 was added
gene: DDX11 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX11 were set to 20137776; 23033317; 30216658
Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM# 613398; MONDO:0013252
Review for gene: DDX11 was set to GREEN
Added comment: PMID 30216658 reviews 12 individuals reported to date: severe microcephaly with prenatal onset was identified in all patients, and severe pre- and postnatal growth restriction was observed in 11 of 11 patients. All 12 patients had sensorineural hearing loss, with 10 of 10 having cochlear hypoplasia or functional abnormalities; 1 patient had a posterior labyrinthine anomaly. In all 4 patients who had brain imaging, abnormalities were identified. Some patients had other structural anomalies, including cardiac defects (5/12), recurrent infections (4/9), and skin pigmentation changes (6/12). Craniofacial features included a depressed nasal bridge with a broad nasal tip and overhanging columella. Elevated induced chromosome breakage was observed in 6 of 8 reported patients. Cohesin defects (premature chromatid separation and premature centromere division) were consistent in most metaphases among the patients examined.
Sources: Expert Review
Growth failure v0.260 BRCA1 Zornitza Stark Marked gene: BRCA1 as ready
Growth failure v0.260 BRCA1 Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence).
Growth failure v0.260 BRCA1 Zornitza Stark Classified gene: BRCA1 as Green List (high evidence)
Growth failure v0.260 BRCA1 Zornitza Stark Gene: brca1 has been classified as Green List (High Evidence).
Growth failure v0.259 BRCA1 Zornitza Stark gene: BRCA1 was added
gene: BRCA1 was added to Growth failure in early childhood. Sources: Expert list
Mode of inheritance for gene: BRCA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRCA1 were set to 23269703; 29133208; 25472942; 29712865
Phenotypes for gene: BRCA1 were set to Fanconi anaemia, complementation group S, MIM# 617883
Review for gene: BRCA1 was set to GREEN
Added comment: At least 5 unrelated families with bi-allelic variants reported and FA phenotype. Short stature is a feature.
Sources: Expert list
Mendeliome v0.8905 ATM Zornitza Stark Phenotypes for gene: ATM were changed from to Ataxia-telangiectasia, MIM# 208900
Mendeliome v0.8904 ATM Zornitza Stark Publications for gene: ATM were set to
Mendeliome v0.8903 ATM Zornitza Stark reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: 30137827; Phenotypes: Ataxia-telangiectasia, MIM# 208900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.258 ATM Zornitza Stark Marked gene: ATM as ready
Growth failure v0.258 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Growth failure v0.258 ATM Zornitza Stark Classified gene: ATM as Green List (high evidence)
Growth failure v0.258 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Growth failure v0.257 ATM Zornitza Stark gene: ATM was added
gene: ATM was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ATM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATM were set to 30137827
Phenotypes for gene: ATM were set to Ataxia-telangiectasia, MIM# 208900
Review for gene: ATM was set to GREEN
Added comment: Well established gene-disease association.

Ataxia-telangiectasia (AT) is a chromosome breakage disorder characterized by cerebellar ataxia, telangiectases, immune defects, and a predisposition to malignancy.

Short stature is a feature.
Sources: Expert Review
Growth failure v0.256 TRAIP Zornitza Stark Marked gene: TRAIP as ready
Growth failure v0.256 TRAIP Zornitza Stark Gene: traip has been classified as Green List (High Evidence).
Growth failure v0.256 TRAIP Zornitza Stark Classified gene: TRAIP as Green List (high evidence)
Growth failure v0.256 TRAIP Zornitza Stark Gene: traip has been classified as Green List (High Evidence).
Growth failure v0.255 TRAIP Zornitza Stark gene: TRAIP was added
gene: TRAIP was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: TRAIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAIP were set to 26595769
Phenotypes for gene: TRAIP were set to Seckel syndrome 9, MIM# 616777
Review for gene: TRAIP was set to GREEN
Added comment: Three families reported, though two distantly related (founder); functional data.
Sources: Expert Review
Growth failure v0.254 RNU4ATAC Zornitza Stark Marked gene: RNU4ATAC as ready
Growth failure v0.254 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Growth failure v0.254 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from MOPD I to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Growth failure v0.253 RNU4ATAC Zornitza Stark Publications for gene: RNU4ATAC were set to 21474760
Growth failure v0.252 RNU4ATAC Zornitza Stark Classified gene: RNU4ATAC as Green List (high evidence)
Growth failure v0.252 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Growth failure v0.251 RNU4ATAC Zornitza Stark reviewed gene: RNU4ATAC: Rating: GREEN; Mode of pathogenicity: None; Publications: 23794361, 26522830, 30455926, 29265708, 12605445; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710), Roifman syndrome (MIM# 616651), Lowry-Wood syndrome, MIM# 226960; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8903 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960 to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Mendeliome v0.8902 RNU4ATAC Zornitza Stark Phenotypes for gene: RNU4ATAC were changed from Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651) to Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710); Roifman syndrome (MIM# 616651); Lowry-Wood syndrome, MIM# 226960
Mendeliome v0.8901 RNU4ATAC Zornitza Stark Publications for gene: RNU4ATAC were set to 23794361; 26522830; 30455926
Mendeliome v0.8900 RNU4ATAC Zornitza Stark edited their review of gene: RNU4ATAC: Added comment: Lowry-Wood syndrome (LWS) is characterized by multiple epiphyseal dysplasia and microcephaly. Patients exhibit intrauterine growth retardation and short stature, as well as developmental delay and intellectual disability. Retinal degeneration has been reported in some patients.

Four unrelated families reported.

Note features between the three RNU4ATAC-related conditions overlap and they may not represent distinct disorders.; Changed rating: GREEN; Changed publications: 29265708, 12605445; Changed phenotypes: Lowry-Wood syndrome, MIM# 226960; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.251 RBBP8 Zornitza Stark Marked gene: RBBP8 as ready
Growth failure v0.251 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence).
Growth failure v0.251 RBBP8 Zornitza Stark Phenotypes for gene: RBBP8 were changed from seckel syndrome but with proportionate head/height impairment, cafe au lair macules to Seckel syndrome 2, MIM# 606744
Growth failure v0.250 RBBP8 Zornitza Stark Publications for gene: RBBP8 were set to 24389050, 21998596
Growth failure v0.249 RBBP8 Zornitza Stark Classified gene: RBBP8 as Amber List (moderate evidence)
Growth failure v0.249 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Amber List (Moderate Evidence).
Growth failure v0.248 RBBP8 Zornitza Stark reviewed gene: RBBP8: Rating: AMBER; Mode of pathogenicity: None; Publications: 21998596, 24389050; Phenotypes: Seckel syndrome 2, MIM# 606744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.248 POLE Zornitza Stark Marked gene: POLE as ready
Growth failure v0.248 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Growth failure v0.248 POLE Zornitza Stark Classified gene: POLE as Green List (high evidence)
Growth failure v0.248 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Growth failure v0.247 POLE Zornitza Stark Tag deep intronic tag was added to gene: POLE.
Growth failure v0.247 POLE Zornitza Stark gene: POLE was added
gene: POLE was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: POLE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLE were set to 30503519; 23230001; 25948378
Phenotypes for gene: POLE were set to FILS syndrome, MIM# 615139; IMAGE-I syndrome, MIM# 618336
Review for gene: POLE was set to GREEN
Added comment: Both the FILS and IMAGE-I phenotypes have short stature as a feature, although it is more severe in IMAGE-I. Note recurrent intronic variant, c.1686+32C-G (intron 15) in IMAGE-I, found in combination with multiple other variants.
Sources: Expert Review
Growth failure v0.246 PCNT Zornitza Stark Marked gene: PCNT as ready
Growth failure v0.246 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Growth failure v0.246 PCNT Zornitza Stark Phenotypes for gene: PCNT were changed from Seckel syndrome, MOPD type II - growth restrction, microcephaly, prominent nose, micrognathia, squeaky voice, insulin resistance, 210720; MOPDII to Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720; MONDO:0008872
Growth failure v0.245 PCNT Zornitza Stark Publications for gene: PCNT were set to 18157127; 18174396
Growth failure v0.244 PCNT Zornitza Stark Classified gene: PCNT as Green List (high evidence)
Growth failure v0.244 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Growth failure v0.243 PCNT Zornitza Stark reviewed gene: PCNT: Rating: GREEN; Mode of pathogenicity: None; Publications: 18174396, 12210304, 30922925, 33460028, 32557621, 32267100; Phenotypes: Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720, MONDO:0008872; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.243 LARP7 Zornitza Stark Marked gene: LARP7 as ready
Growth failure v0.243 LARP7 Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence).
Growth failure v0.243 LARP7 Zornitza Stark Classified gene: LARP7 as Green List (high evidence)
Growth failure v0.243 LARP7 Zornitza Stark Gene: larp7 has been classified as Green List (High Evidence).
Growth failure v0.242 LARP7 Zornitza Stark gene: LARP7 was added
gene: LARP7 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: LARP7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LARP7 were set to 22865833; 21937992; 30006060; 33569879
Phenotypes for gene: LARP7 were set to Alazami syndrome, MIM# 615071; Microcephalic primordial dwarfism, Alazami type MONDO:0014031
Review for gene: LARP7 was set to GREEN
Added comment: Alazami syndrome is an autosomal recessive disorder characterized by severe growth restriction present at birth, severely impaired intellectual development, and distinctive facial features. Five unrelated families reported.
Sources: Expert Review
Growth failure v0.241 FAM111A Zornitza Stark Marked gene: FAM111A as ready
Growth failure v0.241 FAM111A Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence).
Growth failure v0.241 FAM111A Zornitza Stark Classified gene: FAM111A as Green List (high evidence)
Growth failure v0.241 FAM111A Zornitza Stark Gene: fam111a has been classified as Green List (High Evidence).
Growth failure v0.240 FAM111A Zornitza Stark gene: FAM111A was added
gene: FAM111A was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: FAM111A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FAM111A were set to 32996714; 23684011
Phenotypes for gene: FAM111A were set to Kenny-Caffey syndrome, type 2, MIM@ 127000
Review for gene: FAM111A was set to GREEN
Added comment: Kenny-Caffey syndrome is characterized by severe proportionate short stature, cortical thickening and medullary stenosis of the tubular bones, delayed closure of the anterior fontanel, eye abnormalities including microphthalmia/nanophthalmos, and transient hypocalcemia.

Note monoallelic variants in this gene are also associated with gracile bone dysplasia, but this is generally perinatal lethal.
Sources: Expert Review
Growth failure v0.239 DNA2 Zornitza Stark Marked gene: DNA2 as ready
Growth failure v0.239 DNA2 Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence).
Growth failure v0.239 DNA2 Zornitza Stark Phenotypes for gene: DNA2 were changed from Seckel syndrome 8, OMIM:615807 to Seckel syndrome 8, MIM:615807
Growth failure v0.238 DNA2 Zornitza Stark Classified gene: DNA2 as Green List (high evidence)
Growth failure v0.238 DNA2 Zornitza Stark Gene: dna2 has been classified as Green List (High Evidence).
Growth failure v0.237 DNA2 Zornitza Stark reviewed gene: DNA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24389050, 31045292; Phenotypes: Seckel syndrome 8, MIM#615807; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8900 TRPS1 Zornitza Stark Marked gene: TRPS1 as ready
Mendeliome v0.8900 TRPS1 Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence).
Mendeliome v0.8900 TRPS1 Zornitza Stark Phenotypes for gene: TRPS1 were changed from to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351
Mendeliome v0.8899 TRPS1 Zornitza Stark Publications for gene: TRPS1 were set to
Mendeliome v0.8898 TRPS1 Zornitza Stark Mode of inheritance for gene: TRPS1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8897 TRPS1 Zornitza Stark reviewed gene: TRPS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11112658, 10615131; Phenotypes: Trichorhinophalangeal syndrome, type I, OMIM # 190350, Trichorhinophalangeal syndrome, type III, OMIM # 190351; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.237 TRPS1 Zornitza Stark Marked gene: TRPS1 as ready
Growth failure v0.237 TRPS1 Zornitza Stark Gene: trps1 has been classified as Green List (High Evidence).
Growth failure v0.237 TRPS1 Zornitza Stark Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131
Growth failure v0.236 PUF60 Zornitza Stark Marked gene: PUF60 as ready
Growth failure v0.236 PUF60 Zornitza Stark Gene: puf60 has been classified as Green List (High Evidence).
Growth failure v0.236 PUF60 Zornitza Stark Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4081 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400
Intellectual disability syndromic and non-syndromic v0.4080 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4079 FGD1 Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4078 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8897 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Mendeliome v0.8897 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Mendeliome v0.8897 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from to Aarskog-Scott syndrome, MIM # 305400; Mental retardation, X-linked syndromic 16, MIM# 305400
Mendeliome v0.8896 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Mendeliome v0.8895 FGD1 Zornitza Stark Mode of inheritance for gene: FGD1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8894 FGD1 Zornitza Stark reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, MIM # 305400, Mental retardation, X-linked syndromic 16, MIM# 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.235 FGD1 Zornitza Stark Marked gene: FGD1 as ready
Growth failure v0.235 FGD1 Zornitza Stark Gene: fgd1 has been classified as Green List (High Evidence).
Growth failure v0.235 FGD1 Zornitza Stark Phenotypes for gene: FGD1 were changed from Aarskog to Aarskog-Scott syndrome, MIM # 305400
Growth failure v0.234 FGD1 Zornitza Stark Publications for gene: FGD1 were set to
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia de Lange syndrome 4, MIM # 614701 to Cornelia de Lange syndrome 4, MIM # 614701
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4078 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701
Intellectual disability syndromic and non-syndromic v0.4077 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4076 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4075 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.33 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from to Cornelia de Lange syndrome 4, MIM # 614701
Hypertrichosis syndromes v0.32 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Hypertrichosis syndromes v0.31 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.30 RAD21 Zornitza Stark commented on gene: RAD21: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in RAD21 gene.

Deardorff et al. (2012) reported 6 patients with CdLS phenotype with heterozygous variants (4 microdeletions incl RAD21, and 2 missense variants), showing functional evidence for the missense variants.

Krab et al. (2020) reported the clinical and molecular data in 29 patients from 22 families with CDLS4 and RAD21 variants

Many other case reports.
Hypertrichosis syndromes v0.30 RAD21 Zornitza Stark reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, MIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.233 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Growth failure v0.233 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Growth failure v0.233 RAD21 Zornitza Stark Phenotypes for gene: RAD21 were changed from Cornelia De Lange to Cornelia de Lange syndrome 4, MIM # 614701
Growth failure v0.232 RAD21 Zornitza Stark Publications for gene: RAD21 were set to
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4075 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Intellectual disability syndromic and non-syndromic v0.4074 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Intellectual disability syndromic and non-syndromic v0.4073 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4072 BRD4 Zornitza Stark Classified gene: BRD4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4072 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4071 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v1.42 BRD4 Zornitza Stark Publications for gene: BRD4 were set to 29379197; 30302754
Microcephaly v1.41 BRD4 Zornitza Stark Classified gene: BRD4 as Green List (high evidence)
Microcephaly v1.41 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Microcephaly v1.40 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8894 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Mendeliome v0.8894 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Mendeliome v0.8894 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Mendeliome v0.8893 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Mendeliome v0.8892 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8891 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.30 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange syndrome
Hypertrichosis syndromes v0.29 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Hypertrichosis syndromes v0.28 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hypertrichosis syndromes v0.27 BRD4 Zornitza Stark reviewed gene: BRD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 29379197, 30302754, 11997514, 34035299; Phenotypes: Cornelia de Lange syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.231 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Growth failure v0.231 BRD4 Zornitza Stark Gene: brd4 has been classified as Green List (High Evidence).
Growth failure v0.231 BRD4 Zornitza Stark Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299
Growth failure v0.230 TRPS1 Chirag Patel Classified gene: TRPS1 as Green List (high evidence)
Growth failure v0.230 TRPS1 Chirag Patel Gene: trps1 has been classified as Green List (High Evidence).
Growth failure v0.229 TRPS1 Chirag Patel gene: TRPS1 was added
gene: TRPS1 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: TRPS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRPS1 were set to PubMed: 11112658, 10615131
Phenotypes for gene: TRPS1 were set to Trichorhinophalangeal syndrome, type I, OMIM # 190350; Trichorhinophalangeal syndrome, type III, OMIM # 190351
Review for gene: TRPS1 was set to GREEN
Added comment: Trichorhinophalangeal syndrome (TRPS) is characterised by sparse, slowly growing scalp hair, laterally sparse eyebrows, bulbous tip of the nose, protruding ears, long flat philtrum, thin upper vermillion border, cone-shaped epiphyses (middle phalanges), and hip malformations (coxa plana, coxa magna, or coxa vara, degenerative arthrosis). TRPS3 differs from TRPS1 by the presence of severe brachydactyly, due to short metacarpals, and severe short stature.

Momeni et al. (2000) identified 6 different nonsense mutations in the TRPS1 gene in 10 unrelated patients. Ludecke et al. (2001) found 35 different mutations in TRPS1 in 44 unrelated patients with TRPS I or TRPS III. The detection rate (86%) indicated that TRPS1 is the major locus for both type I and type III TRPS. They found no mutation in the parents of sporadic patients or in apparently healthy relatives of familial patients, indicating complete penetrance of TRPS1 mutations.
Sources: Literature
Growth failure v0.228 PUF60 Chirag Patel Classified gene: PUF60 as Green List (high evidence)
Growth failure v0.228 PUF60 Chirag Patel Gene: puf60 has been classified as Green List (High Evidence).
Growth failure v0.227 PUF60 Chirag Patel gene: PUF60 was added
gene: PUF60 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: PUF60 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PUF60 were set to PubMed: 19464398, 24140112, 28327570, 27804958
Phenotypes for gene: PUF60 were set to Verheij syndrome, OMIM # 615583
Review for gene: PUF60 was set to GREEN
Added comment: Verheij syndrome is characterised by growth retardation, delayed psychomotor development, dysmorphic facial features, skeletal/vertebral abnormalities, coloboma, renal defects, and cardiac defects. Over 25 patients reported in literature with deletions and SNVs involving PUF60.
Sources: Literature
Growth failure v0.226 FGD1 Chirag Patel Classified gene: FGD1 as Green List (high evidence)
Growth failure v0.226 FGD1 Chirag Patel Gene: fgd1 has been classified as Green List (High Evidence).
Growth failure v0.225 FGD1 Chirag Patel reviewed gene: FGD1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 7954831, 20082460; Phenotypes: Aarskog-Scott syndrome, OMIM # 305400; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.225 RAD21 Chirag Patel Classified gene: RAD21 as Green List (high evidence)
Growth failure v0.225 RAD21 Chirag Patel Gene: rad21 has been classified as Green List (High Evidence).
Growth failure v0.224 RAD21 Chirag Patel reviewed gene: RAD21: Rating: GREEN; Mode of pathogenicity: None; Publications: PubMed: 22633399, 32193685, 27882533, 30716475, 30125677, 24378232; Phenotypes: Cornelia de Lange syndrome 4, OMIM # 614701; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.224 BRD4 Chirag Patel Classified gene: BRD4 as Green List (high evidence)
Growth failure v0.224 BRD4 Chirag Patel Gene: brd4 has been classified as Green List (High Evidence).
Growth failure v0.223 BRD4 Chirag Patel gene: BRD4 was added
gene: BRD4 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: BRD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: BRD4 were set to PMID: 29379197, 30302754, 11997514, 34035299
Phenotypes for gene: BRD4 were set to Cornelia de Lange syndrome (no OMIM# yet)
Review for gene: BRD4 was set to GREEN
Added comment: Cornelia de Lange syndrome is a clinically heterogeneous developmental disorder characterized by malformations affecting multiple systems. Affected individuals have dysmorphic facial features, cleft palate, distal limb defects, growth retardation, and developmental delay. About 1% of patients have mutations in the BRD4 gene.

Olley et al. (2018) report 4 patients with CdLS phenotype with 4 different variants (1 deletion incl BRD4, 1 missense, and 2 frameshift). Alesi et al. (2019) reported a patient with 19p13.12p13.11 deletion including BRD4 with CdLS phenotype.

Olley et al (2021) provided further functional evidence for the previous missense variant, showing it reduces BRD4-occupancy at enhancers it does not affect transcription of the pluripotency network in mouse embryonic stem cells. Rather, it delays the cell cycle, increases DNA damage signalling, and perturbs regulation of DNA repair in mutant cells.

Houzelstein et al. (2002) showed that mice with heterozygous LOF mutations in Brd4 have marked early postnatal mortality, severe prenatal onset growth failure, abnormalities of the craniofacial skeleton and reduced body fat19; all features common in CdLS.
Sources: Literature
Cardiomyopathy_Paediatric v0.106 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from Cardiomyopathy, hypertrophic, MIM#613873 to Cardiomyopathy, hypertrophic, MIM#613873; Cardiomyopathy, dilated, 2E, MIM# 619492
Cardiomyopathy_Paediatric v0.105 JPH2 Zornitza Stark Publications for gene: JPH2 were set to 30681346; 17509612; 23973696; 26869393; 28393127; 30235249
Cardiomyopathy_Paediatric v0.104 JPH2 Zornitza Stark Mode of inheritance for gene: JPH2 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Cardiomyopathy_Paediatric v0.103 JPH2 Zornitza Stark changed review comment from: MODERATE evidence by ClinGen working group.

Via ClinGen: Associated with hypertrophic cardiomyopathy in 16 probands in 5 publications with some functional evidence in support (expression studies, in vitro assays, animal models).

Conflicting evidence for missense variants in particular: one of the variants p.Gly505Ser is present in >500 individuals in gnomad, including 7 homozygotes, and another novel missense variant was observed in an 86-year-old man, diagnosed with hypertrophic cardiomyopathy, in whom echocardiography and cardiac magnetic resonance imaging strongly suggested amyloidosis to be the underlying cause.; to: Association with HCM: MODERATE evidence by ClinGen working group.

Via ClinGen: Associated with hypertrophic cardiomyopathy in 16 probands in 5 publications with some functional evidence in support (expression studies, in vitro assays, animal models).

Conflicting evidence for missense variants in particular: one of the variants p.Gly505Ser is present in >500 individuals in gnomad, including 7 homozygotes, and another novel missense variant was observed in an 86-year-old man, diagnosed with hypertrophic cardiomyopathy, in whom echocardiography and cardiac magnetic resonance imaging strongly suggested amyloidosis to be the underlying cause.
Cardiomyopathy_Paediatric v0.103 JPH2 Zornitza Stark edited their review of gene: JPH2: Added comment: Association with DCM: Several families with DCM and variants in this gene, plus more severe bi-allelic disease reported, animal models. Onset in infancy reported.

MODERATE by ClinGen.; Changed publications: 30681346, 17509612, 23973696, 26869393, 28393127, 30235249, 29540472, 31227780, 29165669, 27471098, 30384889, 31227780, 10949023, 23715556; Changed phenotypes: Cardiomyopathy, hypertrophic, MIM#613873, Cardiomyopathy, dilated, 2E, MIM# 619492; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8891 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from Cardiomyopathy, hypertrophic, MIM#613873; dilated cardiomyopathy to Cardiomyopathy, hypertrophic, MIM#613873; Cardiomyopathy, dilated, 2E, MIM# 619492
Mendeliome v0.8890 JPH2 Zornitza Stark edited their review of gene: JPH2: Changed phenotypes: Cardiomyopathy, hypertrophic, MIM#613873, Cardiomyopathy, dilated, 2E, MIM# 619492
Dilated Cardiomyopathy v1.4 JPH2 Zornitza Stark Phenotypes for gene: JPH2 were changed from dilated cardiomyopathy to Cardiomyopathy, dilated, 2E, MIM# 619492
Dilated Cardiomyopathy v1.3 JPH2 Zornitza Stark edited their review of gene: JPH2: Changed phenotypes: Cardiomyopathy, dilated, 2E, MIM# 619492
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Congenital Heart Defect v0.127 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.126 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Growth failure v0.222 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Growth failure v0.222 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Growth failure v0.222 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Growth failure v0.222 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Growth failure v0.221 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Growth failure in early childhood. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Mendeliome v0.8890 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Mendeliome v0.8890 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Mendeliome v0.8890 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Mendeliome v0.8890 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Mendeliome v0.8889 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Marked gene: ZNF699 as ready
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Classified gene: ZNF699 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4071 ZNF699 Zornitza Stark Gene: znf699 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4070 ZNF699 Zornitza Stark gene: ZNF699 was added
gene: ZNF699 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ZNF699 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZNF699 were set to 33875846
Phenotypes for gene: ZNF699 were set to DEGCAGS syndrome, MIM# 619488
Review for gene: ZNF699 was set to GREEN
Added comment: DEGCAGS syndrome is a neurodevelopmental disorder characterized by global developmental delay, coarse and dysmorphic facial features, and poor growth and feeding apparent from infancy. Affected individuals have variable systemic manifestations often with significant structural defects of the cardiovascular, genitourinary, gastrointestinal, and/or skeletal systems. Additional features may include sensorineural hearing loss, hypotonia, anaemia or pancytopaenia, and immunodeficiency with recurrent infections.

12 unrelated families reported, 5 different homozygous frameshift variants.
Sources: Literature
Combined Immunodeficiency v0.365 POLD2 Zornitza Stark Marked gene: POLD2 as ready
Combined Immunodeficiency v0.365 POLD2 Zornitza Stark Gene: pold2 has been classified as Red List (Low Evidence).
Combined Immunodeficiency v0.365 PARN Zornitza Stark Marked gene: PARN as ready
Combined Immunodeficiency v0.365 PARN Zornitza Stark Gene: parn has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.365 PARN Zornitza Stark Phenotypes for gene: PARN were changed from to Dyskeratosis congenita, autosomal recessive 6, MIM# 616353
Combined Immunodeficiency v0.364 PARN Zornitza Stark Publications for gene: PARN were set to
Combined Immunodeficiency v0.363 PARN Zornitza Stark Mode of inheritance for gene: PARN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.362 PARN Zornitza Stark edited their review of gene: PARN: Changed publications: 25893599, 26342108, 25848748, 32452087
Combined Immunodeficiency v0.362 PARN Zornitza Stark reviewed gene: PARN: Rating: GREEN; Mode of pathogenicity: None; Publications: 25893599, 26342108, 25848748; Phenotypes: Dyskeratosis congenita, autosomal recessive 6, MIM# 616353; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.362 NFE2L2 Zornitza Stark Marked gene: NFE2L2 as ready
Combined Immunodeficiency v0.362 NFE2L2 Zornitza Stark Gene: nfe2l2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 MYSM1 Zornitza Stark Marked gene: MYSM1 as ready
Combined Immunodeficiency v0.362 MYSM1 Zornitza Stark Gene: mysm1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 LIG1 Zornitza Stark Marked gene: LIG1 as ready
Combined Immunodeficiency v0.362 LIG1 Zornitza Stark Gene: lig1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 KDM6A Zornitza Stark Marked gene: KDM6A as ready
Combined Immunodeficiency v0.362 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 FOXN1 Zornitza Stark Marked gene: FOXN1 as ready
Combined Immunodeficiency v0.362 FOXN1 Zornitza Stark Gene: foxn1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.362 FOXN1 Zornitza Stark Phenotypes for gene: FOXN1 were changed from to T-cell immunodeficiency, congenital alopecia, and nail dystrophy, autosomal recessive MIM# 601705; T-cell lymphopenia, infantile, with or without nail dystrophy, autosomal dominan, MIM#t 618806
Combined Immunodeficiency v0.361 MAGT1 Zornitza Stark Marked gene: MAGT1 as ready
Combined Immunodeficiency v0.361 MAGT1 Zornitza Stark Gene: magt1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.361 MAGT1 Zornitza Stark Phenotypes for gene: MAGT1 were changed from to Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia MIM# 300853; XMEN; Low CD4; inverted CD4/CD8 ratio; reduced MAIT cells; poor proliferation to CD3; decreased memory B cells; progressive hypogammaglobulinaemia; reduced NK cell; EBV infection; lymphoma; viral infections; respiratory and GI infections; Glycosylation defects
Combined Immunodeficiency v0.360 MAGT1 Zornitza Stark Publications for gene: MAGT1 were set to
Combined Immunodeficiency v0.359 MAGT1 Zornitza Stark Mode of inheritance for gene: MAGT1 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Combined Immunodeficiency v0.358 IKBKG Zornitza Stark Marked gene: IKBKG as ready
Combined Immunodeficiency v0.358 IKBKG Zornitza Stark Gene: ikbkg has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.358 IKBKG Zornitza Stark Phenotypes for gene: IKBKG were changed from to Ectodermal dysplasia and immunodeficiency 1 MIM# 300291; Immunodeficiency 33 MIM# 300636
Combined Immunodeficiency v0.357 IKBKG Zornitza Stark Publications for gene: IKBKG were set to
Combined Immunodeficiency v0.356 IKBKG Zornitza Stark Mode of inheritance for gene: IKBKG was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.4069 NIPBL Zornitza Stark Marked gene: NIPBL as ready
Intellectual disability syndromic and non-syndromic v0.4069 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4069 NIPBL Zornitza Stark Phenotypes for gene: NIPBL were changed from to Cornelia de Lange syndrome 1, MIM # 122470
Intellectual disability syndromic and non-syndromic v0.4068 NIPBL Zornitza Stark Publications for gene: NIPBL were set to
Intellectual disability syndromic and non-syndromic v0.4067 NIPBL Zornitza Stark Mode of inheritance for gene: NIPBL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.4066 NIPBL Zornitza Stark reviewed gene: NIPBL: Rating: GREEN; Mode of pathogenicity: None; Publications: 16604071, 20358602, 16236812, 17661813; Phenotypes: Cornelia de Lange syndrome 1, MIM # 122470; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.220 NIPBL Zornitza Stark Marked gene: NIPBL as ready
Growth failure v0.220 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Growth failure v0.220 NIPBL Zornitza Stark Phenotypes for gene: NIPBL were changed from Cornelia De Lange to Cornelia de Lange syndrome 1, MIM # 122470
Growth failure v0.219 NIPBL Zornitza Stark Publications for gene: NIPBL were set to
Mendeliome v0.8888 SMC1A Zornitza Stark Phenotypes for gene: SMC1A were changed from Cornelia de Lange syndrome 2, MIM# 300590 to Cornelia de Lange syndrome 2, MIM# 300590; Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044
Mendeliome v0.8887 SMC1A Zornitza Stark Publications for gene: SMC1A were set to 17273969; 22106055; 19701948; 26752331; 28166369
Mendeliome v0.8886 SMC1A Zornitza Stark reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 29023665, 31409060, 31334757, 28166369; Phenotypes: Cornelia de Lange syndrome 2, MIM# 300590, Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.218 SMC1A Zornitza Stark Marked gene: SMC1A as ready
Growth failure v0.218 SMC1A Zornitza Stark Gene: smc1a has been classified as Green List (High Evidence).
Growth failure v0.218 SMC1A Zornitza Stark Phenotypes for gene: SMC1A were changed from Developmental and epileptic encephalopathy, 85, with or without midline brain defects, MONDO:0026771; Cornelia de Lange syndrome 2, MONDO:0010370; Cornelia de Lange syndrome 2, OMIM:300590; Developmental and epileptic encephalopathy 85, with or without midline brain defects, OMIM:301044 to Cornelia de Lange syndrome 2, OMIM # 300590, MONDO:0010370
Growth failure v0.217 SMC1A Zornitza Stark Publications for gene: SMC1A were set to
Combined Immunodeficiency v0.355 MAGT1 Danielle Ariti reviewed gene: MAGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24550228, 31036665, 32451662; Phenotypes: Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia MIM# 300853, XMEN, Low CD4, inverted CD4/CD8 ratio, reduced MAIT cells, poor proliferation to CD3, decreased memory B cells, progressive hypogammaglobulinaemia, reduced NK cell, EBV infection, lymphoma, viral infections, respiratory and GI infections, Glycosylation defects; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Combined Immunodeficiency v0.355 IKBKG Danielle Ariti reviewed gene: IKBKG: Rating: GREEN; Mode of pathogenicity: None; Publications: 11242109, 11047757, 29855039, 15833888, 28993958, 15577852; Phenotypes: Ectodermal dysplasia and immunodeficiency 1 MIM# 300291, Immunodeficiency 33 MIM# 300636; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.216 NIPBL Chirag Patel Classified gene: NIPBL as Green List (high evidence)
Growth failure v0.216 NIPBL Chirag Patel Gene: nipbl has been classified as Green List (High Evidence).
Growth failure v0.215 NIPBL Chirag Patel reviewed gene: NIPBL: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 16604071, 20358602, 16236812, 17661813; Phenotypes: Cornelia de Lange syndrome 1, OMIM # 122470; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.215 SMC1A Chirag Patel Classified gene: SMC1A as Green List (high evidence)
Growth failure v0.215 SMC1A Chirag Patel Gene: smc1a has been classified as Green List (High Evidence).
Growth failure v0.214 SMC1A Chirag Patel reviewed gene: SMC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 16604071, 20358602, 19842212, 24124034; Phenotypes: Cornelia de Lange syndrome 2, OMIM # 300590; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Combined Immunodeficiency v0.355 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to 15731174; 19953608; 15699179 12055248; 34220820
Combined Immunodeficiency v0.354 DCLRE1C Zornitza Stark Marked gene: DCLRE1C as ready
Combined Immunodeficiency v0.354 DCLRE1C Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.354 DCLRE1C Zornitza Stark Phenotypes for gene: DCLRE1C were changed from to Severe combined immunodeficiency, Athabascan type MIM# 602450; Omenn syndrome MIM# 603554
Combined Immunodeficiency v0.353 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to
Combined Immunodeficiency v0.352 DCLRE1C Zornitza Stark Mode of inheritance for gene: DCLRE1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8886 DCLRE1B Zornitza Stark Marked gene: DCLRE1B as ready
Mendeliome v0.8886 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Mendeliome v0.8886 DCLRE1B Zornitza Stark Phenotypes for gene: DCLRE1B were changed from to Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome
Mendeliome v0.8885 DCLRE1B Zornitza Stark Publications for gene: DCLRE1B were set to
Mendeliome v0.8884 DCLRE1B Zornitza Stark Classified gene: DCLRE1B as Red List (low evidence)
Mendeliome v0.8884 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Mendeliome v0.8883 DCLRE1B Zornitza Stark reviewed gene: DCLRE1B: Rating: RED; Mode of pathogenicity: None; Publications: 20479256, 21647296; Phenotypes: Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome; Mode of inheritance: Unknown
Combined Immunodeficiency v0.351 DCLRE1B Zornitza Stark Marked gene: DCLRE1B as ready
Combined Immunodeficiency v0.351 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Combined Immunodeficiency v0.351 DCLRE1B Zornitza Stark Phenotypes for gene: DCLRE1B were changed from to Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome
Combined Immunodeficiency v0.350 DCLRE1B Zornitza Stark Publications for gene: DCLRE1B were set to
Combined Immunodeficiency v0.349 DCLRE1B Zornitza Stark Classified gene: DCLRE1B as Red List (low evidence)
Combined Immunodeficiency v0.349 DCLRE1B Zornitza Stark Gene: dclre1b has been classified as Red List (Low Evidence).
Combined Immunodeficiency v0.348 ATM Zornitza Stark Marked gene: ATM as ready
Combined Immunodeficiency v0.348 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.348 ATM Zornitza Stark Phenotypes for gene: ATM were changed from to Ataxia-telangiectasia MIM# 208900; Progressive T cell decrease, poor T-cell proliferation to mitogens; low IgA, IgE and IgG; increased IgM monomers; antibodies variably decreased; Ataxia; telangiectasia especially of sclerae; pulmonary infections; lymphoreticular and other malignancies; increased alpha fetoprotein; increased radiosensitivity, chromosomal instability and chromosomal translocations
Combined Immunodeficiency v0.347 ATM Zornitza Stark Publications for gene: ATM were set to
Combined Immunodeficiency v0.346 ATM Zornitza Stark Mode of inheritance for gene: ATM was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8883 TOR1AIP1 Zornitza Stark Phenotypes for gene: TOR1AIP1 were changed from Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072; Progeroid appearance; Cataracts; Microcephaly; Deafness; Contractures to Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072; Congenital myasthenic syndrome
Mendeliome v0.8882 TOR1AIP1 Zornitza Stark Publications for gene: TOR1AIP1 were set to 24856141; 31299614; 30723199; 27342937; 32055997
Mendeliome v0.8881 TOR1AIP1 Zornitza Stark edited their review of gene: TOR1AIP1: Added comment: Gene is associated with multiple muscle phenotypes as already noted. Single family myasthenic syndrome and supportive mouse model data.; Changed rating: GREEN; Changed publications: 33215087; Changed phenotypes: Congenital myasthenic syndrome; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark changed review comment from: Single family plus mouse model.; to: Single family plus mouse model. Variants in this gene also cause a range of other muscle disorders.
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark Marked gene: TOR1AIP1 as ready
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark Gene: tor1aip1 has been classified as Amber List (Moderate Evidence).
Congenital Myasthenia v1.5 TOR1AIP1 Zornitza Stark Phenotypes for gene: TOR1AIP1 were changed from to Congenital myasthenic syndrome
Congenital Myasthenia v1.4 TOR1AIP1 Zornitza Stark Classified gene: TOR1AIP1 as Amber List (moderate evidence)
Congenital Myasthenia v1.4 TOR1AIP1 Zornitza Stark Gene: tor1aip1 has been classified as Amber List (Moderate Evidence).
Congenital Myasthenia v1.3 TOR1AIP1 Zornitza Stark reviewed gene: TOR1AIP1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Progressive Neurological Conditions v7.82 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Congenital Disorders of Glycosylation; Hereditary Spastic Paraplegia - paediatric; Brain Calcification; Hereditary Neuropathy_CMT - isolated; Miscellaneous Metabolic Disorders; Dystonia - isolated/combined; Hereditary Spastic Paraplegia - adult onset; Glycogen Storage Diseases; Neurotransmitter Defects; Fatty Acid Oxidation Defects; Brain Channelopathies; Lysosomal Storage Disorder; Genetic Epilepsy; Mitochondrial disease; Ataxia - paediatric; Leukodystrophy - paediatric; Dystonia - complex; Ataxia - adult onset; Early-onset Dementia; Motor Neurone Disease; Hereditary Neuropathy - complex; Myopathy - adult onset; Early-onset Parkinson disease; Leukodystrophy - adult onset; Rhabdomyolysis; Limb Girdle Muscular Dystrophy; Pain syndromes; Peroxisomal Disorders; Iron metabolism disorders; Cerebral vascular malformations; Neuroferritinopathies
Congenital Myasthenia v1.3 TOR1AIP1 Gina Ravenscroft reviewed gene: TOR1AIP1: Rating: ; Mode of pathogenicity: None; Publications: PMID: 33215087; Phenotypes: Congenital myasthenic syndrome; Mode of inheritance: None
Progressive Neurological Conditions v7.81 Bryony Thompson Changed child panels to: Myopathy - paediatric onset; Hereditary Spastic Paraplegia - paediatric; Brain Calcification; Hereditary Neuropathy_CMT - isolated; Miscellaneous Metabolic Disorders; Dystonia - isolated/combined; Hereditary Spastic Paraplegia - adult onset; Brain Channelopathies; Genetic Epilepsy; Mitochondrial disease; Ataxia - paediatric; Leukodystrophy - paediatric; Dystonia - complex; Ataxia - adult onset; Early-onset Dementia; Motor Neurone Disease; Hereditary Neuropathy - complex; Early-onset Parkinson disease; Myopathy - adult onset; Leukodystrophy - adult onset; Limb Girdle Muscular Dystrophy; Pain syndromes; Cerebral vascular malformations
Congenital Myasthenia v1.3 TOR1AIP1 Gina Ravenscroft gene: TOR1AIP1 was added
gene: TOR1AIP1 was added to Congenital Myasthenia. Sources: Expert Review
Mode of inheritance for gene: TOR1AIP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOR1AIP1 were set to PMID: 34164833
Penetrance for gene: TOR1AIP1 were set to Complete
Combined Immunodeficiency v0.345 DCLRE1C Danielle Ariti reviewed gene: DCLRE1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 15731174, 19953608, 15699179 12055248, 34220820; Phenotypes: Severe combined immunodeficiency, Athabascan type MIM# 602450, Omenn syndrome MIM# 603554; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.345 DCLRE1C Danielle Ariti Deleted their review
Combined Immunodeficiency v0.345 DCLRE1C Danielle Ariti reviewed gene: DCLRE1C: Rating: AMBER; Mode of pathogenicity: None; Publications: 15731174, 19953608; Phenotypes: Omenn syndrome MIM# 603554, Absent B cells, normal-elevated T-cells, normal-elevated NK cells, severe combined immunodeficiency (SCID), erythrodermia, hepatosplenomegaly, lymphadenopathy, alopecia, radiosensitivity, elevated IgE, elevated eosinophilia, dermatitis, failure to thrive, recurrent respiratory infections; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.345 DCLRE1B Danielle Ariti reviewed gene: DCLRE1B: Rating: RED; Mode of pathogenicity: None; Publications: 20479256, 21647296; Phenotypes: Dyskeratosis congenita and Hoyeraal-Hreidarsson (HH) syndrome MIM# 616353; Mode of inheritance: Unknown
Combined Immunodeficiency v0.345 ATM Danielle Ariti reviewed gene: ATM: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301790, 27884168, 8689683; Phenotypes: Ataxia-telangiectasia MIM# 208900, Progressive T cell decrease, poor T-cell proliferation to mitogens, low IgA, IgE and IgG, increased IgM monomers, antibodies variably decreased, Ataxia, telangiectasia especially of sclerae, pulmonary infections, lymphoreticular and other malignancies, increased alpha fetoprotein, increased radiosensitivity, chromosomal instability and chromosomal translocations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8881 PAPPA2 Zornitza Stark Marked gene: PAPPA2 as ready
Mendeliome v0.8881 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Mendeliome v0.8881 PAPPA2 Zornitza Stark Classified gene: PAPPA2 as Green List (high evidence)
Mendeliome v0.8881 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Progressive Neurological Conditions v7.80 Bryony Thompson Panel status changed from internal to public
Mendeliome v0.8880 PAPPA2 Zornitza Stark gene: PAPPA2 was added
gene: PAPPA2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: PAPPA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PAPPA2 were set to 26902202; 34272725; 32739295
Phenotypes for gene: PAPPA2 were set to Short stature, Dauber-Argente type, MIM#619489
Review for gene: PAPPA2 was set to GREEN
Added comment: Short stature of the Dauber-Argente type (SSDA) is characterized by progressive postnatal growth failure, moderate microcephaly, thin long bones, and mildly decreased bone density. Patients have elevated circulating levels of total IGF1 due to impaired proteolysis of IGFBP3 and IGFBP5, resulting in reduced free IGF1.

7 individuals from 3 unrelated families reported, mouse model.
Sources: Literature
Growth failure v0.214 PAPPA2 Zornitza Stark Marked gene: PAPPA2 as ready
Growth failure v0.214 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Growth failure v0.214 PAPPA2 Zornitza Stark Phenotypes for gene: PAPPA2 were changed from Proportionate Short Stature, High Circulating IGF-I, IGFBP-3, and ALS, Mild Microcephaly, thin Long Bones and Decreased Bone Mineral Density to Short stature, Dauber-Argente type, MIM#619489
Growth failure v0.213 PAPPA2 Zornitza Stark Publications for gene: PAPPA2 were set to 26902202
Growth failure v0.212 PAPPA2 Zornitza Stark Classified gene: PAPPA2 as Green List (high evidence)
Growth failure v0.212 PAPPA2 Zornitza Stark Gene: pappa2 has been classified as Green List (High Evidence).
Growth failure v0.211 PAPPA2 Zornitza Stark reviewed gene: PAPPA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26902202, 34272725, 32739295; Phenotypes: Short stature, Dauber-Argente type, MIM#619489; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.211 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Growth failure v0.211 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Growth failure v0.211 CRIPT Zornitza Stark Phenotypes for gene: CRIPT were changed from frontal bossing, high forehead, sparse hair and eyebrows, telecanthus, mild proptosis (staring look), upturned nostrils, and hypoplastic terminal phalanges with brachydactyly to Short stature with microcephaly and distinctive facies (MIM#615789)
Growth failure v0.210 CRIPT Zornitza Stark Publications for gene: CRIPT were set to PMC3912419
Growth failure v0.209 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Growth failure v0.209 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Growth failure v0.208 CRIPT Zornitza Stark reviewed gene: CRIPT: Rating: AMBER; Mode of pathogenicity: None; Publications: 24389050, 27250922; Phenotypes: Short stature with microcephaly and distinctive facies (MIM#615789); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.208 CEP152 Zornitza Stark Marked gene: CEP152 as ready
Growth failure v0.208 CEP152 Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence).
Growth failure v0.208 CEP152 Zornitza Stark Classified gene: CEP152 as Green List (high evidence)
Growth failure v0.208 CEP152 Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence).
Growth failure v0.207 CEP152 Zornitza Stark gene: CEP152 was added
gene: CEP152 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: CEP152 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CEP152 were set to 21131973
Phenotypes for gene: CEP152 were set to Seckel syndrome 5, MIM# 613823
Review for gene: CEP152 was set to GREEN
Added comment: At least three unrelated families reported. Note bi-allelic variants in this gene also cause isolated microcephaly.
Sources: Expert Review
Mendeliome v0.8879 ATR Zornitza Stark Marked gene: ATR as ready
Mendeliome v0.8879 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Mendeliome v0.8879 ATR Zornitza Stark Phenotypes for gene: ATR were changed from to Seckel syndrome 1, MIM# 210600
Mendeliome v0.8878 ATR Zornitza Stark Publications for gene: ATR were set to
Mendeliome v0.8877 ATR Zornitza Stark Mode of inheritance for gene: ATR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.206 ATR Zornitza Stark Marked gene: ATR as ready
Growth failure v0.206 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Mendeliome v0.8876 ATR Zornitza Stark reviewed gene: ATR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12640452, 19620979, 30199583, 23111928; Phenotypes: Seckel syndrome 1, MIM# 210600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.206 ATR Zornitza Stark Classified gene: ATR as Green List (high evidence)
Growth failure v0.206 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Growth failure v0.205 ATR Zornitza Stark gene: ATR was added
gene: ATR was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: ATR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATR were set to 12640452; 19620979; 30199583; 23111928
Phenotypes for gene: ATR were set to Seckel syndrome 1, MIM# 210600
Review for gene: ATR was set to GREEN
Added comment: At least three unrelated families reported.
Sources: Expert Review
Growth failure v0.204 KDM6A Zornitza Stark Marked gene: KDM6A as ready
Growth failure v0.204 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Growth failure v0.204 KDM6A Zornitza Stark Phenotypes for gene: KDM6A were changed from Kabuki to Kabuki syndrome 2, MIM# 300867
Growth failure v0.203 KDM6A Zornitza Stark Publications for gene: KDM6A were set to
Growth failure v0.202 KDM6A Zornitza Stark Classified gene: KDM6A as Green List (high evidence)
Growth failure v0.202 KDM6A Zornitza Stark Gene: kdm6a has been classified as Green List (High Evidence).
Growth failure v0.201 KDM6A Zornitza Stark reviewed gene: KDM6A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22197486, 23076834, 24633898, 25972376; Phenotypes: Kabuki syndrome 2, MIM# 300867; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.201 MAPK1 Zornitza Stark Marked gene: MAPK1 as ready
Growth failure v0.201 MAPK1 Zornitza Stark Gene: mapk1 has been classified as Green List (High Evidence).
Growth failure v0.201 MAPK1 Zornitza Stark Classified gene: MAPK1 as Green List (high evidence)
Growth failure v0.201 MAPK1 Zornitza Stark Gene: mapk1 has been classified as Green List (High Evidence).
Growth failure v0.200 MAPK1 Zornitza Stark gene: MAPK1 was added
gene: MAPK1 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: MAPK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAPK1 were set to 32721402
Phenotypes for gene: MAPK1 were set to Noonan syndrome 13, MIM#619087
Mode of pathogenicity for gene: MAPK1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: MAPK1 was set to GREEN
Added comment: Motta et al (2020 - PMID: 32721402) report on 7 unrelated individuals harboring de novo missense MAPK1 pathogenic variants.

The phenotype corresponded to a neurodevelopmental disorder and - as the authors comment - consistently included DD, ID , behavioral problems. Postnatal growth delay was observed in approximately half. Hypertelorism, ptosis, downslant of palpebral fissures, wide nasal bridge as low-set/posteriorly rotated ears were among the facial features observed (each in 3 or more subjects within this cohort). Together with short/webbed neck and abnormalities of skin (lentigines / CAL spots) and growth delay these led to clinical suspicion of Noonan s. or disorder of the same pathway in some. Congenital heart defects (ASD, mitral valve insufficiency, though not cardiomyopathy) occurred in 4/7. Bleeding diathesis and lymphedema were reported only once.

MAPK1 encodes the mitogen-activated protein kinase 1 (also known as ERK2) a serine/threonine kinase of the RAS-RAF-MEK-(MAPK/)ERK pathway.

MAPK1 de novo variants were identified in all individuals following trio exome sequencing (and extensive previous genetic investigations which were non-diagnostic).

The distribution of variants, as well as in silico/vitro/vivo studies suggest a GoF effect (boosted signal through the MAPK cascade. MAPK signaling also upregulated in Noonan syndrome).
Sources: Expert Review
Growth failure v0.199 RRAS2 Zornitza Stark Marked gene: RRAS2 as ready
Growth failure v0.199 RRAS2 Zornitza Stark Gene: rras2 has been classified as Green List (High Evidence).
Growth failure v0.199 RRAS2 Zornitza Stark Classified gene: RRAS2 as Green List (high evidence)
Growth failure v0.199 RRAS2 Zornitza Stark Gene: rras2 has been classified as Green List (High Evidence).
Growth failure v0.198 RRAS2 Zornitza Stark gene: RRAS2 was added
gene: RRAS2 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: RRAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RRAS2 were set to 31130282
Phenotypes for gene: RRAS2 were set to Noonan syndrome 12, MIM #618624
Mode of pathogenicity for gene: RRAS2 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: RRAS2 was set to GREEN
Added comment: Six unrelated families reported, GoF variants.
Sources: Expert Review
Mendeliome v0.8876 SHOX Zornitza Stark Marked gene: SHOX as ready
Mendeliome v0.8876 SHOX Zornitza Stark Gene: shox has been classified as Green List (High Evidence).
Mendeliome v0.8876 SHOX Zornitza Stark Phenotypes for gene: SHOX were changed from to Langer mesomelic dysplasia, MIM# 249700; Leri-Weill dyschondrosteosis, MIM# 127300
Mendeliome v0.8875 SHOX Zornitza Stark Mode of inheritance for gene: SHOX was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8874 SHOX Zornitza Stark Tag SV/CNV tag was added to gene: SHOX.
Mendeliome v0.8874 SHOX Zornitza Stark reviewed gene: SHOX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Langer mesomelic dysplasia, MIM# 249700, Leri-Weill dyschondrosteosis, MIM# 127300; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.197 SHOX Zornitza Stark Marked gene: SHOX as ready
Growth failure v0.197 SHOX Zornitza Stark Gene: shox has been classified as Green List (High Evidence).
Growth failure v0.197 SHOX Zornitza Stark changed review comment from: Deletions common.; to: Deletions common. Pseudoautosomal region of X chromosome.
Growth failure v0.197 SHOX Zornitza Stark edited their review of gene: SHOX: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.197 SHOX Zornitza Stark Phenotypes for gene: SHOX were changed from to Langer mesomelic dysplasia, MIM# 249700; Leri-Weill dyschondrosteosis, MIM# 127300
Growth failure v0.196 SHOX Zornitza Stark Classified gene: SHOX as Green List (high evidence)
Growth failure v0.196 SHOX Zornitza Stark Gene: shox has been classified as Green List (High Evidence).
Growth failure v0.195 SHOX Zornitza Stark Tag SV/CNV tag was added to gene: SHOX.
Growth failure v0.195 SHOX Zornitza Stark reviewed gene: SHOX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Langer mesomelic dysplasia, MIM# 249700, Leri-Weill dyschondrosteosis, MIM# 127300; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.195 CENPJ Zornitza Stark Marked gene: CENPJ as ready
Growth failure v0.195 CENPJ Zornitza Stark Gene: cenpj has been classified as Red List (Low Evidence).
Growth failure v0.195 CENPJ Zornitza Stark Phenotypes for gene: CENPJ were changed from seckel syndrome to Seckel syndrome 4, MIM# 613676
Growth failure v0.194 CENPJ Zornitza Stark Publications for gene: CENPJ were set to 20522431
Growth failure v0.193 CENPJ Zornitza Stark changed review comment from: Single family reported with Seckel phenotype and supportive mouse model. However, bi-allelic variants in this gene are typically associated with microcephaly.; to: Single family reported with Seckel phenotype and supportive mouse model. However, bi-allelic variants in this gene are typically associated with microcephaly without short stature.
Growth failure v0.193 CENPJ Zornitza Stark reviewed gene: CENPJ: Rating: RED; Mode of pathogenicity: None; Publications: 20522431, 23166506; Phenotypes: Seckel syndrome 4, MIM# 613676; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8874 ORC4 Zornitza Stark Marked gene: ORC4 as ready
Mendeliome v0.8874 ORC4 Zornitza Stark Gene: orc4 has been classified as Green List (High Evidence).
Mendeliome v0.8874 ORC4 Zornitza Stark Phenotypes for gene: ORC4 were changed from to Meier-Gorlin syndrome 2, MIM# 613800
Mendeliome v0.8873 ORC4 Zornitza Stark Publications for gene: ORC4 were set to
Mendeliome v0.8872 ORC4 Zornitza Stark Mode of inheritance for gene: ORC4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8871 ORC4 Zornitza Stark reviewed gene: ORC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 21358631, 23023959, 22333897; Phenotypes: Meier-Gorlin syndrome 2, MIM# 613800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.193 ORC4 Zornitza Stark Marked gene: ORC4 as ready
Growth failure v0.193 ORC4 Zornitza Stark Gene: orc4 has been classified as Green List (High Evidence).
Growth failure v0.193 ORC4 Zornitza Stark Phenotypes for gene: ORC4 were changed from Meier-Gorlin syndrome 2, 613800; micrognathia, patellar aplasia/hypoplasia, microtia, mammary hypoplasia; Meier-Gorlin to Meier-Gorlin syndrome 2, MIM# 613800
Growth failure v0.192 ORC4 Zornitza Stark Publications for gene: ORC4 were set to 21358632
Growth failure v0.191 ORC4 Zornitza Stark Classified gene: ORC4 as Green List (high evidence)
Growth failure v0.191 ORC4 Zornitza Stark Gene: orc4 has been classified as Green List (High Evidence).
Growth failure v0.190 ORC4 Zornitza Stark reviewed gene: ORC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 21358631, 23023959, 22333897; Phenotypes: Meier-Gorlin syndrome 2, MIM# 613800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8871 ORC1 Zornitza Stark Marked gene: ORC1 as ready
Mendeliome v0.8871 ORC1 Zornitza Stark Gene: orc1 has been classified as Green List (High Evidence).
Mendeliome v0.8871 ORC1 Zornitza Stark Phenotypes for gene: ORC1 were changed from to Meier-Gorlin syndrome 1, MIM# 224690; MONDO:0009143
Mendeliome v0.8870 ORC1 Zornitza Stark Publications for gene: ORC1 were set to
Mendeliome v0.8869 ORC1 Zornitza Stark Mode of inheritance for gene: ORC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8868 ORC1 Zornitza Stark reviewed gene: ORC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358633, 21358632, 21358631, 23023959; Phenotypes: Meier-Gorlin syndrome 1, MIM# 224690, MONDO:0009143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.190 ORC1 Zornitza Stark Marked gene: ORC1 as ready
Growth failure v0.190 ORC1 Zornitza Stark Gene: orc1 has been classified as Green List (High Evidence).
Growth failure v0.190 ORC1 Zornitza Stark Phenotypes for gene: ORC1 were changed from Meier-Gorlin syndrome 1, 224690; microtia, beaked nose, patellar aplasia/hypoplasia, mammary hypoplasia, micrognathia; Meier-Gorlin to Meier-Gorlin syndrome 1, MIM# 224690; MONDO:0009143
Growth failure v0.189 ORC1 Zornitza Stark Publications for gene: ORC1 were set to 21358632
Growth failure v0.188 ORC1 Zornitza Stark Classified gene: ORC1 as Green List (high evidence)
Growth failure v0.188 ORC1 Zornitza Stark Gene: orc1 has been classified as Green List (High Evidence).
Growth failure v0.187 ORC1 Zornitza Stark reviewed gene: ORC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358633, 21358632, 21358631, 23023959; Phenotypes: Meier-Gorlin syndrome 1, MIM# 224690, MONDO:0009143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8868 ORC6 Zornitza Stark Marked gene: ORC6 as ready
Mendeliome v0.8868 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Mendeliome v0.8868 ORC6 Zornitza Stark Phenotypes for gene: ORC6 were changed from to Meier-Gorlin syndrome 3, MIM# 613803
Mendeliome v0.8867 ORC6 Zornitza Stark Publications for gene: ORC6 were set to
Mendeliome v0.8866 ORC6 Zornitza Stark Mode of inheritance for gene: ORC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8865 ORC6 Zornitza Stark reviewed gene: ORC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 22333897, 25691413, 26139588; Phenotypes: Meier-Gorlin syndrome 3, MIM# 613803; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.187 ORC6 Zornitza Stark Marked gene: ORC6 as ready
Growth failure v0.187 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Growth failure v0.187 ORC6 Zornitza Stark Phenotypes for gene: ORC6 were changed from Meier-Gorlin; micrognathia, patellar aplasia/hypoplasia, microtia, mammary hypoplasia; Meier-Gorlin syndrome 3, 613803 to Meier-Gorlin syndrome 3, MIM# 613803
Growth failure v0.186 ORC6 Zornitza Stark Publications for gene: ORC6 were set to 21358632
Growth failure v0.185 ORC6 Zornitza Stark Classified gene: ORC6 as Green List (high evidence)
Growth failure v0.185 ORC6 Zornitza Stark Gene: orc6 has been classified as Green List (High Evidence).
Growth failure v0.184 ORC6 Zornitza Stark reviewed gene: ORC6: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 22333897, 25691413, 26139588; Phenotypes: Meier-Gorlin syndrome 3, MIM# 613803; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.184 IGF1R Zornitza Stark Marked gene: IGF1R as ready
Growth failure v0.184 IGF1R Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence).
Growth failure v0.184 IGF1R Zornitza Stark Phenotypes for gene: IGF1R were changed from 15q-Del; Insulin likegrowthfactorI,resistanceto,270450; Insulin-Like Growth Factor I Resistance to Insulin-like growth factor I, resistance to, MIM # 270450
Growth failure v0.183 IGF1R Zornitza Stark Publications for gene: IGF1R were set to
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4066 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Intellectual disability syndromic and non-syndromic v0.4065 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Intellectual disability syndromic and non-syndromic v0.4064 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4063 IGF1 Zornitza Stark reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8865 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Mendeliome v0.8865 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Mendeliome v0.8865 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Mendeliome v0.8864 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Mendeliome v0.8863 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.8862 IGF1 Zornitza Stark reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.182 IGF1 Zornitza Stark Publications for gene: IGF1 were set to 8857020; 15769976; 14684690; 31539878; 28768959; 34125705; 22832530
Growth failure v0.181 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Growth failure v0.181 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Growth failure v0.181 IGF1 Zornitza Stark Phenotypes for gene: IGF1 were changed from Insulin-Like Growth Factor I Deficiency; Growth retardation with deafness and mental retardation due to IGF1 deficiency, 608747; IGF1 to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747
Growth failure v0.180 IGF1 Zornitza Stark Publications for gene: IGF1 were set to
Growth failure v0.179 IGF1 Zornitza Stark Mode of inheritance for gene: IGF1 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Imprinting disorders v0.3 IGF2 Zornitza Stark Marked gene: IGF2 as ready
Imprinting disorders v0.3 IGF2 Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence).
Imprinting disorders v0.3 IGF2 Zornitza Stark Phenotypes for gene: IGF2 were changed from Affected tissue: all; Phenotypes resulting from gene over expression: Beckwith-Wiedemann Syndrome (proven effects of dosage alteration rather than gene muation). Phenotype resulting from under expression: Silver-Russell Syndrome to Affected tissue: all; Phenotypes resulting from gene over expression: Beckwith-Wiedemann Syndrome (proven effects of dosage alteration rather than gene muation). Phenotype resulting from under expression: Silver-Russell syndrome 3, MIM #616489
Imprinting disorders v0.2 IGF2 Zornitza Stark Publications for gene: IGF2 were set to http://igc.otago.ac.nz/home.html; PMID: 26154720; 30794780
Imprinting disorders v0.1 IGF2 Zornitza Stark reviewed gene: IGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26154720, 31544945; Phenotypes: Silver-Russell syndrome 3, MIM #616489; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.8862 IGF2 Zornitza Stark Mode of inheritance for gene: IGF2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mendeliome v0.8861 IGF2 Zornitza Stark changed review comment from: RSS phenotype.; to: Silver-Russell syndrome-3 (SRS3) is characterized by intrauterine growth retardation with relative macrocephaly, followed by feeding difficulties and postnatal growth restriction. Dysmorphic facial features include triangular face, prominent forehead, and low-set ears. Other variable features include limb defects, genitourinary and cardiovascular anomalies, hearing impairment, and developmental delay. Disruption of any gene in the HMGA2-PLAG1-IGF2 pathway results in a decrease in IGF2 expression and produces an SRS phenotype similar to that of patients carrying 11p15.5 epigenetic defects.

Begemann et al. (2015) performed exome sequencing in 4 affected people with severe growth restriction in one family, and identified a heterozygous nonsense mutation in the IGF2 gene that segregated fully with the disorder. Affected individuals inherited the mutation from their healthy fathers, and it originated from the healthy paternal grandmother. Clinical features occurred only in those who inherited the variant allele through paternal transmission, consistent with maternal imprinting of IGF2.

Many other cases reported since with de novo mutations in IGF2 present on the paternal allele.
Mendeliome v0.8861 IGF2 Zornitza Stark edited their review of gene: IGF2: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Growth failure v0.178 IGF2 Zornitza Stark Marked gene: IGF2 as ready
Growth failure v0.178 IGF2 Zornitza Stark Gene: igf2 has been classified as Green List (High Evidence).
Growth failure v0.178 IGF2 Zornitza Stark Phenotypes for gene: IGF2 were changed from Pre- and post-natal growth failure; SRS; ?Growth restriction, severe, with distinctive facies, 616489; Silver-Russell phenptype; IUGR to Silver-Russell syndrome 3, MIM #616489
Growth failure v0.177 IGF2 Zornitza Stark Publications for gene: IGF2 were set to 26154720
Mendeliome v0.8861 OBSL1 Zornitza Stark Marked gene: OBSL1 as ready
Mendeliome v0.8861 OBSL1 Zornitza Stark Gene: obsl1 has been classified as Green List (High Evidence).
Mendeliome v0.8861 OBSL1 Zornitza Stark Phenotypes for gene: OBSL1 were changed from to 3-M syndrome 2, MIM #612921
Mendeliome v0.8860 OBSL1 Zornitza Stark Publications for gene: OBSL1 were set to
Mendeliome v0.8859 OBSL1 Zornitza Stark Mode of inheritance for gene: OBSL1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8858 OBSL1 Zornitza Stark reviewed gene: OBSL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21737058, 19481195, 23018678, 19877176; Phenotypes: 3-M syndrome 2, MIM #612921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.176 OBSL1 Zornitza Stark Marked gene: OBSL1 as ready
Growth failure v0.176 OBSL1 Zornitza Stark Gene: obsl1 has been classified as Green List (High Evidence).
Growth failure v0.176 OBSL1 Zornitza Stark Phenotypes for gene: OBSL1 were changed from 3M; 3-M syndrome 2, 612921 to 3-M syndrome 2, MIM #612921
Growth failure v0.175 OBSL1 Zornitza Stark Publications for gene: OBSL1 were set to 21737058
Mendeliome v0.8858 PIK3R1 Zornitza Stark Marked gene: PIK3R1 as ready
Mendeliome v0.8858 PIK3R1 Zornitza Stark Gene: pik3r1 has been classified as Green List (High Evidence).
Mendeliome v0.8858 PIK3R1 Zornitza Stark Phenotypes for gene: PIK3R1 were changed from to SHORT syndrome, MIM # 269880; Immunodeficiency 36, MIM#616005
Mendeliome v0.8857 PIK3R1 Zornitza Stark Publications for gene: PIK3R1 were set to
Mendeliome v0.8856 PIK3R1 Zornitza Stark Mode of inheritance for gene: PIK3R1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8855 PIK3R1 Zornitza Stark reviewed gene: PIK3R1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23810378, 23810379, 23810382; Phenotypes: SHORT syndrome, MIM # 269880; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.174 PIK3R1 Zornitza Stark Marked gene: PIK3R1 as ready
Growth failure v0.174 PIK3R1 Zornitza Stark Gene: pik3r1 has been classified as Green List (High Evidence).
Growth failure v0.174 PIK3R1 Zornitza Stark Phenotypes for gene: PIK3R1 were changed from SHORT syndrome, 269880; SHORT to SHORT syndrome, OMIM # 269880
Growth failure v0.173 PIK3R1 Zornitza Stark Publications for gene: PIK3R1 were set to
Mendeliome v0.8855 PLAG1 Zornitza Stark Publications for gene: PLAG1 were set to 28796236; 29913240
Mendeliome v0.8854 PLAG1 Zornitza Stark Classified gene: PLAG1 as Green List (high evidence)
Mendeliome v0.8854 PLAG1 Zornitza Stark Gene: plag1 has been classified as Green List (High Evidence).
Mendeliome v0.8853 PLAG1 Zornitza Stark edited their review of gene: PLAG1: Added comment: Additional families reported, upgrade to Green.

Silver-Russell syndrome-4 (SRS4) is characterised by intrauterine growth retardation followed by feeding difficulties and postnatal growth restriction. Dysmorphic facial features include triangular face and prominent forehead, and relative macrocephaly at birth may be observed. So far 4 families have been reported with some functional studies of the role of the gene in the growth pathway.

Abi Habib et al. (2018) reported 1 family (child, sister and mother) patient with Silver-Russell syndrome (with normal methylation on chromosomes 7, 11, and 14, and exclusion of maternal UPD and chromosomal rearrangements). Using WES they identified a heterozygous 1-bp deletion in the PLAG1 gene. The variant segregated with disease, and was not present in polymorphism databases or ExAC. They also reported another patient with a different heterozygous 1-bp deletion in the PLAG1 gene. This was not found in her unaffected twin brother, older brother, or parents. Experiments in Hep3b cells demonstrated that PLAG1 positively regulates expression of the IGF2 promoter P3, independently and via the HMGA2-PLAG1-IGF2 pathway. Disruption of any gene in the pathway results in a decrease in IGF2 expression and produces an SRS phenotype similar to that of patients carrying 11p15.5 epigenetic defects (SRS1; 180860), except for body asymmetry, which is not expected to occur since the molecular defects are present in all cells of the body, unlike the mosaic epigenetic changes at the 11p15.5 locus.

Inoue et al. (2020) reported 1 family with 2 affected people with Silver-Russell syndrome with a nonsense variant in the PLAG1 gene, which segregated with disease.

Vado et al. (2020) reported 1 family with multiple affected people with Silver-Russell syndrome with a frameshift variant in the PLAG1 gene, which segregated with disease.; Changed rating: GREEN; Changed publications: 28796236, 29913240, 33291420, 32546215
Growth failure v0.172 PLAG1 Zornitza Stark Marked gene: PLAG1 as ready
Growth failure v0.172 PLAG1 Zornitza Stark Gene: plag1 has been classified as Green List (High Evidence).
Growth failure v0.172 PLAG1 Zornitza Stark Phenotypes for gene: PLAG1 were changed from SRS; Silver-Russell syndrome to Silver-Russell syndrome 4, MIM # 618907
Growth failure v0.171 PLAG1 Zornitza Stark Publications for gene: PLAG1 were set to 28796236
Growth failure v0.170 SRCAP Zornitza Stark Marked gene: SRCAP as ready
Growth failure v0.170 SRCAP Zornitza Stark Gene: srcap has been classified as Green List (High Evidence).
Growth failure v0.170 SRCAP Zornitza Stark Phenotypes for gene: SRCAP were changed from Floating-Harbor syndrome, 136140; Floating Harbor to Floating-Harbor syndrome, OMIM # 136140
Growth failure v0.169 SRCAP Zornitza Stark Publications for gene: SRCAP were set to
Growth failure v0.168 IGF1R Chirag Patel reviewed gene: IGF1R: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 14657428, 22130793, 23045302, 26252249, 17264177, 31586944; Phenotypes: Insulin-like growth factor I, resistance to, OMIM # 270450; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.168 IGF1 Chirag Patel reviewed gene: IGF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 8857020, 15769976, 14684690, 31539878, 28768959, 34125705, 22832530; Phenotypes: Growth retardation with deafness and mental retardation due to IGF1 deficiency, OMIM # 608747; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.168 IGF2 Chirag Patel reviewed gene: IGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26154720, 31544945; Phenotypes: Silver-Russell syndrome 3, OMIM #616489; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Growth failure v0.168 OBSL1 Chirag Patel reviewed gene: OBSL1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19481195, 23018678, 19877176; Phenotypes: 3-M syndrome 2, OMIM #612921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.168 PIK3R1 Chirag Patel reviewed gene: PIK3R1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 23810378, 23810379, 23810382; Phenotypes: SHORT syndrome, OMIM # 269880; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.168 PLAG1 Chirag Patel reviewed gene: PLAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 28796236, 33291420, 32546215; Phenotypes: Silver-Russell syndrome 4,OMIM # 618907; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.168 SRCAP Chirag Patel reviewed gene: SRCAP: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22265015, 22965468, 22965468; Phenotypes: Floating-Harbor syndrome, OMIM # 136140; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8853 PACRG Zornitza Stark Marked gene: PACRG as ready
Mendeliome v0.8853 PACRG Zornitza Stark Gene: pacrg has been classified as Red List (Low Evidence).
Mendeliome v0.8853 PACRG Zornitza Stark Publications for gene: PACRG were set to
Mendeliome v0.8852 PACRG Zornitza Stark Classified gene: PACRG as Red List (low evidence)
Mendeliome v0.8852 PACRG Zornitza Stark Gene: pacrg has been classified as Red List (Low Evidence).
Mendeliome v0.8851 PACRG Zornitza Stark reviewed gene: PACRG: Rating: RED; Mode of pathogenicity: None; Publications: 31116684, 31182890, 14737177, 27193298; Phenotypes: ; Mode of inheritance: None
Combined Immunodeficiency v0.345 ZBTB24 Zornitza Stark Marked gene: ZBTB24 as ready
Combined Immunodeficiency v0.345 ZBTB24 Zornitza Stark Gene: zbtb24 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.345 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to 21596365; 21906047; 27626380 32061411
Combined Immunodeficiency v0.344 ZBTB24 Zornitza Stark Phenotypes for gene: ZBTB24 were changed from to Immunodeficiency-centromeric instability-facial anomalies syndrome 2 MIM# 614069; Facial dysmorphic features; developmental delay; macroglossia; bacterial/opportunistic infections; malabsorption; cytopaenia; malignancies; multiradial configurations of chromosomes 1, 9, 16; Hypogammaglobulinaemia or agammaglobulinaemia; variable antibody deficiency
Combined Immunodeficiency v0.343 ZBTB24 Zornitza Stark Publications for gene: ZBTB24 were set to
Combined Immunodeficiency v0.342 ZBTB24 Zornitza Stark Mode of inheritance for gene: ZBTB24 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.92 WIPF1 Zornitza Stark Marked gene: WIPF1 as ready
Predominantly Antibody Deficiency v0.92 WIPF1 Zornitza Stark Gene: wipf1 has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.92 WIPF1 Zornitza Stark Phenotypes for gene: WIPF1 were changed from to Wiskott-Aldrich syndrome 2 MIM# 614493; Reduced T cells; defective lymphocyte responses to anti-CD3; high IgE; Thrombocytopenia with or without small platelets; recurrent bacterial and viral Infections; eczema; bloody diarrhoea; gastrointestinal bleeding; WAS protein absent
Predominantly Antibody Deficiency v0.91 WIPF1 Zornitza Stark Publications for gene: WIPF1 were set to
Predominantly Antibody Deficiency v0.90 WIPF1 Zornitza Stark Mode of inheritance for gene: WIPF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.89 WIPF1 Zornitza Stark reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, gastrointestinal bleeding, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8851 WIPF1 Zornitza Stark Marked gene: WIPF1 as ready
Mendeliome v0.8851 WIPF1 Zornitza Stark Gene: wipf1 has been classified as Green List (High Evidence).
Mendeliome v0.8851 WIPF1 Zornitza Stark Phenotypes for gene: WIPF1 were changed from to Wiskott-Aldrich syndrome 2 MIM# 614493; Reduced T cells; defective lymphocyte responses to anti-CD3; high IgE; Thrombocytopenia with or without small platelets; recurrent bacterial and viral Infections; eczema; bloody diarrhoea; gastrointestinal bleeding; WAS protein absent
Mendeliome v0.8850 WIPF1 Zornitza Stark Publications for gene: WIPF1 were set to
Mendeliome v0.8849 WIPF1 Zornitza Stark Mode of inheritance for gene: WIPF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4063 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Intellectual disability syndromic and non-syndromic v0.4063 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4063 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from to Transcobalamin II deficiency, 275350
Intellectual disability syndromic and non-syndromic v0.4062 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Intellectual disability syndromic and non-syndromic v0.4061 TCN2 Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8848 TCN2 Zornitza Stark changed review comment from: Well established gene-disease association.

26 pathogenic TCN2 variants have been reported in over 40 individuals; multiple mouse models

Homologous and Compound Heterozygous TCN2 variants (deletions or insertions, nonsense mutations, and point mutations) have been reported; deletions or insertions are the most common, causing frameshifts that result in protein truncation.

Individuals usually present within the first year of life with failure to thrive, diarrhoea, anaemia, pallor and agammaglobulinaemia.
Sources: Expert list; to: Well established gene-disease association.

26 pathogenic TCN2 variants have been reported in over 40 individuals; multiple mouse models

Homozygous and Compound Heterozygous TCN2 variants (deletions or insertions, nonsense mutations, and point mutations) have been reported; deletions or insertions are the most common, causing frameshifts that result in protein truncation.

Individuals usually present within the first year of life with failure to thrive, diarrhoea, anaemia, pallor and agammaglobulinaemia.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.4060 TCN2 Zornitza Stark reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 19373259, 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency, 275350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8848 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Mendeliome v0.8848 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Mendeliome v0.8848 TCN2 Zornitza Stark Publications for gene: TCN2 were set to 19373259
Mendeliome v0.8847 TCN2 Zornitza Stark edited their review of gene: TCN2: Changed publications: 19373259, 32841161, 33023511, 30124850
Mendeliome v0.8847 TCN2 Zornitza Stark changed review comment from: Well established gene-disease association.
Sources: Expert list; to: Well established gene-disease association.

26 pathogenic TCN2 variants have been reported in over 40 individuals; multiple mouse models

Homologous and Compound Heterozygous TCN2 variants (deletions or insertions, nonsense mutations, and point mutations) have been reported; deletions or insertions are the most common, causing frameshifts that result in protein truncation.

Individuals usually present within the first year of life with failure to thrive, diarrhoea, anaemia, pallor and agammaglobulinaemia.
Sources: Expert list
Mendeliome v0.8847 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from to Transcobalamin II deficiency, 275350
Mendeliome v0.8846 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Mendeliome v0.8845 TCN2 Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8844 TAP2 Zornitza Stark Marked gene: TAP2 as ready
Mendeliome v0.8844 TAP2 Zornitza Stark Gene: tap2 has been classified as Green List (High Evidence).
Mendeliome v0.8844 TAP2 Zornitza Stark Phenotypes for gene: TAP2 were changed from to Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571; Low CD8; absent MHC I on lymphocytes; Vasculitis; pyoderma gangrenosum; recurrent bacterial/viral respiratory infections; bronchiectasis
Mendeliome v0.8843 TAP2 Zornitza Stark Publications for gene: TAP2 were set to
Mendeliome v0.8842 TAP2 Zornitza Stark Mode of inheritance for gene: TAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8841 TAP1 Zornitza Stark Marked gene: TAP1 as ready
Mendeliome v0.8841 TAP1 Zornitza Stark Gene: tap1 has been classified as Green List (High Evidence).
Mendeliome v0.8841 TAP1 Zornitza Stark Phenotypes for gene: TAP1 were changed from to Bare lymphocyte syndrome, type I MIM#604571; Low CD8; absent MHC I on lymphocytes; vasculitis; pyoderma gangrenosum; skin lesions; recurrent respiratory tract infections; bronchiectasis
Mendeliome v0.8840 TAP1 Zornitza Stark Publications for gene: TAP1 were set to
Mendeliome v0.8839 TAP1 Zornitza Stark Mode of inheritance for gene: TAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8838 PGRMC1 Bryony Thompson Phenotypes for gene: PGRMC1 were changed from Premature ovarian failure to Premature ovarian failure; Isolated paediatric cataract
Mendeliome v0.8837 PGRMC1 Bryony Thompson Tag SV/CNV tag was added to gene: PGRMC1.
Mendeliome v0.8837 PGRMC1 Bryony Thompson Publications for gene: PGRMC1 were set to 25246111; 18782852
Mendeliome v0.8836 WIPF1 Danielle Ariti reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, gastrointestinal bleeding, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8836 PGRMC1 Bryony Thompson Classified gene: PGRMC1 as Amber List (moderate evidence)
Mendeliome v0.8836 PGRMC1 Bryony Thompson Gene: pgrmc1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8835 PGRMC1 Bryony Thompson reviewed gene: PGRMC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 33867527, 23783460; Phenotypes: Isolated paediatric cataract; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cataract v0.286 PGRMC1 Bryony Thompson Marked gene: PGRMC1 as ready
Cataract v0.286 PGRMC1 Bryony Thompson Gene: pgrmc1 has been classified as Amber List (Moderate Evidence).
Cataract v0.286 PGRMC1 Bryony Thompson changed review comment from: A single large family with X-linked isolated paediatric cataract segregating a large 127 kb deletion truncating PGRMC1. A supporting knockout zebrafish model with cataract. Also, two unrelated probands with non-syndromic ID and cataract with a large deletion encompassing PGRMC1 and SLC25A5.
Sources: Literature; to: A single large family with X-linked isolated paediatric cataract in males segregating a large 127 kb deletion truncating PGRMC1. A supporting knockout zebrafish model with cataract. Also, two unrelated male probands with non-syndromic ID and cataract with a large deletion encompassing PGRMC1 and SLC25A5.
Sources: Literature
Cataract v0.286 PGRMC1 Bryony Thompson Classified gene: PGRMC1 as Amber List (moderate evidence)
Cataract v0.286 PGRMC1 Bryony Thompson Gene: pgrmc1 has been classified as Amber List (Moderate Evidence).
Cataract v0.285 PGRMC1 Bryony Thompson gene: PGRMC1 was added
gene: PGRMC1 was added to Cataract. Sources: Literature
SV/CNV tags were added to gene: PGRMC1.
Mode of inheritance for gene: PGRMC1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: PGRMC1 were set to 33867527; 23783460
Phenotypes for gene: PGRMC1 were set to Isolated paediatric cataract
Review for gene: PGRMC1 was set to AMBER
Added comment: A single large family with X-linked isolated paediatric cataract segregating a large 127 kb deletion truncating PGRMC1. A supporting knockout zebrafish model with cataract. Also, two unrelated probands with non-syndromic ID and cataract with a large deletion encompassing PGRMC1 and SLC25A5.
Sources: Literature
Combined Immunodeficiency v0.341 WIPF1 Zornitza Stark Marked gene: WIPF1 as ready
Combined Immunodeficiency v0.341 WIPF1 Zornitza Stark Gene: wipf1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.341 WIPF1 Zornitza Stark Phenotypes for gene: WIPF1 were changed from to Wiskott-Aldrich syndrome 2 MIM# 614493; Reduced T cells; defective lymphocyte responses to anti-CD3; high IgE; Thrombocytopenia with or without small platelets; recurrent bacterial and viral Infections; eczema; bloody diarrhoea; gastrointestinal bleeding; WAS protein absent
Combined Immunodeficiency v0.340 WIPF1 Zornitza Stark Publications for gene: WIPF1 were set to
Combined Immunodeficiency v0.339 WIPF1 Zornitza Stark Mode of inheritance for gene: WIPF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.338 TCN2 Zornitza Stark Marked gene: TCN2 as ready
Combined Immunodeficiency v0.338 TCN2 Zornitza Stark Gene: tcn2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.338 TCN2 Zornitza Stark Phenotypes for gene: TCN2 were changed from to Transcobalamin II deficiency MIM# 275350; Decreased Ig levels; Megaloblastic anaemia; pancytopaenia; if untreated (B12) for prolonged periods results in intellectual disability; failure to thrive; diarrhoea; hypogammaglobulinaemia; pallor; hypotonia; respiratory infection
Growth failure v0.168 TRIM37 Chirag Patel reviewed gene: TRIM37: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10888877, 12754710, 15108285, 14757854, 27044324; Phenotypes: Mulibrey nanism; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.337 TCN2 Zornitza Stark Publications for gene: TCN2 were set to
Combined Immunodeficiency v0.336 TCN2 Zornitza Stark Mode of inheritance for gene: TCN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.335 TAP2 Zornitza Stark Marked gene: TAP2 as ready
Combined Immunodeficiency v0.335 TAP2 Zornitza Stark Gene: tap2 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.335 TAP2 Zornitza Stark Phenotypes for gene: TAP2 were changed from to Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571; Low CD8; absent MHC I on lymphocytes; Vasculitis; pyoderma gangrenosum; recurrent bacterial/viral respiratory infections; bronchiectasis
Mendeliome v0.8835 TAP2 Danielle Ariti reviewed gene: TAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 7517574, 9232449, 10560675, 27861817; Phenotypes: Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571, Low CD8, absent MHC I on lymphocytes, Vasculitis, pyoderma gangrenosum, recurrent bacterial/viral respiratory infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.334 TAP2 Zornitza Stark Publications for gene: TAP2 were set to
Combined Immunodeficiency v0.333 TAP2 Zornitza Stark Mode of inheritance for gene: TAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8835 TAP1 Danielle Ariti reviewed gene: TAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28161407, 10074494, 1473153; Phenotypes: Bare lymphocyte syndrome, type I MIM#604571, Low CD8, absent MHC I on lymphocytes, vasculitis, pyoderma gangrenosum, skin lesions, recurrent respiratory tract infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.332 TAP1 Zornitza Stark Marked gene: TAP1 as ready
Combined Immunodeficiency v0.332 TAP1 Zornitza Stark Gene: tap1 has been classified as Green List (High Evidence).
Combined Immunodeficiency v0.332 TAP1 Zornitza Stark Phenotypes for gene: TAP1 were changed from to Bare lymphocyte syndrome, type I MIM#604571; Low CD8; absent MHC I on lymphocytes; vasculitis; pyoderma gangrenosum; skin lesions; recurrent respiratory tract infections; bronchiectasis
Combined Immunodeficiency v0.331 TAP1 Zornitza Stark Publications for gene: TAP1 were set to 28161407; 10074494; 1473153
Combined Immunodeficiency v0.330 TAP1 Zornitza Stark Publications for gene: TAP1 were set to
Combined Immunodeficiency v0.330 TAP1 Zornitza Stark Mode of inheritance for gene: TAP1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.329 TAP1 Zornitza Stark Mode of inheritance for gene: TAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 ZBTB24 Danielle Ariti reviewed gene: ZBTB24: Rating: GREEN; Mode of pathogenicity: None; Publications: 21596365, 21906047, 27626380 32061411; Phenotypes: Immunodeficiency-centromeric instability-facial anomalies syndrome 2 MIM# 614069, Facial dysmorphic features, developmental delay, macroglossia, bacterial/opportunistic infections, malabsorption, cytopaenia, malignancies, multiradial configurations of chromosomes 1, 9, 16, Hypogammaglobulinaemia or agammaglobulinaemia, variable antibody deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 WIPF1 Danielle Ariti reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, gastrointestinal bleeding, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 WIPF1 Danielle Ariti Deleted their review
Combined Immunodeficiency v0.328 WIPF1 Danielle Ariti reviewed gene: WIPF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22231303, 27742395, 11869681, 14757742; Phenotypes: Wiskott-Aldrich syndrome 2 MIM# 614493, Reduced T cells, defective lymphocyte responses to anti-CD3, high IgE, Thrombocytopenia with or without small platelets, recurrent bacterial and viral Infections, eczema, bloody diarrhoea, WAS protein absent; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8835 ALS2 Teresa Zhao gene: ALS2 was added
gene: ALS2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ALS2 were set to PMID: 30128655; 33409823
Phenotypes for gene: ALS2 were set to Infantile onset ascending spastic paralysis (MIM#607225); Juvenile amyotrophic lateral sclerosis 2 (MIM#205100); Juvenile primary lateral sclerosis (MIM#606353)
Review for gene: ALS2 was set to GREEN
Added comment: >50 variants reported in multiple individuals with Infantile onset ascending spastic paralysis, mostly originated from the Middle East and Mediterranean countries.
Sources: Literature
Combined Immunodeficiency v0.328 TCN2 Danielle Ariti reviewed gene: TCN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32841161, 33023511, 30124850; Phenotypes: Transcobalamin II deficiency MIM# 275350, Decreased Ig levels, Megaloblastic anaemia, pancytopaenia, if untreated (B12) for prolonged periods results in intellectual disability, failure to thrive, diarrhoea, hypogammaglobulinaemia, pallor, hypotonia, respiratory infection; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Combined Immunodeficiency v0.328 TAP2 Danielle Ariti reviewed gene: TAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 7517574, 9232449, 10560675, 27861817; Phenotypes: Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571, Low CD8, absent MHC I on lymphocytes, Vasculitis, pyoderma gangrenosum, recurrent bacterial/viral respiratory infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.63 HMNMYO Bryony Thompson Marked STR: HMNMYO as ready
Repeat Disorders v0.63 HMNMYO Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence).
Repeat Disorders v0.63 HMNMYO Bryony Thompson Classified STR: HMNMYO as Green List (high evidence)
Repeat Disorders v0.63 HMNMYO Bryony Thompson Str: hmnmyo has been classified as Green List (High Evidence).
Repeat Disorders v0.62 HMNMYO Bryony Thompson STR: HMNMYO was added
STR: HMNMYO was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: HMNMYO was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: HMNMYO were set to 33559681; 33459760
Phenotypes for STR: HMNMYO were set to Neuropathy, hereditary motor, with myopathic features MIM#619216
Review for STR: HMNMYO was set to GREEN
STR: HMNMYO was marked as clinically relevant
Added comment: NM_022834.5(VWA1):c.62_71GCGCGGAGCG[X]
10-bp repeat expansion leading to a loss of function allele, was observed in 14/15 families and was homozygous in 10/15 with a recessive hereditary motor neuropathy.
Normal: 2 repeats
Pathogenic: >=3 repeats (currently only 3 repeats reported)
Sources: Literature
Combined Immunodeficiency v0.328 TAP1 Danielle Ariti reviewed gene: TAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28161407, 10074494, 1473153; Phenotypes: Bare lymphocyte syndrome, type I MIM#604571, Low CD8, absent MHC I on lymphocytes, vasculitis, pyoderma gangrenosum, skin lesions, recurrent respiratory tract infections, bronchiectasis; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Cardiomyopathy_Paediatric v0.103 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.102 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Cardiomyopathy_Paediatric. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Deafness_IsolatedAndComplex v1.89 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v1.88 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Deafness_IsolatedAndComplex. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Ataxia v0.291 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Ataxia v0.291 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Ataxia v0.291 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Ataxia v0.291 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Ataxia v0.290 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Ataxia - paediatric. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Leukodystrophy v0.230 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Leukodystrophy v0.230 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Leukodystrophy v0.230 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Leukodystrophy v0.230 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Mendeliome v0.8835 RNF220 Zornitza Stark Tag founder tag was added to gene: RNF220.
Leukodystrophy v0.229 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Leukodystrophy - paediatric. Sources: Literature
founder tags were added to gene: RNF220.
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Mendeliome v0.8835 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Mendeliome v0.8835 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Mendeliome v0.8835 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Mendeliome v0.8835 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Mendeliome v0.8834 RNF220 Zornitza Stark gene: RNF220 was added
gene: RNF220 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Marked gene: RNF220 as ready
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Classified gene: RNF220 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.4060 RNF220 Zornitza Stark Gene: rnf220 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis changed review comment from: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other; to: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.

Consider inclusion in panels for leukodystrophies, childhood onset ataxia, sensorineural hearing loss, corpus callosum anomalies, cardiomyopathies, hepatopathies, etc in all cases with green rating.

Sources: Literature, Other
Intellectual disability syndromic and non-syndromic v0.4059 RNF220 Konstantinos Varvagiannis gene: RNF220 was added
gene: RNF220 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: RNF220 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF220 were set to 33964137; 10881263
Phenotypes for gene: RNF220 were set to Leukodystrophy; CNS hypomyelination; Ataxia; Intellectual disability; Sensorineural hearing impairment; Elevated hepatic transaminases; Hepatic fibrosis; Dilated cardiomyopathy; Spastic paraplegia; Dysarthria; Abnormality of the corpus callosum
Penetrance for gene: RNF220 were set to Complete
Review for gene: RNF220 was set to GREEN
Added comment: Sferra et al (2021 - PMID: 33964137) provide extensive evidence that biallelic RNF220 mutations cause a disorder characterized by hypomyelinating leukodystrophy, ataxia (9/9 - onset 1-5y), borderline intellectual functioning (3/9) / intellectual disability (5/9 - in most cases mild), sensorineural deafness (9/9) with complete hearing loss in the first decade of life, hepatopathy (9/9) with associated periportal fibrosis, and dilated cardiomyopathy (9/9) which was fatal.

Other neurologic manifestations apart from ataxia incl. hyperreflexia (8/8), spastic paraplegia (9/9), dysarthria (9/9), peripheral neuropathy (4/9), seizures in one case (1/9). Upon brain MRI there was thin corpus callosum (9/9) or cerebellar atrophy in some (2/9).

The authors identified homozygosity for 2 recurrent missense RNF220 variants in affected members belonging to these 5 broad consanguineous pedigrees (7 families), namely NM_018150.4:c.1094G>A / p.Arg365Gly in 4 Roma families in the context of a shared haplotype (/founder effect) as well as c.1088G>A / p.Arg363Gly in a large pedigree from southern Italy initially reported by Leuzzi et al (2000 - PMID: 10881263).

Extensive segregation analyses were carried out including several affected and unaffected members.

RNF220 encodes ring finger protein 220, which functions as an E3 ubiquitin ligase. Previous studies have shown among others a role in modulation of Sonic hedgehog/GLI signaling and cerebellar development

Evidence for the role of RNF220 included relevant expression, localization within the cell, interaction partners (lamin B1, 20S proteasome), similarities with other laminopathies in terms of phenotype, etc :
*RNF220 has a relevant expression pattern in CNS (based on qRT-PCR analyses in human brain, cerebellum, cerebral cortex / mRNA levels in human fetal CNS with higher expression in cerebellum, spinal cord and cortex / previous GTEx data / protein levels in mouse CNS)
*The protein displays nuclear localization based on iPSC cells differentiated to motor neurons (also supported by data from the Human Protein Atlas). Transfection of COS-1 cells demonstrated localization primarily to the nucleus (as also previously demonstrated in HEK293T cells) in vesicle like structures with ASF2/SF2 colocalization suggesting enrichment in nuclear speckles. There was also partial co-distribution with the 20S proteasome. R363Q and R365Q additionally coalesced in the cytoplasm forming protein aggregates/inclusions.
*Immunofluorescence studies in patient fibroblasts also confirmed abnormal increase of the protein in the cytoplasm and increased fluorescence with the 20S proteasome.
*Proteomic identification of RNF220-interacting proteins in transfected HEK293T cells demonstrated enrichment for all members of the lamin protein family (incl . lamin B1, AC, B2).
*RNAi-mediated downregulation of RNF222 in Drosophila suggested altered subcellular localization and accumulation of the fly orthologue for human lamin B1.
*Immunoprecipitation of lamin B1 from the nuclear matrix of cerebellar cells suggested significant interaction of endogenous lamin B1 with RNF220, while transfection studies in HEK293T cells for wt/mt suggested reduced binding to endogenous lamin B1 for RNF220 mt compared to wt (more prominent for R365Q). RNF220 mutants also reduced ubiquitination of nuclear lamin B1 compared to wt.
*Patient fibroblasts immunostained with different nuclear envelope markers displayed abnormal nuclear shapes with multiple invaginations and lobulations, findings also observed in laminopathies.

There is currently no associated phenotype in OMIM or G2P. SysID includes RNF220 among the current primary ID genes.
Sources: Literature, Other
Growth failure v0.167 KMT2D Zornitza Stark changed review comment from: Association with Kabuki syndrome: failure to thrive in infancy and short stature are key features.

Note new association between missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.
~10 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability.; to: Association with Kabuki syndrome: failure to thrive in infancy and short stature are key features.

Note new association between missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.
~10 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability. Extreme short stature reported.
Growth failure v0.167 KMT2D Zornitza Stark Phenotypes for gene: KMT2D were changed from Kabuki syndrome 1, MIM# 147920 to Kabuki syndrome 1, MIM# 147920; KMT2D-associated neurodevelopmental syndrome
Growth failure v0.166 KMT2D Zornitza Stark Publications for gene: KMT2D were set to 21882399
Growth failure v0.165 KMT2D Zornitza Stark changed review comment from: Failure to thrive in infancy and short stature are key features.; to: Association with Kabuki syndrome: failure to thrive in infancy and short stature are key features.

Note new association between missense variants located in a specific region spanning exons 38 and 39 and affecting highly conserved residues cause a novel multiple malformations syndrome distinct from Kabuki syndrome, through a dominant negative mechanism.
~10 unrelated families with choanal atresia, athelia or hypoplastic nipples, branchial sinus abnormalities, neck pits, lacrimal duct anomalies, hearing loss, external ear malformations, and thyroid abnormalities. None of the individuals had intellectual disability.
Growth failure v0.165 KMT2D Zornitza Stark edited their review of gene: KMT2D: Changed publications: 31949313, 32083401, 21882399; Changed phenotypes: Kabuki syndrome 1, MIM# 147920, KMT2D-associated neurodevelopmental syndrome
Growth failure v0.165 KMT2D Zornitza Stark Publications for gene: KMT2D were set to
Growth failure v0.164 KMT2D Zornitza Stark edited their review of gene: KMT2D: Changed publications: 21882399
Growth failure v0.164 KMT2D Zornitza Stark Marked gene: KMT2D as ready
Growth failure v0.164 KMT2D Zornitza Stark Gene: kmt2d has been classified as Green List (High Evidence).
Growth failure v0.164 KMT2D Zornitza Stark Phenotypes for gene: KMT2D were changed from Kabuki to Kabuki syndrome 1, MIM# 147920
Growth failure v0.163 KMT2D Zornitza Stark Classified gene: KMT2D as Green List (high evidence)
Growth failure v0.163 KMT2D Zornitza Stark Gene: kmt2d has been classified as Green List (High Evidence).
Growth failure v0.162 KMT2D Zornitza Stark reviewed gene: KMT2D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kabuki syndrome 1, MIM# 147920; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.162 CDT1 Zornitza Stark Marked gene: CDT1 as ready
Growth failure v0.162 CDT1 Zornitza Stark Gene: cdt1 has been classified as Green List (High Evidence).
Growth failure v0.162 CDT1 Zornitza Stark Phenotypes for gene: CDT1 were changed from Meier-Gorlin syndrome 4, 613804; micrognathia, microtia, patellar hypoplasia/aplasia, mammary hypoplasia; Meier-Gorlin to Meier-Gorlin syndrome 4, MIM# 613804; MONDO:0013431
Growth failure v0.161 CDT1 Zornitza Stark Publications for gene: CDT1 were set to 21358632
Growth failure v0.160 CDT1 Zornitza Stark Classified gene: CDT1 as Green List (high evidence)
Growth failure v0.160 CDT1 Zornitza Stark Gene: cdt1 has been classified as Green List (High Evidence).
Growth failure v0.159 CDT1 Zornitza Stark reviewed gene: CDT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21358632, 21358631, 33338304, 22333897; Phenotypes: Meier-Gorlin syndrome 4, MIM# 613804, MONDO:0013431; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.159 CHD7 Zornitza Stark Marked gene: CHD7 as ready
Growth failure v0.159 CHD7 Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence).
Growth failure v0.159 CHD7 Zornitza Stark Phenotypes for gene: CHD7 were changed from CHARGE syndrome, 214800; CHARGE syndrome - ocular coloboma, choanal atresia, cranial nerve defects, distinctive external and inner ear abnormalities, hearing loss, cardiovascular malformations, urogenital anomalies, and growth retardation to CHARGE syndrome, MIM# 214800
Growth failure v0.158 CHD7 Zornitza Stark Classified gene: CHD7 as Green List (high evidence)
Growth failure v0.158 CHD7 Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence).
Growth failure v0.157 CHD7 Zornitza Stark reviewed gene: CHD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: CHARGE syndrome, MIM# 214800; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.157 ATRIP Zornitza Stark Marked gene: ATRIP as ready
Growth failure v0.157 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Growth failure v0.157 ATRIP Zornitza Stark Phenotypes for gene: ATRIP were changed from microcephaly, micrognathia, small ear lobes, dental crowding to Seckel-like syndrome
Growth failure v0.156 ATRIP Zornitza Stark reviewed gene: ATRIP: Rating: RED; Mode of pathogenicity: None; Publications: 23144622; Phenotypes: Seckel syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.156 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Growth failure v0.156 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Growth failure v0.156 PLK4 Zornitza Stark Phenotypes for gene: PLK4 were changed from microcephaly and chorioretinopathy 2, MONDO:0014516; Microcephaly and chorioretinopathy, autosomal recessive, 2, OMIM:616171 to Microcephaly and chorioretinopathy 2, MONDO:0014516; Microcephaly and chorioretinopathy, autosomal recessive, 2, #MIM:616171
Growth failure v0.155 PLK4 Zornitza Stark Classified gene: PLK4 as Green List (high evidence)
Growth failure v0.155 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Growth failure v0.154 PLK4 Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.154 Zornitza Stark Panel types changed to Rare Disease
Growth failure v0.153 RNPC3 Zornitza Stark Marked gene: RNPC3 as ready
Growth failure v0.153 RNPC3 Zornitza Stark Gene: rnpc3 has been classified as Amber List (Moderate Evidence).
Growth failure v0.153 RNPC3 Zornitza Stark Phenotypes for gene: RNPC3 were changed from ?Growth hormone deficiency, isolated, type V, 618160; isolated growth hormone deficiency to Growth hormone deficiency
Growth failure v0.152 RNPC3 Zornitza Stark reviewed gene: RNPC3: Rating: AMBER; Mode of pathogenicity: None; Publications: 29866761, 32462814; Phenotypes: Growth hormone deficiency; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.152 RAP1B Zornitza Stark edited their review of gene: RAP1B: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.152 RAP1B Zornitza Stark Marked gene: RAP1B as ready
Growth failure v0.152 RAP1B Zornitza Stark Gene: rap1b has been classified as Amber List (Moderate Evidence).
Growth failure v0.152 RAP1B Zornitza Stark Phenotypes for gene: RAP1B were changed from short stature; Syndromic intellectual disability to Syndromic intellectual disability; short stature
Growth failure v0.151 RAP1B Zornitza Stark reviewed gene: RAP1B: Rating: AMBER; Mode of pathogenicity: None; Publications: 32627184, 26280580; Phenotypes: Syndromic intellectual disability, short stature; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.151 CDC6 Zornitza Stark Marked gene: CDC6 as ready
Growth failure v0.151 CDC6 Zornitza Stark Gene: cdc6 has been classified as Red List (Low Evidence).
Growth failure v0.151 CDC6 Zornitza Stark Phenotypes for gene: CDC6 were changed from patellar hypoplasia/aplasia, microtia, meier-gorlin syndrome, mammary hypoplasia; ?Meier-Gorlin syndrome 5, 613805 to Meier-Gorlin syndrome 5 (MIM#613805)
Growth failure v0.150 CDC6 Zornitza Stark reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.149 HDAC8 Zornitza Stark Marked gene: HDAC8 as ready
Growth failure v0.149 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Growth failure v0.149 HDAC8 Zornitza Stark Phenotypes for gene: HDAC8 were changed from Cornelia De Lange to Cornelia de Lange syndrome 5, MIM# 300882
Growth failure v0.148 HDAC8 Zornitza Stark Publications for gene: HDAC8 were set to
Growth failure v0.147 HDAC8 Zornitza Stark Classified gene: HDAC8 as Green List (high evidence)
Growth failure v0.147 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Growth failure v0.146 HDAC8 Zornitza Stark reviewed gene: HDAC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 30614194, 24403048; Phenotypes: Cornelia de Lange syndrome 5, MIM# 300882; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Growth failure v0.146 NLRP2 Zornitza Stark edited their review of gene: NLRP2: Changed publications: 30877238, 33090377, 29574422, 26323243, 19300480
Growth failure v0.146 NLRP2 Zornitza Stark Marked gene: NLRP2 as ready
Growth failure v0.146 NLRP2 Zornitza Stark Gene: nlrp2 has been classified as Amber List (Moderate Evidence).
Growth failure v0.146 NLRP2 Zornitza Stark Mode of inheritance for gene: NLRP2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to Other
Growth failure v0.145 NLRP2 Zornitza Stark reviewed gene: NLRP2: Rating: AMBER; Mode of pathogenicity: None; Publications: 29574422; Phenotypes: IUGR; Mode of inheritance: Other
Growth failure v0.145 NHLRC2 Zornitza Stark Marked gene: NHLRC2 as ready
Growth failure v0.145 NHLRC2 Zornitza Stark Gene: nhlrc2 has been classified as Green List (High Evidence).
Growth failure v0.145 NHLRC2 Zornitza Stark Phenotypes for gene: NHLRC2 were changed from FINCA syndrome OMIM:618278 to Fibrosis, neurodegeneration, and cerebral angiomatosis (FINCA) syndrome MIM#618278
Growth failure v0.144 NHLRC2 Zornitza Stark Classified gene: NHLRC2 as Green List (high evidence)
Growth failure v0.144 NHLRC2 Zornitza Stark Gene: nhlrc2 has been classified as Green List (High Evidence).
Growth failure v0.143 NHLRC2 Zornitza Stark reviewed gene: NHLRC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29423877, 32435055; Phenotypes: Fibrosis, neurodegeneration, and cerebral angiomatosis (FINCA) syndrome MIM#618278; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.143 NBAS Zornitza Stark Marked gene: NBAS as ready
Growth failure v0.143 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Mendeliome v0.8833 NBAS Zornitza Stark Marked gene: NBAS as ready
Mendeliome v0.8833 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Mendeliome v0.8833 NBAS Zornitza Stark Phenotypes for gene: NBAS were changed from to Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800; Infantile liver failure syndrome 2, MIM# 616483
Mendeliome v0.8832 NBAS Zornitza Stark Publications for gene: NBAS were set to
Mendeliome v0.8831 NBAS Zornitza Stark Mode of inheritance for gene: NBAS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8830 NBAS Zornitza Stark reviewed gene: NBAS: Rating: GREEN; Mode of pathogenicity: None; Publications: 31761904; Phenotypes: Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800, Infantile liver failure syndrome 2, MIM# 616483; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.143 NBAS Zornitza Stark Marked gene: NBAS as ready
Growth failure v0.143 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Growth failure v0.143 NBAS Zornitza Stark Phenotypes for gene: NBAS were changed from Short stature, optic nerve atrophy, and Pelger-Huet anomaly, 614800 to Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800
Growth failure v0.142 NBAS Zornitza Stark Publications for gene: NBAS were set to 31761904
Growth failure v0.141 NBAS Zornitza Stark changed review comment from: Founder mutation in Yakut population but also reported in other ethnicities. Short stature is a feature.

Note bi-allelic variants in this gene also cause infantile liver failure syndrome, MIM#616483.; to: Founder mutation in Yakut population but also reported in other ethnicities. Short stature is a feature.

Note bi-allelic variants in this gene also cause infantile liver failure syndrome, MIM#616483. Clinical features are directly related to the affected region of the NBAS protein: β-propeller (combined phenotype), Sec39 (infantile liver failure syndrome type 2/ILFS2), and C-terminal (short stature, optic atrophy, and Pelger-Huët anomaly/SOPH)
Growth failure v0.141 NBAS Zornitza Stark Classified gene: NBAS as Green List (high evidence)
Growth failure v0.141 NBAS Zornitza Stark Gene: nbas has been classified as Green List (High Evidence).
Growth failure v0.140 NBAS Zornitza Stark reviewed gene: NBAS: Rating: GREEN; Mode of pathogenicity: None; Publications: 20577004, 26286438; Phenotypes: Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.140 MTX2 Zornitza Stark Marked gene: MTX2 as ready
Growth failure v0.140 MTX2 Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence).
Growth failure v0.140 MTX2 Zornitza Stark Classified gene: MTX2 as Green List (high evidence)
Growth failure v0.140 MTX2 Zornitza Stark Gene: mtx2 has been classified as Green List (High Evidence).
Growth failure v0.139 MTX2 Zornitza Stark reviewed gene: MTX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32917887; Phenotypes: Mandibuloacral dysplasia progeroid syndrome, MIM# 619127, Mandibuloacral dysplasia, lipodystrophy, arterial calcification; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Repeat Disorders v0.61 SCA8 Bryony Thompson Marked STR: SCA8 as ready
Repeat Disorders v0.61 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Repeat Disorders v0.61 SCA8 Bryony Thompson Classified STR: SCA8 as Green List (high evidence)
Repeat Disorders v0.61 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Repeat Disorders v0.60 SCA8 Bryony Thompson STR: SCA8 was added
STR: SCA8 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA8 were set to 20301445
Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: SCA8 was set to GREEN
STR: SCA8 was marked as clinically relevant
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Expert list
Repeat Disorders v0.59 FXPOI Bryony Thompson Marked STR: FXPOI as ready
Repeat Disorders v0.59 FXPOI Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence).
Repeat Disorders v0.59 FXPOI Bryony Thompson Classified STR: FXPOI as Green List (high evidence)
Repeat Disorders v0.59 FXPOI Bryony Thompson Str: fxpoi has been classified as Green List (High Evidence).
Repeat Disorders v0.58 FXPOI Bryony Thompson STR: FXPOI was added
STR: FXPOI was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXPOI was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXPOI were set to 20301558
Phenotypes for STR: FXPOI were set to Premature ovarian failure 1 MIM#311360
Review for STR: FXPOI was set to GREEN
STR: FXPOI was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the POI phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (grey zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXPOI: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
It is estimated that 21% of women who carry a premutation develop FXPOI. The association between repeat size of the premutation allele and FXPOI is nonlinear; women with 80-99 repeats are at greatest risk for FXPOI.
Sources: Expert list
Repeat Disorders v0.57 EPM1 Bryony Thompson Marked STR: EPM1 as ready
Repeat Disorders v0.57 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.57 EPM1 Bryony Thompson Classified STR: EPM1 as Green List (high evidence)
Repeat Disorders v0.57 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.56 EPM1 Bryony Thompson STR: EPM1 was added
STR: EPM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EPM1 were set to 29325606; 20301321
Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: EPM1 was set to GREEN
STR: EPM1 was marked as clinically relevant
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Repeat Disorders v0.55 FRDA Bryony Thompson Marked STR: FRDA as ready
Repeat Disorders v0.55 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Repeat Disorders v0.55 FRDA Bryony Thompson Classified STR: FRDA as Green List (high evidence)
Repeat Disorders v0.55 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Repeat Disorders v0.54 FRDA Bryony Thompson STR: FRDA was added
STR: FRDA was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FRDA were set to 20301458
Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300
Review for STR: FRDA was set to GREEN
STR: FRDA was marked as clinically relevant
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Repeat Disorders v0.53 FRAXE Bryony Thompson Marked STR: FRAXE as ready
Repeat Disorders v0.53 FRAXE Bryony Thompson Str: fraxe has been classified as Green List (High Evidence).
Repeat Disorders v0.53 FRAXE Bryony Thompson Classified STR: FRAXE as Green List (high evidence)
Repeat Disorders v0.53 FRAXE Bryony Thompson Str: fraxe has been classified as Green List (High Evidence).
Repeat Disorders v0.52 FRAXE Bryony Thompson STR: FRAXE was added
STR: FRAXE was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FRAXE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: FRAXE were set to 8334699; 8673085; 11388762
Phenotypes for STR: FRAXE were set to Intellectual developmental disorder, X-linked 109 MIM#309548
Review for STR: FRAXE was set to GREEN
STR: FRAXE was marked as clinically relevant
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Mendeliome v0.8830 ARF3 Zornitza Stark Marked gene: ARF3 as ready
Mendeliome v0.8830 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8830 ARF3 Zornitza Stark Classified gene: ARF3 as Amber List (moderate evidence)
Mendeliome v0.8830 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8829 ARF3 Zornitza Stark gene: ARF3 was added
gene: ARF3 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Review for gene: ARF3 was set to AMBER
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Marked gene: ARF3 as ready
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Classified gene: ARF3 as Amber List (moderate evidence)
Genetic Epilepsy v0.1170 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4059 ARF3 Zornitza Stark Classified gene: ARF3 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4059 ARF3 Zornitza Stark Gene: arf3 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Zornitza Stark reviewed gene: ARF3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Genetic Epilepsy v0.1169 ARF3 Konstantinos Varvagiannis gene: ARF3 was added
gene: ARF3 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Penetrance for gene: ARF3 were set to unknown
Review for gene: ARF3 was set to AMBER
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4058 ARF3 Konstantinos Varvagiannis gene: ARF3 was added
gene: ARF3 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: ARF3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: ARF3 were set to 34346499
Phenotypes for gene: ARF3 were set to Global developmental delay; Intellectual disability; Seizures; Morphological abnormality of the central nervous system
Penetrance for gene: ARF3 were set to unknown
Added comment: Sakamoto et al (2021 - PMID: 34346499) provide some evidence that monoallelic ARF3 pathogenic variants may be associated with a NDD with brain abnormality.

Using trio exome sequencing, the authors identified 2 individuals with NDD harboring de novo ARF3 variants, namely: NM_001659.2:c.200A>T / p.Asp67Val and c.296G>T / p.Arg99Leu.

Individual 1 (with Asp67Val / age : 4y10m), appeared to be more severelely affected with prenatal onset progressive microcephaly, severe global DD, epilepsy. Upon MRI there was cerebellar and brainstem atrophy. Individual 2 (Arg99Leu / 14y) had severe DD and ID (IQ of 23), epilepsy and upon MRI cerebellar hypoplasia. This subject did not exhibit microcephaly. Common facial features incl. broad nose, full cheeks, small philtrum, strabismus, thin upper lips and abnormal jaw. There was no evidence of systemic involvement in both.

ARF3 encodes ADP-ribosylation factor 3. Adenosine diphosphate ribosylation factors (ARFs) are key proteins for regulation of cargo sorting at the Golgi network, with ARF3 mainly working at the trans-Golgi network. ARFs belong to the small GTP-binding protein (G protein) superfamily. ARF3 switches between an active GTP-bound form and an inactive GDP-bound form, regulated by guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) respectively.

Members of the ARF superfamily regulate various aspects of membrane traffic, among others in neurons.

There are 5 homologs of ARF families, divided in 3 classes. ARF3 and ARF1 belong to class I. Monoallelic ARF1 mutations are associated with Periventricular nodular heterotopia 8 (MIM 618185).

In vivo, in vitro and in silico studies for the 2 variants suggest that both impair the Golgi transport system although each variant most likely exerts a different effect (gain-of-function for Arg99Leu vs loss-of-function/dominant-negative for Asp67Val).

This was also reflected in somewhat different phenotype of the subjects with the respective variants. Common features included severe DD, epilepsy and brain abnormalities although Asp67Val was associated with diffuse brain atrophy as well as congenital microcephaly and Arg99Leu with cerebellar hypoplasia.

Evidence to support the effect of each variant include:

Arg99Leu:
Had identical Golgi localization to that of wt
Had increased binding activity with GGA1, a protein recruited by the GTP-bound active form of ARF3 to the TGN membrane (supporting GoF)
In silico structural analysis suggested it may fail to stabilize the conformation of Asp26, resulting in impaired GTP hydrolysis (GoF).
In transgenic fruit flies, evaluation of the ARF3 variant toxicity using the rough eye phenotype this variant was associated with increased severity of the r-e phenotype similar to a previously studied GoF variant (Gln71Leu)

Asp67Val:
Did not show a Golgi-like pattern of localization (similar to Thr31Asn a previously studied dominant-negative variant)
Displayed decreased protein stability
In silico structural analysis suggested that Asp67Val may lead to compromised binding of GTP or GDP (suggestive of LoF)
In transgenic Drosophila eye-specific expression of Asp67Val (similar to Thr31Asn, a known dominant-negative variant) was lethal possibly due to high toxicity in very small amounts in tissues outside the eye.

There is no associated phenotype in OMIM, G2P or SysID.
Sources: Literature
Repeat Disorders v0.51 DM1 Bryony Thompson Marked STR: DM1 as ready
Repeat Disorders v0.51 DM1 Bryony Thompson Str: dm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.51 DM1 Bryony Thompson Classified STR: DM1 as Green List (high evidence)
Repeat Disorders v0.51 DM1 Bryony Thompson Str: dm1 has been classified as Green List (High Evidence).
Repeat Disorders v0.50 DM1 Bryony Thompson STR: DM1 was added
STR: DM1 was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: DM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DM1 were set to 20301344; 29325606
Phenotypes for STR: DM1 were set to Myotonic dystrophy 1 MIM#160900
Review for STR: DM1 was set to GREEN
STR: DM1 was marked as clinically relevant
Added comment: HGVS nomenclature: NM_001081560.2:c.*224_*226CTG[X]
RNA toxic gain of function is mechanism of disease
Premutation: 35-49 repeats, no clinical signs
Mild: 50-~150 repeats, age of onset 20-70 yrs, clinical signs - cataracts, mild myotonia
Classic: ~100-~1,000 repeats, age of onset 10-30 yrs, clinical signs - weakness, myotonia, cataracts, balding, cardiac arrhythmia
Congenital: >1,000 repeats, age of onset birth-10 yrs , clinical signs - infantile hypotonia, respiratory deficits, intellectual disability, classic signs in adults
Sources: Expert list
Repeat Disorders v0.49 FXS Bryony Thompson Marked STR: FXS as ready
Repeat Disorders v0.49 FXS Bryony Thompson Str: fxs has been classified as Green List (High Evidence).
Repeat Disorders v0.49 FXS Bryony Thompson Classified STR: FXS as Green List (high evidence)
Repeat Disorders v0.49 FXS Bryony Thompson Str: fxs has been classified as Green List (High Evidence).
Repeat Disorders v0.48 FXS Bryony Thompson STR: FXS was added
STR: FXS was added to Repeat Disorders. Sources: Expert list
Mode of inheritance for STR: FXS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXS were set to 33795824; 25227148
Phenotypes for STR: FXS were set to Fragile X syndrome MIM#300624
Review for STR: FXS was set to GREEN
STR: FXS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Growth failure v0.139 KDM3B Zornitza Stark Phenotypes for gene: KDM3B were changed from Intellectual disability; short stature to Diets-Jongmans syndrome, MIM# 618846; Intellectual disability; short stature; deafness
Growth failure v0.138 KDM3B Zornitza Stark edited their review of gene: KDM3B: Changed phenotypes: Diets-Jongmans syndrome, MIM# 618846, Intellectual disability, short stature, deafness
Growth failure v0.138 KDM3B Zornitza Stark Marked gene: KDM3B as ready
Growth failure v0.138 KDM3B Zornitza Stark Gene: kdm3b has been classified as Green List (High Evidence).
Growth failure v0.138 KDM3B Zornitza Stark Phenotypes for gene: KDM3B were changed from Behavioral abnormality; Seizures; Global developmental delay; Short stature; Intellectual disability to Intellectual disability; short stature
Growth failure v0.137 KDM3B Zornitza Stark Mode of inheritance for gene: KDM3B was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.136 KDM3B Zornitza Stark Classified gene: KDM3B as Green List (high evidence)
Growth failure v0.136 KDM3B Zornitza Stark Gene: kdm3b has been classified as Green List (High Evidence).
Growth failure v0.135 KDM3B Zornitza Stark reviewed gene: KDM3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 30929739; Phenotypes: Intellectual disability, short stature; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.135 INTS1 Zornitza Stark Marked gene: INTS1 as ready
Growth failure v0.135 INTS1 Zornitza Stark Gene: ints1 has been classified as Green List (High Evidence).
Growth failure v0.135 INTS1 Zornitza Stark Classified gene: INTS1 as Green List (high evidence)
Growth failure v0.135 INTS1 Zornitza Stark Gene: ints1 has been classified as Green List (High Evidence).
Growth failure v0.134 INTS1 Zornitza Stark reviewed gene: INTS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28542170, 30622326, 31428919; Phenotypes: Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies, #MIM:618571, MONDO:0032817; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.134 FOXP4 Zornitza Stark Marked gene: FOXP4 as ready
Growth failure v0.134 FOXP4 Zornitza Stark Gene: foxp4 has been classified as Green List (High Evidence).
Growth failure v0.134 FOXP4 Zornitza Stark Phenotypes for gene: FOXP4 were changed from Neurodevelopmental disorder; multiple congenital abnormalities to Neurodevelopmental disorder; multiple congenital abnormalities; short stature
Growth failure v0.133 FOXP4 Zornitza Stark Mode of inheritance for gene: FOXP4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.132 FOXP4 Zornitza Stark Classified gene: FOXP4 as Green List (high evidence)
Growth failure v0.132 FOXP4 Zornitza Stark Gene: foxp4 has been classified as Green List (High Evidence).
Growth failure v0.131 FOXP4 Zornitza Stark reviewed gene: FOXP4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33110267; Phenotypes: Neurodevelopmental disorder, multiple congenital abnormalities, short stature; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.131 COG4 Zornitza Stark Marked gene: COG4 as ready
Growth failure v0.131 COG4 Zornitza Stark Gene: cog4 has been classified as Green List (High Evidence).
Growth failure v0.131 COG4 Zornitza Stark Phenotypes for gene: COG4 were changed from microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407; Saul-Wilson syndrome, OMIM:618150 to Saul-Wilson syndrome, OMIM:618150; Microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407
Growth failure v0.130 COG4 Zornitza Stark Classified gene: COG4 as Green List (high evidence)
Growth failure v0.130 COG4 Zornitza Stark Gene: cog4 has been classified as Green List (High Evidence).
Growth failure v0.129 COG4 Zornitza Stark edited their review of gene: COG4: Changed mode of pathogenicity: Other
Growth failure v0.129 COG4 Zornitza Stark changed review comment from: 14 individuals reported with DD, skeletal changes, cataracts, and growth retardation (progeriod like). All have a recurrent de novo heterozygous missense variant (p.Gly516Arg).

Please note bi-allelic variants cause CDG.; to: 14 individuals reported with DD, skeletal changes, cataracts, and growth retardation (progeriod like). All have a recurrent de novo heterozygous missense variant (p.Gly516Arg). GoF suggested.

Please note bi-allelic variants cause CDG.
Growth failure v0.129 COG4 Zornitza Stark reviewed gene: COG4: Rating: GREEN; Mode of pathogenicity: None; Publications: 30290151; Phenotypes: Saul-Wilson syndrome, OMIM:618150, Microcephalic osteodysplastic dysplasia, Saul-Wilson type, MONDO:0019407; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.129 TRIP13 Zornitza Stark Marked gene: TRIP13 as ready
Growth failure v0.129 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Growth failure v0.129 TRIP13 Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence)
Growth failure v0.129 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Growth failure v0.128 TRIP13 Zornitza Stark gene: TRIP13 was added
gene: TRIP13 was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: TRIP13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIP13 were set to 28553959
Phenotypes for gene: TRIP13 were set to Mosaic variegated aneuploidy syndrome 3, MIM# 617598
Review for gene: TRIP13 was set to AMBER
Added comment: Autosomal recessive disorder resulting from errors in chromosome segregation. Most affected individuals develop early-onset Wilms tumor and show either aneuploidy or premature chromatid separation in cells. Some patients may have additional developmental features, such as microcephaly, growth retardation, or developmental delay.

6 unrelated families reported, but 5 shared the same homozygous stop variant, p.Arg354X, suggestive of founder effect.
Sources: Expert Review
Growth failure v0.127 BUB1B Zornitza Stark Marked gene: BUB1B as ready
Growth failure v0.127 BUB1B Zornitza Stark Gene: bub1b has been classified as Green List (High Evidence).
Growth failure v0.127 BUB1B Zornitza Stark Classified gene: BUB1B as Green List (high evidence)
Growth failure v0.127 BUB1B Zornitza Stark Gene: bub1b has been classified as Green List (High Evidence).
Growth failure v0.126 BUB1B Zornitza Stark gene: BUB1B was added
gene: BUB1B was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: BUB1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BUB1B were set to 18548531
Phenotypes for gene: BUB1B were set to Mosaic variegated aneuploidy syndrome 1, MIM#257300
Review for gene: BUB1B was set to GREEN
Added comment: Mosaic Variegated Aneuploidy Syndrome (MVA) is a rare autosomal recessive disorder characterized by mosaic aneuploidies involving multiple chromosomes and tissues. Affected individuals typically present with severe intrauterine and postnatal growth retardation, microcephaly, facial dysmorphism, developmental delay and predisposition to cancer and epilepsy.

More than 10 families reported.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.4058 CEP57 Zornitza Stark Marked gene: CEP57 as ready
Intellectual disability syndromic and non-syndromic v0.4058 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.4058 CEP57 Zornitza Stark Phenotypes for gene: CEP57 were changed from to Mosaic variegated aneuploidy syndrome 2, #MIM 614114
Intellectual disability syndromic and non-syndromic v0.4057 CEP57 Zornitza Stark Publications for gene: CEP57 were set to
Intellectual disability syndromic and non-syndromic v0.4056 CEP57 Zornitza Stark Mode of inheritance for gene: CEP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4055 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266, 32861809, 30147898; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8828 CEP57 Zornitza Stark Marked gene: CEP57 as ready
Mendeliome v0.8828 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Mendeliome v0.8828 CEP57 Zornitza Stark Phenotypes for gene: CEP57 were changed from to Mosaic variegated aneuploidy syndrome 2, #MIM 614114
Mendeliome v0.8827 CEP57 Zornitza Stark Publications for gene: CEP57 were set to
Mendeliome v0.8826 CEP57 Zornitza Stark Mode of inheritance for gene: CEP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8825 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266, 32861809, 30147898; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.125 CEP57 Zornitza Stark edited their review of gene: CEP57: Changed publications: 24259107, 21552266, 32861809, 30147898
Growth failure v0.125 CEP57 Zornitza Stark Marked gene: CEP57 as ready
Growth failure v0.125 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Growth failure v0.125 CEP57 Zornitza Stark Classified gene: CEP57 as Green List (high evidence)
Growth failure v0.125 CEP57 Zornitza Stark Gene: cep57 has been classified as Green List (High Evidence).
Growth failure v0.124 CEP57 Zornitza Stark Phenotypes for gene: CEP57 were changed from Mosaic variegated aneuploidy syndrome 2, 614114 to Mosaic variegated aneuploidy syndrome 2, MIM#614114
Growth failure v0.123 CEP57 Zornitza Stark Publications for gene: CEP57 were set to 24259107; 21552266
Growth failure v0.122 CEP57 Zornitza Stark Deleted their comment
Growth failure v0.122 CEP57 Zornitza Stark edited their review of gene: CEP57: Added comment: Mosaic Variegated Aneuploidy Syndrome (MVA) is a rare autosomal recessive disorder characterized by mosaic aneuploidies involving multiple chromosomes and tissues. Affected individuals typically present with severe intrauterine and postnatal growth retardation, microcephaly, facial dysmorphism, developmental delay and predisposition to cancer and epilepsy.; Changed publications: 24259107, 21552266, 32861809
Growth failure v0.122 CEP57 Zornitza Stark reviewed gene: CEP57: Rating: GREEN; Mode of pathogenicity: None; Publications: 24259107, 21552266; Phenotypes: Mosaic variegated aneuploidy syndrome 2, #MIM 614114; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.122 Zornitza Stark removed gene:CCDC186 from the panel
Growth failure v0.121 ANAPC1 Zornitza Stark Marked gene: ANAPC1 as ready
Growth failure v0.121 ANAPC1 Zornitza Stark Gene: anapc1 has been classified as Green List (High Evidence).
Ectodermal Dysplasia v0.55 ANAPC1 Zornitza Stark Phenotypes for gene: ANAPC1 were changed from Rothmund-Thomson syndrome, type 1 MIM#618625 to Rothmund-Thomson syndrome, type 1 MIM#618625; MONDO:0016368
Ectodermal Dysplasia v0.54 ANAPC1 Zornitza Stark Tag deep intronic tag was added to gene: ANAPC1.
Ectodermal Dysplasia v0.54 ANAPC1 Zornitza Stark reviewed gene: ANAPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31303264; Phenotypes: Rothmund Thomson syndrome type 1, #MIM:618625, MONDO:0016368; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.121 ANAPC1 Zornitza Stark Tag deep intronic tag was added to gene: ANAPC1.
Growth failure v0.121 ANAPC1 Zornitza Stark Classified gene: ANAPC1 as Green List (high evidence)
Growth failure v0.121 ANAPC1 Zornitza Stark Gene: anapc1 has been classified as Green List (High Evidence).
Growth failure v0.120 ANAPC1 Zornitza Stark reviewed gene: ANAPC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31303264; Phenotypes: Rothmund-Thomson syndrome, type 1, MIM# 618625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Growth failure v0.120 FANCM Zornitza Stark Marked gene: FANCM as ready
Growth failure v0.120 FANCM Zornitza Stark Gene: fancm has been classified as Red List (Low Evidence).
Growth failure v0.120 FANCM Zornitza Stark Phenotypes for gene: FANCM were changed from Fanconi anemia, complementation group M, 614087; Fanconi anemia; Fanconi Anemia to Fanconi anaemia
Growth failure v0.119 SMC3 Zornitza Stark Marked gene: SMC3 as ready
Growth failure v0.119 SMC3 Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence).
Growth failure v0.119 SMC3 Zornitza Stark Phenotypes for gene: SMC3 were changed from Cornelia De Lange to Cornelia de Lange syndrome 3, MIM# 610759
Growth failure v0.118 SMC3 Zornitza Stark Publications for gene: SMC3 were set to
Growth failure v0.117 SMC3 Zornitza Stark Classified gene: SMC3 as Green List (high evidence)
Growth failure v0.117 SMC3 Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence).
Growth failure v0.116 SMC3 Zornitza Stark reviewed gene: SMC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 25125236, 25655089; Phenotypes: Cornelia de Lange syndrome 3, MIM# 610759; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.116 SOX3 Zornitza Stark Marked gene: SOX3 as ready
Growth failure v0.116 SOX3 Zornitza Stark Gene: sox3 has been classified as Red List (Low Evidence).
Growth failure v0.116 SOX3 Zornitza Stark Phenotypes for gene: SOX3 were changed from Panhypopituitarism, X-linked, OMIM:312000; Mental retardation, X-linked, with isolated growth hormone deficiency, OMIM:300123; Panhypopituitarism, X-linked, MONDO:0010712; Intellectual disability, X-linked, with panhypopituitarism, MONDO:0010252 to Mental retardation, X-linked, with isolated growth hormone deficiency, MIM#300123; Panhypopituitarism, X-linked, MIM#312000
Growth failure v0.115 SOX3 Zornitza Stark Publications for gene: SOX3 were set to 15800844
Growth failure v0.114 SOX3 Zornitza Stark Mode of inheritance for gene: SOX3 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.113 SOX3 Zornitza Stark Tag SV/CNV tag was added to gene: SOX3.
Growth failure v0.113 SOX3 Zornitza Stark reviewed gene: SOX3: Rating: RED; Mode of pathogenicity: None; Publications: 29175558, 30125608, 12428212, 15800844; Phenotypes: Mental retardation, X-linked, with isolated growth hormone deficiency, MIM#300123, Panhypopituitarism, X-linked, MIM#312000; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.113 SOX2 Zornitza Stark Marked gene: SOX2 as ready
Growth failure v0.113 SOX2 Zornitza Stark Gene: sox2 has been classified as Green List (High Evidence).
Growth failure v0.113 SOX2 Zornitza Stark Phenotypes for gene: SOX2 were changed from to Microphthalmia, syndromic 3, MIM# 206900
Growth failure v0.112 SOX2 Zornitza Stark Publications for gene: SOX2 were set to
Growth failure v0.111 SOX2 Zornitza Stark Classified gene: SOX2 as Green List (high evidence)
Growth failure v0.111 SOX2 Zornitza Stark Gene: sox2 has been classified as Green List (High Evidence).
Growth failure v0.110 SOX2 Zornitza Stark reviewed gene: SOX2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15812812, 16543359, 16932809,; Phenotypes: Microphthalmia, syndromic 3, MIM# 206900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Growth failure v0.110 ERCC8 Zornitza Stark edited their review of gene: ERCC8: Changed phenotypes: Cockayne syndrome, type A, MIM# 216400, MONDO:0019569
Growth failure v0.110 ERCC8 Zornitza Stark Marked gene: ERCC8 as ready
Growth failure v0.110 ERCC8 Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence).
Growth failure v0.110 ERCC8 Zornitza Stark Phenotypes for gene: ERCC8 were changed from cockayne to Cockayne syndrome, type A, MIM# 216400; MONDO:0019569
Growth failure v0.109 ERCC8 Zornitza Stark Publications for gene: ERCC8 were set to
Growth failure v0.108 ERCC8 Zornitza Stark Classified gene: ERCC8 as Green List (high evidence)
Growth failure v0.108 ERCC8 Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence).
Growth failure v0.107 ERCC6 Zornitza Stark Marked gene: ERCC6 as ready
Growth failure v0.107 ERCC6 Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence).
Growth failure v0.107 ERCC6 Zornitza Stark Phenotypes for gene: ERCC6 were changed from Cockayne syndrome, type B, 133540 to Cerebrooculofacioskeletal syndrome 1, MIM# 214150; MONDO:0008955; Cockayne syndrome, type B, MIM# 133540; MONDO:0019570
Growth failure v0.106 ERCC6 Zornitza Stark changed review comment from: Well established gene-disease association, spectrum of severity.; to: Well established gene-disease association, spectrum of severity. Marked short stature is a feature.
Growth failure v0.106 ERCC6 Zornitza Stark edited their review of gene: ERCC6: Changed phenotypes: Cerebrooculofacioskeletal syndrome 1, MIM# 214150, MONDO:0008955, Cockayne syndrome, type B, MIM# 133540, MONDO:0019570
Growth failure v0.106 ERCC6 Zornitza Stark Classified gene: ERCC6 as Green List (high evidence)
Growth failure v0.106 ERCC6 Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence).
Growth failure v0.105 LIG4 Zornitza Stark Marked gene: LIG4 as ready
Growth failure v0.105 LIG4 Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence).
Growth failure v0.105 LIG4 Zornitza Stark Phenotypes for gene: LIG4 were changed from microcephaly, growth retardation, immunodeficiency, developmental delay to LIG4 syndrome, MIM# 606593; microcephaly, growth retardation, immunodeficiency, developmental delay
Growth failure v0.104 LIG4 Zornitza Stark Publications for gene: LIG4 were set to 11779494, 16088910,
Growth failure v0.103 LIG4 Zornitza Stark Classified gene: LIG4 as Green List (high evidence)
Growth failure v0.103 LIG4 Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence).
Growth failure v0.102 STAT5B Zornitza Stark Marked gene: STAT5B as ready
Growth failure v0.102 STAT5B Zornitza Stark Gene: stat5b has been classified as Green List (High Evidence).
Growth failure v0.102 STAT5B Zornitza Stark Phenotypes for gene: STAT5B were changed from to Growth hormone insensitivity with immune dysregulation 1, autosomal recessive, MIM# 245590; Growth hormone insensitivity with immune dysregulation 2, autosomal dominant, MIM# 618985
Growth failure v0.101 STAT5B Zornitza Stark Publications for gene: STAT5B were set to
Growth failure v0.100 STAT5B Zornitza Stark Classified gene: STAT5B as Green List (high evidence)
Growth failure v0.100 STAT5B Zornitza Stark Gene: stat5b has been classified as Green List (High Evidence).
Growth failure v0.99 STAT5B Zornitza Stark reviewed gene: STAT5B: Rating: GREEN; Mode of pathogenicity: None; Publications: 13679528, 15827093, 16787985, 17389811, 29844444; Phenotypes: Growth hormone insensitivity with immune dysregulation 1, autosomal recessive, MIM# 245590, Growth hormone insensitivity with immune dysregulation 2, autosomal dominant, MIM# 618985; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Growth failure v0.99 TBCE Zornitza Stark Marked gene: TBCE as ready
Growth failure v0.99 TBCE Zornitza Stark Gene: tbce has been classified as Green List (High Evidence).
Growth failure v0.99 TBCE Zornitza Stark Phenotypes for gene: TBCE were changed from to Kenny-Caffey syndrome, type 1, MIM# 244460; Hypoparathyroidism-retardation-dysmorphism syndrome, MIM# 241410, Sanjad-Sakati syndrome
Growth failure v0.98 TBCE Zornitza Stark Publications for gene: TBCE were set to
Growth failure v0.97 TBCE Zornitza Stark Classified gene: TBCE as Green List (high evidence)
Growth failure v0.97 TBCE Zornitza Stark Gene: tbce has been classified as Green List (High Evidence).
Growth failure v0.96 TBCE Zornitza Stark reviewed gene: TBCE: Rating: GREEN; Mode of pathogenicity: None; Publications: 12389028, 26029652, 33010201, 30638765; Phenotypes: Kenny-Caffey syndrome, type 1, MIM# 244460, Hypoparathyroidism-retardation-dysmorphism syndrome, MIM# 241410, Sanjad-Sakati syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8825 PLXNA2 Zornitza Stark Marked gene: PLXNA2 as ready
Mendeliome v0.8825 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8825 PLXNA2 Zornitza Stark Classified gene: PLXNA2 as Amber List (moderate evidence)
Mendeliome v0.8825 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8824 PLXNA2 Zornitza Stark gene: PLXNA2 was added
gene: PLXNA2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNA2 were set to 34327814
Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology
Review for gene: PLXNA2 was set to AMBER
Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants.

The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members.

Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)).

Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed).

The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed).

Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved.

Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele.

As the authors discuss:
*PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration.
*Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch.
*Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD.
*Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus.

Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg:
- Cyanotic heart disease explaining discordance in cognitive outcome among sibs
- Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or
- Additional pathogenic variants possibly explaining the CHD in the first subject.

There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Marked gene: PLXNA2 as ready
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Classified gene: PLXNA2 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4055 PLXNA2 Zornitza Stark Gene: plxna2 has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.7 SLC51A Zornitza Stark Marked gene: SLC51A as ready
Congenital Diarrhoea v1.7 SLC51A Zornitza Stark Gene: slc51a has been classified as Red List (Low Evidence).
Congenital Diarrhoea v1.7 SLC51A Zornitza Stark gene: SLC51A was added
gene: SLC51A was added to Congenital Diarrhoea. Sources: Literature
Mode of inheritance for gene: SLC51A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51A were set to 31863603
Phenotypes for gene: SLC51A were set to Cholestasis, progressive familial intrahepatic, 6, MIM# 619484
Review for gene: SLC51A was set to RED
Added comment: Single individual reported with homozygous LoF variant, who presented with chronic malabsorptive diarrhoea, easy bruising, episodes of prolonged bleeding that required blood transfusions, and failure to thrive. Laboratory testing at age 2.5 years showed elevated liver transaminases and alkaline phosphatase. Liver biopsy demonstrated portal and periportal fibrosis and hepatocytes with foci of hepatocytic cholestasis. Analysis of bile acids in a blood spot were normal. Treatment with ursodiol and cholestyramine was started at 5 years of age. The coagulopathy resolved and his growth was adequate, but his liver transaminases, direct bilirubin, and GGT levels remained elevated.
Sources: Literature
Mendeliome v0.8823 SLC51A Zornitza Stark Marked gene: SLC51A as ready
Mendeliome v0.8823 SLC51A Zornitza Stark Gene: slc51a has been classified as Red List (Low Evidence).
Mendeliome v0.8823 SLC51A Zornitza Stark gene: SLC51A was added
gene: SLC51A was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SLC51A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51A were set to 31863603
Phenotypes for gene: SLC51A were set to Cholestasis, progressive familial intrahepatic, 6, MIM# 619484
Review for gene: SLC51A was set to RED
Added comment: Single individual reported with homozygous LoF variant, who presented with chronic malabsorptive diarrhoea, easy bruising, episodes of prolonged bleeding that required blood transfusions, and failure to thrive. Laboratory testing at age 2.5 years showed elevated liver transaminases and alkaline phosphatase. Liver biopsy demonstrated portal and periportal fibrosis and hepatocytes with foci of hepatocytic cholestasis. Analysis of bile acids in a blood spot were normal. Treatment with ursodiol and cholestyramine was started at 5 years of age. The coagulopathy resolved and his growth was adequate, but his liver transaminases, direct bilirubin, and GGT levels remained elevated.
Sources: Literature
Cholestasis v0.203 SLC51A Zornitza Stark Marked gene: SLC51A as ready
Cholestasis v0.203 SLC51A Zornitza Stark Gene: slc51a has been classified as Red List (Low Evidence).
Cholestasis v0.203 SLC51A Zornitza Stark gene: SLC51A was added
gene: SLC51A was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: SLC51A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51A were set to 31863603
Phenotypes for gene: SLC51A were set to Cholestasis, progressive familial intrahepatic, 6, MIM# 619484
Review for gene: SLC51A was set to RED
Added comment: Single individual reported with homozygous LoF variant, who presented with chronic malabsorptive diarrhoea, easy bruising, episodes of prolonged bleeding that required blood transfusions, and failure to thrive. Laboratory testing at age 2.5 years showed elevated liver transaminases and alkaline phosphatase. Liver biopsy demonstrated portal and periportal fibrosis and hepatocytes with foci of hepatocytic cholestasis. Analysis of bile acids in a blood spot were normal. Treatment with ursodiol and cholestyramine was started at 5 years of age. The coagulopathy resolved and his growth was adequate, but his liver transaminases, direct bilirubin, and GGT levels remained elevated.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4054 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Intellectual disability syndromic and non-syndromic v0.4053 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Callosome v0.310 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Callosome v0.309 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Mendeliome v0.8822 SUPT16H Zornitza Stark Phenotypes for gene: SUPT16H were changed from Intellectual disability; Abnormality of the corpus callosum to Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480; Intellectual disability; Abnormality of the corpus callosum
Mendeliome v0.8821 SUPT16H Zornitza Stark edited their review of gene: SUPT16H: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480, Intellectual disability, Abnormality of the corpus callosum
Early-onset Parkinson disease v0.110 FMR1 Bryony Thompson Phenotypes for gene: FMR1 were changed from to Fragile X tremor/ataxia syndrome MIM#300623; Fragile X syndrome MIM#300624
Early-onset Parkinson disease v0.109 FMR1 Bryony Thompson Publications for gene: FMR1 were set to
Early-onset Parkinson disease v0.108 FMR1 Bryony Thompson Mode of inheritance for gene: FMR1 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Intellectual disability syndromic and non-syndromic v0.4053 PLXNA2 Konstantinos Varvagiannis gene: PLXNA2 was added
gene: PLXNA2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature,Other
Mode of inheritance for gene: PLXNA2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLXNA2 were set to 34327814
Phenotypes for gene: PLXNA2 were set to Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology
Penetrance for gene: PLXNA2 were set to Incomplete
Review for gene: PLXNA2 was set to AMBER
Added comment: Altuame et al (2021 - PMID: 34327814) describe 3 individuals from 2 consanguineous Arab families with biallelic PLXNA2 variants.

The index patient from the 1st family presented with CHD (hypoplastic right ventricle, ASD), DD and moderate ID (IQ of 40), failure to thrive as well as some dysmorphic features (obtuse mandibular angle, mild overbite, synophrys with downslanting p-f, strabismus, etc). There were additional features (eg. postaxial polydactyly) which were found in other affected and unaffected family members.

Exome sequencing with autozygome analysis revealed homozygosity for a PLXNA2 stopgain variant (NM_025179:c.3603C>A / p.(Cys1201*)).

Sanger confirmation was carried out and segregation analyses confirmed carrier status of the unaffected parents and a sib as well as a brother homozygous for the same variant. Clinical evaluation of the latter, following this finding revealed borderline intellectual functioning, ADHD, failure to thrive. There was no mandibular anomaly or overbite and no clinical evidence of CHD (no echo performed).

The index patient from the 2nd consanguineous family was evaluated for ID (IQ of 63), with previous borderline motor development, ADHD and some dysmorphic features (obtuse mandibular angle and overbite). There was no clinical evidence of CHD (no echo performed).

Exome sequencing with autozygosity mapping revealed a homozygous missense PLXNA2 variant (c.3073G>A / p.(Asp1025Asn), present only once in gnomAD (htz), with rather non-concordant in silico predictions SIFT 0.22, PolyPhen 0.682 and CADD 23.5. The aa was however highly conserved.

Segregation analysis confirmed carrier state of the parents and 2 unaffected sibs, with a 3rd sib homozygous for the wt allele.

As the authors discuss:
*PLXNA2 belongs to the plexin family of genes, encoding transmbembrane proteins functioning as semaphorin receptors. It has predominant expression in neural tissue. The protein is thought to bind semaphorin-3A, -3C or -5 followed by plexin A2 dimerization, activation of its GTPase-activating protein domain, negative regulation of Rap1B GTPase and initiation of a signal transduction cascade mediating axonal repulsion/guidance, dendritic guidance, neuronal migration.
*Murine Plxna2 knockout models display structural brain defects. In addition they display congenital heart defects incl. persistent truncus arteriosus and interrupted aortic arch.
*Rare CNVs in adult humans with tetralogy of Fallot have suggested a potential role of PLXNA2 in cardiac development and CHD.
*Expression and the role of PLXNA2 in human chondrocytes as well as a GWAS in 240 japanese patients with mandibular prognathism where PLXNA2 was suggested as a susceptibility locus.

Overall, the authors recognize some common features (as for cognitive functioning, some dysmorphic features incl. obtuse mandibular angle and overbite in 2 unrelated subjects, failure to thrive 3/3) and provide plausible explanations for the variability / discordance of others eg:
- Cyanotic heart disease explaining discordance in cognitive outcome among sibs
- Incomplete penetrance for CHD (and/or ID or mandibular anomaly) as for few AR disorders and/or
- Additional pathogenic variants possibly explaining the CHD in the first subject.

There is no associated phenotype in OMIM or G2P. SysID includes PLXNA2 among the candidate ID genes.
Sources: Literature, Other
Growth failure v0.96 Zornitza Stark removed gene:THRB from the panel
Growth failure v0.95 Zornitza Stark removed gene:IGFBP3 from the panel
Growth failure v0.94 Zornitza Stark removed gene:IGFBP1 from the panel
Growth failure v0.93 MRAS Zornitza Stark Marked gene: MRAS as ready
Growth failure v0.93 MRAS Zornitza Stark Gene: mras has been classified as Green List (High Evidence).
Growth failure v0.93 MRAS Zornitza Stark Mode of pathogenicity for gene: MRAS was changed from None to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Growth failure v0.92 MRAS Zornitza Stark Classified gene: MRAS as Green List (high evidence)
Growth failure v0.92 MRAS Zornitza Stark Gene: mras has been classified as Green List (High Evidence).
Growth failure v0.91 MRAS Zornitza Stark gene: MRAS was added
gene: MRAS was added to Growth failure in early childhood. Sources: Expert Review
Mode of inheritance for gene: MRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MRAS were set to 28289718; 31173466; 31108500; 31173466
Phenotypes for gene: MRAS were set to Noonan syndrome 11, MIM#618499
Review for gene: MRAS was set to GREEN
Added comment: At least 6 unrelated individuals reported.
Sources: Expert Review
Pituitary hormone deficiency v0.13 BTK Zornitza Stark Marked gene: BTK as ready
Pituitary hormone deficiency v0.13 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Pituitary hormone deficiency v0.13 BTK Zornitza Stark reviewed gene: BTK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8013627, 7849697, 9554752; Phenotypes: Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.90 BTK Zornitza Stark Publications for gene: BTK were set to 8013627; 7849697
Growth failure v0.89 BTK Zornitza Stark changed review comment from: At least 3 families reported with GH deficiency plus agammaglobulinaemia.; to: At least 4 families reported with GH deficiency plus agammaglobulinaemia.
Growth failure v0.89 BTK Zornitza Stark edited their review of gene: BTK: Changed publications: 8013627, 7849697, 9554752
Growth failure v0.89 BTK Zornitza Stark Marked gene: BTK as ready
Growth failure v0.89 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Growth failure v0.89 BTK Zornitza Stark Phenotypes for gene: BTK were changed from to Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200
Growth failure v0.88 BTK Zornitza Stark Publications for gene: BTK were set to
Growth failure v0.87 BTK Zornitza Stark Mode of inheritance for gene: BTK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Growth failure v0.86 BTK Zornitza Stark Classified gene: BTK as Green List (high evidence)
Growth failure v0.86 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Growth failure v0.85 BTK Zornitza Stark reviewed gene: BTK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8013627, 7849697; Phenotypes: Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Predominantly Antibody Deficiency v0.89 BTK Zornitza Stark Marked gene: BTK as ready
Predominantly Antibody Deficiency v0.89 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.89 BTK Zornitza Stark Phenotypes for gene: BTK were changed from to Agammaglobulinaemia, X-linked 1, MIM# 300755; Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200
Predominantly Antibody Deficiency v0.88 BTK Zornitza Stark Publications for gene: BTK were set to
Predominantly Antibody Deficiency v0.87 BTK Zornitza Stark Mode of inheritance for gene: BTK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Predominantly Antibody Deficiency v0.86 BTK Zornitza Stark reviewed gene: BTK: Rating: GREEN; Mode of pathogenicity: None; Publications: 8013627, 7849697; Phenotypes: Agammaglobulinaemia, X-linked 1, MIM# 300755, Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.8821 MOCOS Zornitza Stark Marked gene: MOCOS as ready
Mendeliome v0.8821 MOCOS Zornitza Stark Gene: mocos has been classified as Green List (High Evidence).
Mendeliome v0.8821 MOCOS Zornitza Stark Phenotypes for gene: MOCOS were changed from to Xanthinuria type II, MIM#603592
Mendeliome v0.8820 MOCOS Zornitza Stark Publications for gene: MOCOS were set to
Mendeliome v0.8819 MOCOS Zornitza Stark Mode of inheritance for gene: MOCOS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8818 MOCOS Zornitza Stark reviewed gene: MOCOS: Rating: GREEN; Mode of pathogenicity: None; Publications: 11302742, 17368066, 14624414, 25967871, 34356852, 32073534, 30758870, 27919260; Phenotypes: Xanthinuria type II, MIM#603592; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8818 HNMT Zornitza Stark Marked gene: HNMT as ready
Mendeliome v0.8818 HNMT Zornitza Stark Gene: hnmt has been classified as Green List (High Evidence).
Mendeliome v0.8818 HNMT Zornitza Stark Phenotypes for gene: HNMT were changed from to Mental retardation, autosomal recessive 51, MIM#616739
Mendeliome v0.8817 HNMT Zornitza Stark Publications for gene: HNMT were set to
Mendeliome v0.8816 HNMT Zornitza Stark Mode of inheritance for gene: HNMT was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8815 HNMT Zornitza Stark reviewed gene: HNMT: Rating: GREEN; Mode of pathogenicity: None; Publications: 26206890, 30744146, 33310825, 33739554; Phenotypes: Mental retardation, autosomal recessive 51, MIM#616739; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.4053 HNMT Zornitza Stark Publications for gene: HNMT were set to 26206890; 30744146
Intellectual disability syndromic and non-syndromic v0.4052 HNMT Zornitza Stark edited their review of gene: HNMT: Added comment: Verhoeven et al. 2020 (PMID: 33310825) report an adult male patient with severe intellectual disability and autism, born to second cousins, with a homozygous nonsense variant (c.88C>T; p.Gln30*). Treatment with antihistaminergic medication and a histamine-restricted diet resulted in significant general improvement, supporting an etiological role for HNMT deficiency. Taskiran et al. 2021 (PMID: 33739554) report an adult male patient with severe intellectual disability, pervasive developmental disorder and ADHD, born to consanguineous parents, with a homozygous nonsense variant (c.100G>T; p.Glu34*).; Changed publications: 26206890, 30744146, 33310825, 33739554
Predominantly Antibody Deficiency v0.86 BLNK Zornitza Stark Marked gene: BLNK as ready
Predominantly Antibody Deficiency v0.86 BLNK Zornitza Stark Gene: blnk has been classified as Green List (High Evidence).
Mendeliome v0.8815 BLNK Zornitza Stark Marked gene: BLNK as ready
Mendeliome v0.8815 BLNK Zornitza Stark Gene: blnk has been classified as Green List (High Evidence).
Mendeliome v0.8815 BLNK Zornitza Stark Phenotypes for gene: BLNK were changed from to Agammaglobulinaemia 4, MIM# 613502
Mendeliome v0.8814 BLNK Zornitza Stark Publications for gene: BLNK were set to
Mendeliome v0.8813 BLNK Zornitza Stark Mode of inheritance for gene: BLNK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.86 BLNK Zornitza Stark Phenotypes for gene: BLNK were changed from to Agammaglobulinaemia 4, MIM# 613502
Mendeliome v0.8812 BLNK Zornitza Stark reviewed gene: BLNK: Rating: GREEN; Mode of pathogenicity: None; Publications: 10583958, 32194234, 25893637; Phenotypes: Agammaglobulinaemia 4, MIM# 613502; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.85 BLNK Zornitza Stark Publications for gene: BLNK were set to
Predominantly Antibody Deficiency v0.84 BLNK Zornitza Stark Mode of inheritance for gene: BLNK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.83 BLNK Zornitza Stark edited their review of gene: BLNK: Changed phenotypes: Agammaglobulinaemia 4, MIM# 613502
Predominantly Antibody Deficiency v0.83 BLNK Zornitza Stark edited their review of gene: BLNK: Changed rating: GREEN
Predominantly Antibody Deficiency v0.83 BLNK Zornitza Stark reviewed gene: BLNK: Rating: ; Mode of pathogenicity: None; Publications: 10583958, 32194234, 25893637; Phenotypes: Agammaglobulinemia 4, MIM# 613502; Mode of inheritance: None
Mendeliome v0.8812 AICDA Zornitza Stark Marked gene: AICDA as ready
Mendeliome v0.8812 AICDA Zornitza Stark Gene: aicda has been classified as Green List (High Evidence).
Mendeliome v0.8812 AICDA Zornitza Stark Phenotypes for gene: AICDA were changed from to Immunodeficiency with hyper-IgM, type 2, MIM# 605258
Mendeliome v0.8811 AICDA Zornitza Stark Publications for gene: AICDA were set to
Mendeliome v0.8810 AICDA Zornitza Stark Mode of inheritance for gene: AICDA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.8809 AICDA Zornitza Stark reviewed gene: AICDA: Rating: GREEN; Mode of pathogenicity: None; Publications: 11007475; Phenotypes: Immunodeficiency with hyper-IgM, type 2, MIM# 605258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.83 AICDA Zornitza Stark Marked gene: AICDA as ready
Predominantly Antibody Deficiency v0.83 AICDA Zornitza Stark Gene: aicda has been classified as Green List (High Evidence).
Predominantly Antibody Deficiency v0.83 AICDA Zornitza Stark Phenotypes for gene: AICDA were changed from to Immunodeficiency with hyper-IgM, type 2, MIM# 605258
Predominantly Antibody Deficiency v0.82 AICDA Zornitza Stark Publications for gene: AICDA were set to
Predominantly Antibody Deficiency v0.81 AICDA Zornitza Stark Mode of inheritance for gene: AICDA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Predominantly Antibody Deficiency v0.80 AICDA Zornitza Stark reviewed gene: AICDA: Rating: GREEN; Mode of pathogenicity: None; Publications: 11007475; Phenotypes: Immunodeficiency with hyper-IgM, type 2, MIM# 605258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cholestasis v0.202 SLC51B Zornitza Stark Marked gene: SLC51B as ready
Cholestasis v0.202 SLC51B Zornitza Stark Gene: slc51b has been classified as Red List (Low Evidence).
Cholestasis v0.202 SLC51B Zornitza Stark gene: SLC51B was added
gene: SLC51B was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: SLC51B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC51B were set to 28898457
Phenotypes for gene: SLC51B were set to Bile acid malabsorption, primary, 2, MIM# 619481; Congenital diarrhoea; Cholestasis
Review for gene: SLC51B was set to RED
Added comment: Two siblings reported with homozygous LOF variant in this gene and congenital diarrhoea/cholestasis.
Sources: Literature
Mendeliome v0.8809 SLC51B Zornitza Stark Phenotypes for gene: SLC51B were changed from Congenital diarrhoea; Cholestasis to Bile acid malabsorption, primary, 2, MIM# 619481; Congenital diarrhoea; Cholestasis
Mendeliome v0.8808 SLC51B Zornitza Stark edited their review of gene: SLC51B: Changed phenotypes: Bile acid malabsorption, primary, 2, MIM# 619481, Congenital diarrhoea, Cholestasis
Congenital Diarrhoea v1.6 SLC51B Zornitza Stark Phenotypes for gene: SLC51B were changed from Congenital diarrhoea; Cholestasis to Bile acid malabsorption, primary, 2, MIM# 619481; Congenital diarrhoea; Cholestasis
Congenital Diarrhoea v1.5 SLC51B Zornitza Stark edited their review of gene: SLC51B: Changed phenotypes: Bile acid malabsorption, primary, 2, MIM# 619481, Congenital diarrhoea, Cholestasis
Microcephaly v1.40 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Microcephaly v1.40 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.40 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Microcephaly v1.40 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.39 VPS50 Zornitza Stark gene: VPS50 was added
gene: VPS50 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.
Sources: Literature
Cholestasis v0.201 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Cholestasis v0.201 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Cholestasis v0.201 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Cholestasis v0.201 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Cholestasis v0.200 VPS50 Zornitza Stark gene: VPS50 was added
gene: VPS50 was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.
Sources: Literature
Mendeliome v0.8808 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Mendeliome v0.8808 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8808 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Mendeliome v0.8808 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.8807 VPS50 Zornitza Stark gene: VPS50 was added
gene: VPS50 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.
Sources: Literature
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Genetic Epilepsy v0.1169 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Marked gene: VPS50 as ready
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Classified gene: VPS50 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.4052 VPS50 Zornitza Stark Gene: vps50 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.1168 VPS50 Konstantinos Varvagiannis gene: VPS50 was added
gene: VPS50 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Penetrance for gene: VPS50 were set to Complete
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.

Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.4051 VPS50 Konstantinos Varvagiannis gene: VPS50 was added
gene: VPS50 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: VPS50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS50 were set to 34037727
Phenotypes for gene: VPS50 were set to Neonatal cholestatic liver disease; Failure to thrive; Profound global developmental delay; Postnatal microcephaly; Seizures; Abnormality of the corpus callosum
Penetrance for gene: VPS50 were set to Complete
Review for gene: VPS50 was set to AMBER
Added comment: Schneeberger et al (2021 - PMID: 34037727) describe the phenotype of 2 unrelated individuals with biallelic VPS50 variants.

Common features included transient neonatal cholestasis, failure to thrive, severe DD with failure to achieve milestones (last examination at 2y and 2y2m respectively), postnatal microcephaly, seizures (onset at 6m and 25m) and irritability. There was corpus callosum hypoplasia on brain imaging.

Both individuals were homozygous for variants private to each family (no/not known consanguinity applying to each case). The first individual was homozygous for a splicing variant (NM_017667.4:c.1978-1G>T) and had a similarly unaffected sister deceased with no available DNA for testing. The other individual was homozygous for an in-frame deletion (c.1823_1825delCAA / p.(Thr608del)).

VPS50 encodes a critical component of the endosome-associated recycling protein (EARP) complex, which functions in recycling endocytic vesicles back to the plasma membrane [OMIM based on Schindler et al]. The complex contains VPS50, VPS51, VPS52, VPS53, the three latter also being components of GARP (Golgi-associated-retrograde protein) complex. GARP contains VPS54 instead of VPS50 and is required for trafficking of proteins to the trans-golgi network. Thus VPS50 (also named syndetin) and VPS54 function in the EARP and GARP complexes, to define directional movement of their endocytic vesicles [OMIM based on Schindler et al]. The VPS50 subunit is required for recycling of the transferrin receptor.

As discussed by Schneeberger et al (refs provided in text):
- VPS50 has a high expression in mouse and human brain as well as throughout mouse brain development.
- Mice deficient for Vps50 have not been reported. vps50 knockdown in zebrafish results in severe developmental defects of the body axis. Knockout mice for other proteins of the EARP/GARP complex (e.g. Vps52, 53 and 54) display embryonic lethality.

Studies performed by Schneeberger et al included:
- Transcript analysis for the 1st variant demonstrated skipping of ex21 (in patient derived fabriblasts) leading to an in frame deletion of 81 bp (r.1978_2058del) with predicted loss of 27 residues (p.Leu660_Leu686del).
- Similar VPS50 mRNA levels but significant reduction of protein levels (~5% and ~8% of controls) were observed in fibroblasts from patients 1 and 2. Additionally, significant reductions in the amounts of VPS52 and VPS53 protein levels were observed despite mRNA levels similar to controls. Overall, this suggested drastic reduction of functional EARP complex levels.
- Lysosomes appeared to have similar morphology, cellular distribution and likely unaffected function in patient fibroblasts.
- Transferrin receptor recycling was shown to be delayed in patient fibroblasts suggestive of compromise of endocytic-recycling function.

As the authors comment, the phenotype of both individuals with biallelic VPS50 variants overlaps with the corresponding phenotype reported in 15 subjects with biallelic VPS53 or VPS51 mutations notably, severe DD/ID, microcephaly and early onset epilepsy, CC anomalies. Overall, for this group, they propose the term "GARP and/or EARP deficiency disorders".

There is no VPS50-associated phenotype in OMIM or G2P. SysID includes VPS50 among the ID candidate genes.

Consider inclusion in other relevant gene panels (e.g. for neonatal cholestasis, epilepsy, microcephaly, growth failure in early infancy, corpus callosum anomalies, etc) with amber rating pending further reports.
Sources: Literature
Amelogenesis imperfecta v1.0 Zornitza Stark promoted panel to version 1.0
Amelogenesis imperfecta v0.72 SMARCD2 Zornitza Stark Marked gene: SMARCD2 as ready
Amelogenesis imperfecta v0.72 SMARCD2 Zornitza Stark Gene: smarcd2 has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.72 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Amelogenesis imperfecta v0.71 Zornitza Stark removed gene:TUFT1 from the panel
Amelogenesis imperfecta v0.70 TP63 Zornitza Stark Marked gene: TP63 as ready
Amelogenesis imperfecta v0.70 TP63 Zornitza Stark Gene: tp63 has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.70 TP63 Zornitza Stark Phenotypes for gene: TP63 were changed from Split hand-split foot-ectodermal dysplasia and amelogenesis imperfecta to Split-hand/foot malformation 4, MIM# 605289
Amelogenesis imperfecta v0.69 TP63 Zornitza Stark Publications for gene: TP63 were set to
Amelogenesis imperfecta v0.68 TP63 Zornitza Stark reviewed gene: TP63: Rating: RED; Mode of pathogenicity: None; Publications: 22065540; Phenotypes: Split-hand/foot malformation 4, MIM# 605289; Mode of inheritance: None
Amelogenesis imperfecta v0.68 TMEM165 Zornitza Stark Marked gene: TMEM165 as ready
Amelogenesis imperfecta v0.68 TMEM165 Zornitza Stark Gene: tmem165 has been classified as Red List (Low Evidence).
Amelogenesis imperfecta v0.68 TMEM165 Zornitza Stark Phenotypes for gene: TMEM165 were changed from amelogenesis imperfecta to Congenital disorder of glycosylation, type IIk, MIM# 614727; amelogenesis imperfecta
Amelogenesis imperfecta v0.67 TMEM165 Zornitza Stark reviewed gene: TMEM165: Rating: RED; Mode of pathogenicity: None; Publications: 22683087; Phenotypes: Congenital disorder of glycosylation, type IIk, MIM# 614727; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.67 SMARCD2 Zornitza Stark reviewed gene: SMARCD2: Rating: RED; Mode of pathogenicity: None; Publications: 28369036; Phenotypes: Specific granule deficiency 2, MIM# 617475; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Amelogenesis imperfecta v0.67 KCNJ1 Zornitza Stark Marked gene: KCNJ1 as ready
Amelogenesis imperfecta v0.67 KCNJ1 Zornitza Stark Gene: kcnj1 has been classified as Red List (Low Evidence).
Mendeliome v0.8806 SP6 Zornitza Stark Publications for gene: SP6 were set to 32167558; 18156176; 18297738; 22676574
Mendeliome v0.8805 SP6 Zornitza Stark Mode of inheritance for gene: SP6 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.8804 SP6 Zornitza Stark Classified gene: SP6 as Green List (high evidence)
Mendeliome v0.8804 SP6 Zornitza Stark Gene: sp6 has been classified as Green List (High Evidence).
Mendeliome v0.8803 SP6 Zornitza Stark reviewed gene: SP6: Rating: GREEN; Mode of pathogenicity: None; Publications: 33652941; Phenotypes: Hypoplastic amelogenesis imperfecta; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Amelogenesis imperfecta v0.67 SP6 Zornitza Stark Marked gene: SP6 as ready
Amelogenesis imperfecta v0.67 SP6 Zornitza Stark Gene: sp6 has been classified as Green List (High Evidence).
Amelogenesis imperfecta v0.67 SP6 Zornitza Stark Publications for gene: SP6 were set to 18297738; 32167558; 18156176; 22676574