| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Prepair 500+ v1.855 | ZBTB24 | Seb Lunke Publications for gene: ZBTB24 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.148 | PIP5K1C | Sarah Pantaleo reviewed gene: PIP5K1C: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2599 | DNAH12 | Zornitza Stark Marked gene: DNAH12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2599 | DNAH12 | Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2599 | DNAH12 | Zornitza Stark Classified gene: DNAH12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2599 | DNAH12 | Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2598 | DNAH12 |
Zornitza Stark gene: DNAH12 was added gene: DNAH12 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: DNAH12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAH12 were set to 39071892; 40146200 Phenotypes for gene: DNAH12 were set to Spermatogenic failure 100, MIM# 621209 Review for gene: DNAH12 was set to GREEN Added comment: Twelve individuals from 7 families and two mouse models support this association Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.82 | DNAH12 | Zornitza Stark Marked gene: DNAH12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.82 | DNAH12 | Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.82 | DNAH12 | Zornitza Stark Classified gene: DNAH12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.82 | DNAH12 | Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.81 | DNAH12 |
Zornitza Stark gene: DNAH12 was added gene: DNAH12 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DNAH12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAH12 were set to 39071892; 40146200 Phenotypes for gene: DNAH12 were set to Spermatogenic failure 100, MIM# 621209 Review for gene: DNAH12 was set to GREEN Added comment: Twelve individuals from 7 families and two mouse models support this association. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.362 | TTC26 | Zornitza Stark Marked gene: TTC26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.362 | TTC26 | Zornitza Stark Gene: ttc26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.362 | TTC26 | Zornitza Stark Classified gene: TTC26 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.362 | TTC26 | Zornitza Stark Gene: ttc26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.361 | TTC26 |
Zornitza Stark gene: TTC26 was added gene: TTC26 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: TTC26 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC26 were set to 34177428; 32617964; 31595528; 24596149; 22718903 Phenotypes for gene: TTC26 were set to Biliary, renal, neurologic, and skeletal syndrome, MIM# 619534 Review for gene: TTC26 was set to GREEN Added comment: 9 families and functional data including zebrafish model. Multiple congenital anomalies likely identifiable by US. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.360 | TOGARAM1 | Zornitza Stark Phenotypes for gene: TOGARAM1 were changed from Cerebral dysgenesis; Cleft of the lip and palate; Hydrocephalus; Microphthalmia to Joubert syndrome 37, MIM# 619185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.359 | TOGARAM1 | Zornitza Stark Classified gene: TOGARAM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.359 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.358 | TOGARAM1 | Zornitza Stark edited their review of gene: TOGARAM1: Added comment: PMID 32453716: 5 unrelated individuals with Joubert syndrome.; Changed rating: GREEN; Changed publications: 32747439, 32453716; Changed phenotypes: Joubert syndrome 37, MIM# 619185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.358 | KIF3B | Zornitza Stark Marked gene: KIF3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.358 | KIF3B | Zornitza Stark Gene: kif3b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.358 | KIF3B | Zornitza Stark Classified gene: KIF3B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.358 | KIF3B | Zornitza Stark Gene: kif3b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.357 | KIF3B |
Zornitza Stark gene: KIF3B was added gene: KIF3B was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: KIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIF3B were set to 32386558; 38665936 Phenotypes for gene: KIF3B were set to Retinitis pigmentosa 89, MIM#618955; polydactyly Review for gene: KIF3B was set to AMBER Added comment: Two families reported with supportive functional data. Predominant phenotype is RP, however polydactyly reported, which would be detectable by US. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.310 | IFT81 | Zornitza Stark Marked gene: IFT81 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.310 | IFT81 | Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.310 | IFT81 | Zornitza Stark Classified gene: IFT81 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.310 | IFT81 | Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | IFT81 | Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 27666822, 37427975, 32783357 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.232 | IFT81 | Zornitza Stark Publications for gene: IFT81 were set to 27666822; 30080953 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.231 | IFT81 | Zornitza Stark Classified gene: IFT81 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.231 | IFT81 | Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.230 | IFT81 | Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 27666822, 37427975, 32783357 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.356 | IFT81 | Zornitza Stark Classified gene: IFT81 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.356 | IFT81 | Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.355 | IFT81 | Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 27666822, 37427975, 32783357 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.71 | IFT81 | Zornitza Stark edited their review of gene: IFT81: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.71 | IFT81 | Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed publications: 27666822, 37427975, 32783357 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.355 | FGF4 | Zornitza Stark Marked gene: FGF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.355 | FGF4 | Zornitza Stark Gene: fgf4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.355 | FGF4 | Zornitza Stark Classified gene: FGF4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.355 | FGF4 | Zornitza Stark Gene: fgf4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.354 | FGF4 |
Zornitza Stark gene: FGF4 was added gene: FGF4 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: FGF4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FGF4 were set to 40259859 Phenotypes for gene: FGF4 were set to Jeune Syndrome, FGF4-related, MONDO:0018770 Review for gene: FGF4 was set to AMBER Added comment: Two families with three affected individuals reported with homozygous variants in FGF4. Family 1 - Consanguineous parents with five children. Three are unaffected and two are affected with Jeune syndrome - like phenotypes. One of the affected siblings is deceased. Proband was diagnosed with pulmonary hypoplasia at 6 months and later identified to have Jeune Syndrome due to other findings. Homozygous p.Leu86Phe missense variant was identified (variant absent from gnomAD v4.1) Family 2 - Non-consanguineous parents with affected son with Jeune syndrome like phenotype (pulmonary hypoplasia and thoracic dystrophy) Homozygous p.Pro204His missense variant was identified (variant absent from gnomAD v4.1) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.353 | DCDC2 | Zornitza Stark Publications for gene: DCDC2 were set to 25557784; 31821705 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.352 | DCDC2 | Zornitza Stark Classified gene: DCDC2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.352 | DCDC2 | Zornitza Stark Gene: dcdc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.351 | DCDC2 | Zornitza Stark edited their review of gene: DCDC2: Added comment: DEFINITIVE by ClinGen.; Changed rating: GREEN; Changed publications: 27469900, 25557784, 31821705 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.351 | CEP76 | Zornitza Stark Marked gene: CEP76 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.351 | CEP76 | Zornitza Stark Gene: cep76 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.351 | CEP76 | Zornitza Stark Classified gene: CEP76 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.351 | CEP76 | Zornitza Stark Gene: cep76 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.350 | CEP76 |
Zornitza Stark gene: CEP76 was added gene: CEP76 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038 Review for gene: CEP76 was set to GREEN Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago ESHG presentation 4/6/24, unpublished CEP76 associated with syndromic ciliopathy CEP76 localizes to centrioles and basal body primary cilia Role in normal centriolar duplication Index case Bardet Biedl syndrome Compound heterozygous pLoF variants in CEP76 Via Gene matcher 7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum: Obesity Ocular phenotype Structural brain anomalies Renal? 3/7 families clinical Dx Joubert syndrome 1/7 BBS 1/7 GDD/ID NOS 2/7 retinitis pigmentosa (1 of these with learning difficulties) Mixture of biallelic pLOF and missense variant CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.349 | CCDC32 | Zornitza Stark Marked gene: CCDC32 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.349 | CCDC32 | Zornitza Stark Gene: ccdc32 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.349 | CCDC32 | Zornitza Stark Classified gene: CCDC32 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.349 | CCDC32 | Zornitza Stark Gene: ccdc32 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.348 | CCDC32 |
Zornitza Stark gene: CCDC32 was added gene: CCDC32 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: CCDC32 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC32 were set to 32307552 Phenotypes for gene: CCDC32 were set to Cardiofacioneurodevelopmental syndrome (CFNDS), MIM#619123 Review for gene: CCDC32 was set to GREEN Added comment: Two unrelated consanguineous families with probands with homozygous frameshift variants reported. Phenotype is a congenital syndrome characterized by craniofacial, cardiac and neurodevelopmental anomalies. Functional studies in zebrafish show that ccdc32 depletion impairs cilia formation and shows a role for ccdc32 in craniofacial, brain and left/right axis development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.347 | CBY1 | Zornitza Stark Marked gene: CBY1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.347 | CBY1 | Zornitza Stark Gene: cby1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.347 | CBY1 | Zornitza Stark Classified gene: CBY1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.347 | CBY1 | Zornitza Stark Gene: cby1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.346 | CBY1 |
Zornitza Stark gene: CBY1 was added gene: CBY1 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: CBY1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CBY1 were set to 33131181; 25103236; 25220153 Phenotypes for gene: CBY1 were set to Joubert syndrome, MONDO:0018772, CBY1-related Review for gene: CBY1 was set to GREEN Added comment: Two unrelated consanguineous families with LoF variants and multiple animal models. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.345 | ADAMTS9 | Zornitza Stark Marked gene: ADAMTS9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.345 | ADAMTS9 | Zornitza Stark Gene: adamts9 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.345 | ADAMTS9 |
Zornitza Stark gene: ADAMTS9 was added gene: ADAMTS9 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: ADAMTS9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAMTS9 were set to 30609407 Phenotypes for gene: ADAMTS9 were set to Nephropathy-related ciliopathy, MONDO:0022409, ADAMTS9-related Review for gene: ADAMTS9 was set to RED Added comment: LIMITED by ClinGen, several families reported with bi-allelic variants and variable features of a ciliopathy. However, evidence presented deemed of poor quality due to a variety of factors. RED on this panel. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Severe early-onset obesity v1.17 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Severe early-onset obesity v1.16 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Severe early-onset obesity v1.16 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Severe early-onset obesity v1.15 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.148 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.147 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.147 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.146 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported.; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.31 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985; 32055034 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.30 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.30 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.29 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2597 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2597 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2596 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.14 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985; 32055034 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.13 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.13 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.71 | BBIP1 | Zornitza Stark Publications for gene: BBIP1 were set to 24026985; 32055034 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.70 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.70 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.69 | BBIP1 | Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.344 | BBIP1 | Zornitza Stark Marked gene: BBIP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.344 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.344 | BBIP1 | Zornitza Stark Classified gene: BBIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.344 | BBIP1 | Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.343 | BBIP1 |
Zornitza Stark gene: BBIP1 was added gene: BBIP1 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: BBIP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BBIP1 were set to 24026985; 32055034; 37239474 Phenotypes for gene: BBIP1 were set to Bardet-Biedl syndrome 18, MIM#615995 Review for gene: BBIP1 was set to GREEN Added comment: PMID: 24026985 - Single patient with BBS described with bi-allelic variants in this gene. PMID: 32055034 - An additional patient with classic BBS with a homozygous splice variant confirmed by RT-PCR to result in NMD PMID 37239474: third family with homozygous LoF variant Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.342 | SLC30A7 | Zornitza Stark Marked gene: SLC30A7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.342 | SLC30A7 | Zornitza Stark Gene: slc30a7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.342 | SLC30A7 | Zornitza Stark Classified gene: SLC30A7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.342 | SLC30A7 | Zornitza Stark Gene: slc30a7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.341 | SLC30A7 |
Zornitza Stark gene: SLC30A7 was added gene: SLC30A7 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: SLC30A7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SLC30A7 were set to 35751429 Phenotypes for gene: SLC30A7 were set to Joubert syndrome (MONDO:0018772), SLC30A7-related Review for gene: SLC30A7 was set to AMBER Added comment: PMID: 35751429: Two individuals reported with de novo variants, one missense and one delins resulting in missense. The first individual is a female with history of unilateral postaxial polydactyly, classic molar tooth sign on MRI, macrocephaly, ataxia, ocular motor apraxia, neurodevelopmental delay, and precocious puberty. The second individual had bilateral postaxial polydactyly, molar tooth sign, macrocephaly, developmental delay, and an extra oral frenulum. No functional studies reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.340 | SCNM1 | Zornitza Stark Marked gene: SCNM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.340 | SCNM1 | Zornitza Stark Gene: scnm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.340 | SCNM1 | Zornitza Stark Classified gene: SCNM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.340 | SCNM1 | Zornitza Stark Gene: scnm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.339 | SCNM1 |
Zornitza Stark gene: SCNM1 was added gene: SCNM1 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: SCNM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SCNM1 were set to 36084634 Phenotypes for gene: SCNM1 were set to Orofaciodigital syndrome XIX, MIM# 620107 Review for gene: SCNM1 was set to GREEN Added comment: Iturrate (2022): three unrelated families (4 affected) w/ OFD, polydactyly, syndactyly and brachydactyly. All had biallelic variants (fs, missense, AluYc1 sequence insertion) and were consanguinous - the missense variant was shown to have a splice outcome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.338 | LEF1 | Zornitza Stark Marked gene: LEF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.338 | LEF1 | Zornitza Stark Gene: lef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.338 | LEF1 | Zornitza Stark Classified gene: LEF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.338 | LEF1 | Zornitza Stark Gene: lef1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.337 | LEF1 |
Zornitza Stark gene: LEF1 was added gene: LEF1 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: LEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: LEF1 were set to 32022899; 35583550 Phenotypes for gene: LEF1 were set to Syndromic disease, MONDO:0002254, LEF1-related Review for gene: LEF1 was set to GREEN Added comment: Monoallelic variants in LEF1 reported in 11 affected individuals from 4 unrelated families, and a biallelic variant reported in an affected individual from a consanguineous family. The phenotypic spectrum included various limb malformations, such as radial ray defects, polydactyly or split hand/foot, and ectodermal dysplasia. Haploinsufficiency or loss of DNA binding postulated to be responsible for a mild to moderate phenotype, whereas loss of β-catenin binding caused by biallelic variants postulated to be associated with a severe phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.336 | IFT57 | Zornitza Stark Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.336 | IFT57 | Zornitza Stark Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.336 | IFT57 | Zornitza Stark Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.336 | IFT57 | Zornitza Stark Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.335 | IFT57 |
Zornitza Stark gene: IFT57 was added gene: IFT57 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to 40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308, IFT57-related Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Learning difficulties - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital ophthalmoplegia v1.10 | MAFB | Zornitza Stark Marked gene: MAFB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital ophthalmoplegia v1.10 | MAFB | Zornitza Stark Gene: mafb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital ophthalmoplegia v1.10 | MAFB | Zornitza Stark Classified gene: MAFB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital ophthalmoplegia v1.10 | MAFB | Zornitza Stark Gene: mafb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital ophthalmoplegia v1.9 | MAFB |
Zornitza Stark gene: MAFB was added gene: MAFB was added to Congenital ophthalmoplegia. Sources: Literature Mode of inheritance for gene: MAFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MAFB were set to 27181683; 34964110; 29779709 Phenotypes for gene: MAFB were set to Duane retraction syndrome 3, MIM# 617041 Review for gene: MAFB was set to GREEN Added comment: At least 5 families reported with variants in this gene and Duane anomaly, supportive functional data. Some individuals also had inner ear agenesis and glomerular disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.3 | ACADM | Zornitza Stark Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.3 | ACADM | Zornitza Stark commented on gene: ACADM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.3 | ACADM | Zornitza Stark Marked gene: ACADM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.3 | ACADM | Zornitza Stark Gene: acadm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.3 | ACADM | Zornitza Stark Classified gene: ACADM as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.3 | ACADM | Zornitza Stark Gene: acadm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.146 | FAM177A1 | Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.145 | FAM177A1 | Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2596 | FAM177A1 | Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177A1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2595 | FAM177A1 | Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.2 | ACADVL |
Lilian Downie gene: ACADVL was added gene: ACADVL was added to Genomic newborn screening: ICoNS. Sources: Expert list Mode of inheritance for gene: ACADVL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ACADVL were set to PMID: 20301763; 32885845; 31372341 Phenotypes for gene: ACADVL were set to VLCAD deficiency MIM#201475 Review for gene: ACADVL was set to GREEN Added comment: Well established gene-disease association. VLCAD deficiency can be classified clinically into 3 forms: a severe early-onset form with high incidence of cardiomyopathy and high mortality; an intermediate form with childhood onset, usually with hypoketotic hypoglycemia and more favorable outcome; and an adult-onset, myopathic form with isolated skeletal muscle involvement, rhabdomyolysis, and myoglobinuria after exercise or fasting. - Severe disease is associated with no residual enzyme activity, often resulting from null variants. Approximately 81% of pathogenic truncating variants in ACADVL are associated with the severe early-onset form [Andresen et al 1999]. - A specific homozygous missense pathogenic variant (c.709T>C;p.Cys237Arg) leading to low long-chain fatty acid oxidation flux may also be associated with cardiac disease [Diekman et al 2015]. - Milder childhood and adult forms are often associated with residual enzyme activity. The common p.Val283Ala variant, in both homozygous and compound heterozygous genotypes, is typically associated with the non-cardiac phenotypes [Spiekerkoetter et al 2009, Diekman et al 2015, Miller et al 2015]. Treatment: avoid fasting, carnitine, restrict LCFA, bezafibrate, triheptanoin On BabyScreen+, BabySeq, BeginNGS, Guardian, Generation and EarlyCheck Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.1 | ACADM |
Lilian Downie gene: ACADM was added gene: ACADM was added to Genomic newborn screening: ICoNS. Sources: Expert list Mode of inheritance for gene: ACADM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACADM were set to Acyl-CoA dehydrogenase, medium chain, deficiency of MIM# 201450 Review for gene: ACADM was set to GREEN Added comment: Well established gene-disease association. Inherited deficiency of medium-chain acyl-CoA dehydrogenase is characterized by intolerance to prolonged fasting, recurrent episodes of hypoglycemic coma with medium-chain dicarboxylic aciduria, impaired ketogenesis, and low plasma and tissue carnitine levels. Can be severe, potentially fatal. Typical presentation is between 3 and 24 months. More than 98% of cases of MCAD deficiency have a pathogenic variant in ACADM, with the c.985A>G variant accounting for between 56-91% of cases. Treatment: management plan to avoid fasting. ClinGen: Strong Actionability in paediatric patients. Non-genetic confirmatory tests: Urine acylglycine analysis Included in BabyScreen+, BabySeq, BeginNGS, Guardian, Generation, EarlyCheck Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | NLRP14 |
Jasmine Chew gene: NLRP14 was added gene: NLRP14 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: NLRP14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NLRP14 were set to 38060382 Phenotypes for gene: NLRP14 were set to Oocyte maturation defect and early embryo arrest Review for gene: NLRP14 was set to AMBER Added comment: PMID: 38060382- Compound heterozygous variants (p.Cys428Profs∗28/p.Leu887delinsArgTyr) reported in an infertile woman with oocyte maturation defects and early embryo arrest (EEA). - Functional analysis showed comparable protein levels compared with the wild-type control, although a truncated band of the expected size (47 kDa) was observed for the p.Cys428Profs∗28 variant. -The truncated variant, p.Cys428Profs∗28, is lacking the LRR domain and, hence, completely loses the ability to bind with UHRF1. The p.Leu887delinsArgTyr variant results in significant alteration in binding modes with decreased binding area and binding free energy, which introduced regional instability in the NLRP14-UHRF1 interaction. The interaction of both variants and UHRF1 was disrupted and might lead to increased UHRF1 protein degradation in oocytes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | OOEP | Jasmine Chew edited their review of gene: OOEP: Changed phenotypes: Recurrent preimplantation embryonic arrest, Female infertility due to oocyte meiotic arrest, MONDO:0044626 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | OOEP |
Jasmine Chew gene: OOEP was added gene: OOEP was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: OOEP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OOEP were set to 35946397 Phenotypes for gene: OOEP were set to Recurrent preimplantation embryonic arrest Review for gene: OOEP was set to AMBER Added comment: i) PMID: 35946397- Compound heterozygous missense variants (p.Arg37Gly and p.Arg37Pro) identified in a patient who experienced recurrent preimplantation embryonic arrest. - Immunofluorescence and western blot analysis showed that both variants lead to reduced OOEP protein expression compared with that in the wild type. - Transcriptomic analysis showed that mutant OOEP‐affected embryos had downregulation of gene transcripts, indicating that substantial number of mRNAs were not transcribed or were decayed in the affected embryo. The GO analysis results revealed that these downregulated genes were mainly enriched in protein binding, translation, mRNA processing, and mitochondrial function. ii) PMID: 39379527- showed functionally that the two reported variants result in significantly destabilizing intercomponent interactions among the subcortical maternal complex (SCMC) subunits. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | PDE6B | Sangavi Sivagnanasundram reviewed gene: PDE6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 8394174, 7599633, 18854872, 33177553, 33673512, 25827439; Phenotypes: inherited retinal dystrophy MONDO:0019118; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | NR2E3 | Sangavi Sivagnanasundram reviewed gene: NR2E3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10655056, 11071390, 18294254, 40317544, 38444285, 22605927; Phenotypes: Enhanced S-cone syndrome MONDO:0100288, retinitis pigmentosa 37 MONDO:0012625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.215 | GJB6 | Sarah Leigh reviewed gene: GJB6: Rating: GREEN; Mode of pathogenicity: None; Publications: 19416251, 24522190, 29921236, 40369851; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.145 | GTF3C3 | Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.144 | GTF3C3 | Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.150 | GTF3C3 | Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.149 | GTF3C3 | Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2595 | GTF3C3 | Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2594 | GTF3C3 | Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.144 | PTPMT1 | Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.143 | PTPMT1 | Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.975 | PTPMT1 | Zornitza Stark Phenotypes for gene: PTPMT1 were changed from Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.975 | PTPMT1 | Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.974 | PTPMT1 | Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2594 | PTPMT1 | Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2593 | PTPMT1 | Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | CRB1 | Sangavi Sivagnanasundram reviewed gene: CRB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11231775, 11389483, 16543197; Phenotypes: Leber congenital amaurosis 8 MONDO:0013453; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | BEST1 | Sangavi Sivagnanasundram reviewed gene: BEST1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29668979, 39803400, 39259030; Phenotypes: autosomal recessive bestrophinopathy MONDO:0012733; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.334 | WNT3 | Zornitza Stark reviewed gene: WNT3: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Tetra-amelia syndrome 1, OMIM #273395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hand and foot malformations v0.76 | WNT3 | Zornitza Stark commented on gene: WNT3: LIMITED by ClinGen. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2593 | WNT3 | Zornitza Stark commented on gene: WNT3: LIMITED by ClinGen. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.334 | PPP2R5C | Zornitza Stark Phenotypes for gene: PPP2R5C were changed from macrocephaly; overgrowth to Houge-Janssens syndrome 4, MIM# 621185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.333 | PPP2R5C | Zornitza Stark reviewed gene: PPP2R5C: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.143 | PPP2R5C | Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.142 | PPP2R5C | Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2593 | PPP2R5C | Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2592 | PPP2R5C | Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.150 | PPP2R5C | Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.149 | PPP2R5C | Zornitza Stark edited their review of gene: PPP2R5C: Changed phenotypes: Houge-Janssens syndrome 4, MIM# 621185 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.263 | RAI1_FAME8_TTTCA | Bryony Thompson Marked STR: RAI1_FAME8_TTTCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.263 | RAI1_FAME8_TTTCA | Bryony Thompson Str: rai1_fame8_tttca has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.263 | RAI1_FAME8_TTTCA |
Bryony Thompson STR: RAI1_FAME8_TTTCA was added STR: RAI1_FAME8_TTTCA was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: RAI1_FAME8_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: RAI1_FAME8_TTTCA were set to 37994247 Phenotypes for STR: RAI1_FAME8_TTTCA were set to benign adult familial myoclonic epilepsy MONDO:0019448 Review for STR: RAI1_FAME8_TTTCA was set to RED Added comment: A single family from Mali segregating TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1. Consistent with other FAME expansions. RNA toxicity is suggested to be the mechanism. Loss of function is the mechanism of disease of Smith-Magenis syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Marked STR: NAXE_NME_GGGCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Classified STR: NAXE_NME_GGGCC as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.262 | NAXE_NME_GGGCC | Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.261 | NAXE_NME_GGGCC |
Bryony Thompson STR: NAXE_NME_GGGCC was added STR: NAXE_NME_GGGCC was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: NAXE_NME_GGGCC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: NAXE_NME_GGGCC were set to 39455596 Phenotypes for STR: NAXE_NME_GGGCC were set to encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1 MONDO:0020781 Review for STR: NAXE_NME_GGGCC was set to AMBER STR: NAXE_NME_GGGCC was marked as clinically relevant STR: NAXE_NME_GGGCC was marked as current diagnostic Added comment: A single case with a homozygous (result of UPD) repeat expansion in the promoter that leads to methylation of the promoter (identified by long-read sequencing). Biallelic loss of function variants in this gene cause a mitochondrial disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.260 | THAP11_SCA51_CAG | Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 37148549 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.259 | THAP11_SCA51_CAG | Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.258 | AFF3_FRA2A_CGG | Bryony Thompson Publications for STR: AFF3_FRA2A_CGG were set to 24763282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.257 | DIP2B_FRA12A_CGG | Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.223 | ARL2BP |
Sangavi Sivagnanasundram gene: ARL2BP was added gene: ARL2BP was added to Syndromic Retinopathy. Sources: Expert Review Mode of inheritance for gene: ARL2BP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ARL2BP were set to 23849777; 31425546; 36507858; 38649918 Phenotypes for gene: ARL2BP were set to Ciliopathy MONDO:0005308 Review for gene: ARL2BP was set to GREEN Added comment: Classified as Definitive by ClinGen Retina GCEP on 02/01/2025 - https://search.clinicalgenome.org/CCID:004172 Affected individuals present with different forms of ocular phenotypes along with other non-ocular phenotypes. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | ARL2BP | Sangavi Sivagnanasundram reviewed gene: ARL2BP: Rating: RED; Mode of pathogenicity: None; Publications: 27790702, 20301590; Phenotypes: Retinitis pigmentosa 82 with or without situs inversus MIM#615434; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | AHI1 | Sangavi Sivagnanasundram reviewed gene: AHI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28442542; Phenotypes: Joubert syndrome 3 MONDO:0012078, retinitis pigmentosa MONDO:0019200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | AGBL5 | Sangavi Sivagnanasundram reviewed gene: AGBL5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26720455, 26355662, 27842159; Phenotypes: retinitis pigmentosa 75, MONDO:0014871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | ABHD12 |
Sangavi Sivagnanasundram changed review comment from: 20797687 - only one individual presenting with nonsyndromic RP. Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract (PHARC syndrome) is a form of syndromic RP. This association is green on syndromic RP.; to: 20797687 - only one individual presenting with nonsyndromic RP. Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract (PHARC syndrome) is a form of syndromic RP. This association is green on syndromic RP. Multiple individuals reported with syndromic RP. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | ABHD12 | Sangavi Sivagnanasundram reviewed gene: ABHD12: Rating: RED; Mode of pathogenicity: None; Publications: 20797687; Phenotypes: PHARC syndrome MONDO:0012984; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.223 | PANK2 | Sangavi Sivagnanasundram reviewed gene: PANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11479594, 15911822, 1734303; Phenotypes: pantothenate kinase-associated neurodegeneration MONDO:0009319; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2592 | SCO2 | Zornitza Stark Mode of inheritance for gene: SCO2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Diamond Blackfan anaemia v1.9 | GATA1 | Zornitza Stark Mode of inheritance for gene: GATA1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Diamond Blackfan anaemia v1.8 | GATA1 | Zornitza Stark reviewed gene: GATA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Diamond-Blackfan anemia (MONDO:0015253); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Arterial Hypertension v1.39 | ATP13A3 | Lilian Downie reviewed gene: ATP13A3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34493544; Phenotypes: Pulmonary hypertension, primary, 5 MIM#265400; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2591 | MMAB | Sangavi Sivagnanasundram reviewed gene: MMAB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24813872; Phenotypes: methylmalonic aciduria, cblB type MONDO:0009614; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Heterotaxy v1.37 | NPHP4 | Elena Savva Mode of inheritance for gene: NPHP4 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | PANX1 | Zornitza Stark Marked gene: PANX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | PANX1 | Zornitza Stark Gene: panx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | PANX1 | Zornitza Stark Classified gene: PANX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.80 | PANX1 | Zornitza Stark Gene: panx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.79 | SEPT4 | Zornitza Stark Marked gene: SEPT4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.79 | SEPT4 | Zornitza Stark Gene: sept4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.79 | SEPT4 | Zornitza Stark Classified gene: SEPT4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.79 | SEPT4 | Zornitza Stark Gene: sept4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.78 | SEPT4 |
Zornitza Stark gene: SEPT4 was added gene: SEPT4 was added to Infertility and Pregnancy Loss. Sources: Expert Review Mode of inheritance for gene: SEPT4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SEPT4 were set to 36135717; 15737931; 15737930 Phenotypes for gene: SEPT4 were set to Spermatogenic failure 99, MIM# 621194 Review for gene: SEPT4 was set to GREEN Added comment: Two unrelated cases with primary male infertility (asthenoteratozoospermia) from consanguineous Chinsese families with 2 difference homozygous stopgain variants (Patient 1: c.721A>T, p.R241* and Patient 2: c.205C>T, p.R69*). Multiple supporting mouse models where the male mice are sterile. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2591 | SEPT4 | Zornitza Stark reviewed gene: SEPT4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 99, MIM# 621194; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.140 | ABCC8 | Zornitza Stark Phenotypes for gene: ABCC8 were changed from permanent neonatal diabetes mellitus MONDO:0100164; transient neonatal diabetes mellitus MONDO:0020525 to Maturity-onset diabetes of the young, type 12, MIM# 621196; permanent neonatal diabetes mellitus MONDO:0100164; transient neonatal diabetes mellitus MONDO:0020525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.139 | ABCC8 | Zornitza Stark Publications for gene: ABCC8 were set to 21054355; 32027066; 32376986 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.138 | ABCC8 | Zornitza Stark reviewed gene: ABCC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 21989597, 34014594; Phenotypes: Maturity-onset diabetes of the young, type 12, MIM# 621196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2591 | ABCC8 | Zornitza Stark Phenotypes for gene: ABCC8 were changed from Diabetes mellitus, noninsulin-dependent MIM#125853; Diabetes mellitus, permanent neonatal 3, with or without neurologic features MIM#618857; Diabetes mellitus, transient neonatal 2 MIM#610374; Hyperinsulinemic hypoglycemia, familial, 1 MIM#256450; Hypoglycemia of infancy, leucine-sensitive MIM#240800 to Maturity-onset diabetes of the young, type 12, MIM# 621196; Diabetes mellitus, noninsulin-dependent MIM#125853; Diabetes mellitus, permanent neonatal 3, with or without neurologic features MIM#618857; Diabetes mellitus, transient neonatal 2 MIM#610374; Hyperinsulinemic hypoglycemia, familial, 1 MIM#256450; Hypoglycemia of infancy, leucine-sensitive MIM#240800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.348 | MRPL49 | Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | MRPL49 | Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.142 | MRPL49 | Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.141 | MRPL49 | Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.215 | MRPL49 | Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.214 | MRPL49 | Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.974 | MRPL49 | Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | MRPL49 | Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2590 | MRPL49 | Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2589 | MRPL49 | Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.159 | IDH3G | Zornitza Stark Phenotypes for gene: IDH3G were changed from X-linked retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa 99, MIM# 301148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.158 | IDH3G | Zornitza Stark reviewed gene: IDH3G: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 99, MIM# 301148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2589 | IDH3G | Zornitza Stark Phenotypes for gene: IDH3G were changed from X-linked retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa 99, MIM# 301148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | IDH3G | Zornitza Stark reviewed gene: IDH3G: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 99, MIM# 301148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.141 | SMAD6 |
Boris Keren changed review comment from: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606). Sources: Literature; to: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606) and 11/15 had neurodevelopmental delay in Timberlake et al. (PMID: 27606499) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.141 | SMAD6 |
Boris Keren gene: SMAD6 was added gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SMAD6 were set to PMID: 32499606 Penetrance for gene: SMAD6 were set to Incomplete Review for gene: SMAD6 was set to GREEN Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | MAN2B1 | Sangavi Sivagnanasundram reviewed gene: MAN2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18651971, 9158146, 9758606, 9915946, 22161967; Phenotypes: alpha-mannosidosis MONDO:0009561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | LYST | Sangavi Sivagnanasundram edited their review of gene: LYST: Changed publications: 8896560, 9215680, 31906877, 9215679, 26499269, 24112114, 28145517 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | LYST | Sangavi Sivagnanasundram reviewed gene: LYST: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896560, 9215680, 31906877, 9215679, 26499269, 24112114, 28145517); Phenotypes: Chediak-Higashi syndrome MONDO:0008963; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | LYRM7 | Sangavi Sivagnanasundram reviewed gene: LYRM7: Rating: GREEN; Mode of pathogenicity: None; Publications: 24014394, 26912632; Phenotypes: mitochondrial disease, LYRM7-related MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | LPAR6 | Sangavi Sivagnanasundram reviewed gene: LPAR6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18297072, 18297070, 18461368; Phenotypes: LPAR6-related hypotrichosis/woolly hair with or without hypotrichosis, MONDO:MONDO:0800312; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.854 | QDPR | Zornitza Stark Marked gene: QDPR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.854 | QDPR | Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.854 | QDPR | Zornitza Stark Phenotypes for gene: QDPR were changed from Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 to Hyperphenylalaninaemia, BH4-deficient, C, MIM# 261630 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.853 | QDPR | Zornitza Stark Phenotypes for gene: QDPR were changed from Hyperphenylalaninemia, BH4-deficient, C, 261630 (3) to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.852 | QDPR | Zornitza Stark Publications for gene: QDPR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.851 | PUS1 | Zornitza Stark Marked gene: PUS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.851 | PUS1 | Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.851 | PUS1 | Zornitza Stark Phenotypes for gene: PUS1 were changed from Mitochondrial myopathy and sideroblastic anemia 1, 600462 (3) to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.850 | PUS1 | Zornitza Stark Publications for gene: PUS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.849 | PTS | Zornitza Stark Marked gene: PTS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.849 | PTS | Zornitza Stark Gene: pts has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.849 | PTS | Zornitza Stark Phenotypes for gene: PTS were changed from Hyperphenylalaninemia, BH4-deficient, A, 261640 (3) to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; BH4-deficient hyperphenylalaninemia A, MONDO:0009863 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.848 | PTS | Zornitza Stark Publications for gene: PTS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.847 | PSAP | Zornitza Stark Marked gene: PSAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.847 | PSAP | Zornitza Stark Gene: psap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.847 | PSAP | Zornitza Stark Phenotypes for gene: PSAP were changed from Metachromatic leukodystrophy due to SAP-b deficiency, 249900 (3) to Metachromatic leukodystrophy due to SAP-b deficiency, MIM #249900; Combined SAP deficiency, MIM #611721; Gaucher disease, atypical, MIM #610539; Krabbe disease, atypical, MIM #611722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.846 | PSAP | Zornitza Stark Publications for gene: PSAP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.845 | PRPS1 | Zornitza Stark Marked gene: PRPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.845 | PRPS1 | Zornitza Stark Gene: prps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.845 | PRPS1 | Zornitza Stark Phenotypes for gene: PRPS1 were changed from Arts syndrome, 301835 (3) to PRPS1 deficiency disorder MONDO:0100061; Phosphoribosylpyrophosphate synthetase superactivity MIM#300661 MONDO:0010395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.844 | PROP1 | Zornitza Stark Marked gene: PROP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.844 | PROP1 | Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.844 | PROP1 | Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined, 2, 262600 (3) to Pituitary hormone deficiency, combined, 2, MIM#262600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.843 | PRF1 | Zornitza Stark Marked gene: PRF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.843 | PRF1 | Zornitza Stark Gene: prf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.843 | PRF1 | Zornitza Stark Phenotypes for gene: PRF1 were changed from Hemophagocytic lymphohistiocytosis, familial, 2, 603553 (3) to Haemophagocytic lymphohistiocytosis, familial, 2 MIM#603553 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.842 | PRF1 | Zornitza Stark Publications for gene: PRF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.841 | PRDM5 | Zornitza Stark Marked gene: PRDM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.841 | PRDM5 | Zornitza Stark Gene: prdm5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.841 | PRDM5 | Zornitza Stark Phenotypes for gene: PRDM5 were changed from Brittle cornea syndrome 2, 614170 (3) to Brittle cornea syndrome 2, MIM#614170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.840 | PRDM5 | Zornitza Stark Publications for gene: PRDM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.839 | PQBP1 | Zornitza Stark Marked gene: PQBP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.839 | PQBP1 | Zornitza Stark Gene: pqbp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.839 | PQBP1 | Zornitza Stark Phenotypes for gene: PQBP1 were changed from Renpenning syndrome, 309500 (3) to Renpenning syndrome MIM#309500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.838 | PQBP1 | Zornitza Stark Publications for gene: PQBP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.837 | PPT1 | Zornitza Stark Marked gene: PPT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.837 | PPT1 | Zornitza Stark Gene: ppt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.837 | PPT1 | Zornitza Stark Phenotypes for gene: PPT1 were changed from Ceroid lipofuscinosis, neuronal, 1, 256730 (3) to Ceroid lipofuscinosis, neuronal, 1, MIM# 256730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.836 | PPT1 | Zornitza Stark Publications for gene: PPT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.835 | POU1F1 | Zornitza Stark Marked gene: POU1F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.835 | POU1F1 | Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.835 | POU1F1 | Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1, 613038 (3) to Pituitary hormone deficiency, combined or isolated, 1, MIM#613038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.834 | POU1F1 | Zornitza Stark Publications for gene: POU1F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.833 | POR | Zornitza Stark Marked gene: POR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.833 | POR | Zornitza Stark Gene: por has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.833 | POR | Zornitza Stark Phenotypes for gene: POR were changed from Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis, 201750 (3) to Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis (MIM#201750) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.832 | POR | Zornitza Stark Publications for gene: POR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.831 | POMT2 | Zornitza Stark Marked gene: POMT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.831 | POMT2 | Zornitza Stark Gene: pomt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.831 | POMT2 | Zornitza Stark Phenotypes for gene: POMT2 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM# 613150; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 2, MIM# 613156 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.830 | POMT2 | Zornitza Stark Publications for gene: POMT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.829 | POMT1 | Zornitza Stark Marked gene: POMT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.829 | POMT1 | Zornitza Stark Gene: pomt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.829 | POMT1 | Zornitza Stark Phenotypes for gene: POMT1 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, 236670 (3) to Myopathy caused by variation in POMT1 MONDO:0700070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.828 | POMT1 | Zornitza Stark Publications for gene: POMT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.827 | POMGNT1 | Zornitza Stark Marked gene: POMGNT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.827 | POMGNT1 | Zornitza Stark Gene: pomgnt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.827 | POMGNT1 | Zornitza Stark Phenotypes for gene: POMGNT1 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3, 253280 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A3, MIM#253280; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B3, MIM#61315 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.826 | POMGNT1 | Zornitza Stark Publications for gene: POMGNT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.825 | POLR3B | Zornitza Stark Marked gene: POLR3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.825 | POLR3B | Zornitza Stark Gene: polr3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.825 | POLR3B | Zornitza Stark Phenotypes for gene: POLR3B were changed from Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381 (3) to Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism,MIM#614381 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.824 | POLR3B | Zornitza Stark Publications for gene: POLR3B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.823 | POLR1C | Zornitza Stark Marked gene: POLR1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.823 | POLR1C | Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.823 | POLR1C | Zornitza Stark Phenotypes for gene: POLR1C were changed from Treacher Collins syndrome 3, 248390 (3) to Leukodystrophy, hypomyelinating, 11 MIM#616494; Treacher Collins syndrome 3 MIM#248390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.822 | POLR1C | Zornitza Stark Publications for gene: POLR1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.821 | POLG | Zornitza Stark Marked gene: POLG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.821 | POLG | Zornitza Stark Gene: polg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.821 | POLG | Zornitza Stark Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type), 203700 (3) to Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.820 | PNPO | Zornitza Stark Marked gene: PNPO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.820 | PNPO | Zornitza Stark Gene: pnpo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.820 | PNPO | Zornitza Stark Phenotypes for gene: PNPO were changed from Pyridoxamine 5'-phosphate oxidase deficiency, 610090 (3) to Pyridoxamine 5'-phosphate oxidase deficiency MIM#610090 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.819 | PNPO | Zornitza Stark Publications for gene: PNPO were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.818 | PNKP | Zornitza Stark Marked gene: PNKP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.818 | PNKP | Zornitza Stark Gene: pnkp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.818 | PNKP | Zornitza Stark Phenotypes for gene: PNKP were changed from Microcephaly, seizures, and developmental delay, 613402 (3) to Ataxia-oculomotor apraxia 4, MIM# 616267; Microcephaly, seizures, and developmental delay, MIM# 613402 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.817 | PNKP | Zornitza Stark Publications for gene: PNKP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.816 | PMM2 | Zornitza Stark Marked gene: PMM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.816 | PMM2 | Zornitza Stark Gene: pmm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.816 | PMM2 | Zornitza Stark Phenotypes for gene: PMM2 were changed from Congenital disorder of glycosylation, type Ia, 212065 (3) to Congenital disorder of glycosylation, type Ia (MIM#212065) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.815 | PLPBP | Zornitza Stark Marked gene: PLPBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.815 | PLPBP | Zornitza Stark Gene: plpbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.815 | PLPBP | Zornitza Stark Phenotypes for gene: PLPBP were changed from Epilepsy, early-onset, vitamin B6-dependent, 617290 (3), Autosomal recessive to Epilepsy, early-onset, vitamin B6-dependent, MIM#617290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.814 | PLPBP | Zornitza Stark Publications for gene: PLPBP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.813 | PLP1 | Zornitza Stark Marked gene: PLP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.813 | PLP1 | Zornitza Stark Gene: plp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.813 | PLP1 | Zornitza Stark Phenotypes for gene: PLP1 were changed from Pelizaeus-Merzbacher disease, 312080 (3) to Pelizaeus-Merzbacher disease MIM#312080, Pelizeaus-Merzbacher spectrum disorder MONDO:0010714; Spastic paraplegia 2, X-linked MIM#312920, hereditary spastic paraplegia 2 MONDO:0010733 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.812 | PLP1 | Zornitza Stark Publications for gene: PLP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.811 | PLOD1 | Zornitza Stark Marked gene: PLOD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.811 | PLOD1 | Zornitza Stark Gene: plod1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.811 | PLOD1 | Zornitza Stark Phenotypes for gene: PLOD1 were changed from Ehlers-Danlos syndrome, type VI, 225400 (3) to Ehlers-Danlos syndrome, kyphoscoliotic type, 1, MIM# 225400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.810 | PLOD1 | Zornitza Stark Publications for gene: PLOD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.809 | PLA2G6 | Zornitza Stark Marked gene: PLA2G6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.809 | PLA2G6 | Zornitza Stark Gene: pla2g6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.809 | PKHD1 | Zornitza Stark Marked gene: PKHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.809 | PKHD1 | Zornitza Stark Gene: pkhd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.809 | PKHD1 | Zornitza Stark Phenotypes for gene: PKHD1 were changed from Polycystic kidney and hepatic disease, 263200 (3) to Polycystic kidney disease 4, with or without hepatic disease MIM#263200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.808 | PKHD1 | Zornitza Stark Publications for gene: PKHD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.807 | PIGT | Zornitza Stark Marked gene: PIGT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.807 | PIGT | Zornitza Stark Gene: pigt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.807 | PIGT | Zornitza Stark Phenotypes for gene: PIGT were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 3 to Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.806 | PIGT | Zornitza Stark Publications for gene: PIGT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.805 | PIGN | Zornitza Stark Marked gene: PIGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.805 | PIGN | Zornitza Stark Gene: pign has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.805 | PIGN | Zornitza Stark Phenotypes for gene: PIGN were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 1, 614080 (3) to Multiple congenital anomalies-hypotonia-seizures syndrome 1,MIM#614080 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.804 | PIGN | Zornitza Stark Publications for gene: PIGN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.803 | PIGG | Zornitza Stark Marked gene: PIGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.803 | PIGG | Zornitza Stark Gene: pigg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.803 | PIGG | Zornitza Stark Publications for gene: PIGG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.802 | PIBF1 | Zornitza Stark Marked gene: PIBF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.802 | PIBF1 | Zornitza Stark Gene: pibf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.802 | PHYH | Zornitza Stark Marked gene: PHYH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.802 | PHYH | Zornitza Stark Gene: phyh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.802 | PHYH | Zornitza Stark Phenotypes for gene: PHYH were changed from Refsum disease, 266500 (3) to Refsum disease MIM#266500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.801 | PHYH | Zornitza Stark Publications for gene: PHYH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.800 | PHGDH | Zornitza Stark Marked gene: PHGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.800 | PHGDH | Zornitza Stark Gene: phgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.800 | PHGDH | Zornitza Stark Phenotypes for gene: PHGDH were changed from Neu-Laxova syndrome1, 256520 (3) to Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.799 | PHGDH | Zornitza Stark Publications for gene: PHGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.798 | PHF8 | Zornitza Stark Marked gene: PHF8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.798 | PHF8 | Zornitza Stark Gene: phf8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.798 | PHF8 | Zornitza Stark Phenotypes for gene: PHF8 were changed from Mental retardation syndrome, X-linked, Siderius type, 300263 (3) to Intellectual developmental disorder, X-linked syndromic, Siderius type, MIM# 300263 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.797 | PHF8 | Zornitza Stark Publications for gene: PHF8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.796 | PGM3 | Zornitza Stark Marked gene: PGM3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.796 | PGM3 | Zornitza Stark Gene: pgm3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.796 | PGM3 | Zornitza Stark Phenotypes for gene: PGM3 were changed from Immunodeficiency 23, 615816 (3) to Immunodeficiency 23, MIM# 615816 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.795 | PGM3 | Zornitza Stark Publications for gene: PGM3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.794 | PGM1 | Zornitza Stark Marked gene: PGM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.794 | PGM1 | Zornitza Stark Gene: pgm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.794 | PGM1 | Zornitza Stark Phenotypes for gene: PGM1 were changed from Congenital disorder of glycosylation, type It, 614921 (3) to Congenital disorder of glycosylation, type It (MIM#614921) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.793 | PGM1 | Zornitza Stark Publications for gene: PGM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.792 | PGK1 | Zornitza Stark Marked gene: PGK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.792 | PGK1 | Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.792 | PGK1 | Zornitza Stark Phenotypes for gene: PGK1 were changed from Phosphoglycerate kinase 1 deficiency, 300653 (3) to Phosphoglycerate kinase 1 deficiency (MIM#300653) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.791 | PGAP2 | Zornitza Stark Marked gene: PGAP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.791 | PGAP2 | Zornitza Stark Gene: pgap2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.791 | PGAP2 | Zornitza Stark Phenotypes for gene: PGAP2 were changed from Hyperphosphatasia with mental retardation syndrome 3, 614207 (3) to Hyperphosphatasia with impaired intellectual development syndrome 3, MIM#614207 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.790 | PGAP2 | Zornitza Stark Publications for gene: PGAP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.789 | PFKM | Zornitza Stark Marked gene: PFKM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.789 | PFKM | Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.789 | PFKM | Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800 (3) to Glycogen storage disease VII MIM#232800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.788 | PFKM | Zornitza Stark Publications for gene: PFKM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.787 | PEX7 | Zornitza Stark Marked gene: PEX7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.787 | PEX7 | Zornitza Stark Gene: pex7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.787 | PEX7 | Zornitza Stark Phenotypes for gene: PEX7 were changed from Chondrodysplasia punctata, rhizomelic, type 1, 215100 (3) to Peroxisome biogenesis disorder 9B, MIM# 614879; Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.786 | PEX7 | Zornitza Stark Publications for gene: PEX7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.785 | PEX6 | Zornitza Stark Marked gene: PEX6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.785 | PEX6 | Zornitza Stark Gene: pex6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.785 | PEX6 | Zornitza Stark Phenotypes for gene: PEX6 were changed from Peroxisome biogenesis disorder 4A (Zellweger), 614862 to Peroxisome biogenesis disorder 4A (Zellweger), MIM# 614862; Peroxisome biogenesis disorder-4B, MIM# 614863 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.784 | PEX6 | Zornitza Stark Publications for gene: PEX6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.783 | PEX5 | Zornitza Stark Marked gene: PEX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.783 | PEX5 | Zornitza Stark Gene: pex5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.783 | PEX5 | Zornitza Stark Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger), 214110 to Peroxisome biogenesis disorder 2A (Zellweger), MIM#214110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.782 | PEX5 | Zornitza Stark Publications for gene: PEX5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.781 | PEX26 | Zornitza Stark Marked gene: PEX26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.781 | PEX26 | Zornitza Stark Gene: pex26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.781 | PEX26 | Zornitza Stark Phenotypes for gene: PEX26 were changed from Peroxisome biogenesis disorder 7A (Zellweger), 614872 to Peroxisome biogenesis disorder 7A (Zellweger) - MIM#614872, MONDO:0013938; Peroxisome biogenesis disorder 7B - MIM#614873, MONDO:0013939 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.780 | PEX26 | Zornitza Stark Publications for gene: PEX26 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.779 | PEX2 | Zornitza Stark Marked gene: PEX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.779 | PEX2 | Zornitza Stark Gene: pex2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.779 | PEX2 | Zornitza Stark Phenotypes for gene: PEX2 were changed from Peroxisome biogenesis disorder 5A (Zellweger), 614866 to Peroxisome biogenesis disorder 5A (Zellweger), MIM#614866; Peroxisome biogenesis disorder 5B, MIM#614867 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.778 | PEX2 | Zornitza Stark Publications for gene: PEX2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.777 | PEX16 | Zornitza Stark Marked gene: PEX16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.777 | PEX16 | Zornitza Stark Gene: pex16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.777 | PEX16 | Zornitza Stark Phenotypes for gene: PEX16 were changed from Peroxisome biogenesis disorder 8A, (Zellweger), 614876 to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876; Peroxisome biogenesis disorder 8B MIM#614877 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.776 | PEX16 | Zornitza Stark Publications for gene: PEX16 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.775 | PEX13 | Zornitza Stark Marked gene: PEX13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.775 | PEX13 | Zornitza Stark Gene: pex13 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.775 | PEX13 | Zornitza Stark Phenotypes for gene: PEX13 were changed from Peroxisome biogenesis disorder 11A (Zellweger), 614883 to Peroxisome biogenesis disorder 11A (Zellweger), MIM#614883; Peroxisome biogenesis disorder 11B, MIM#614885 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.774 | PEX12 | Zornitza Stark Marked gene: PEX12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.774 | PEX12 | Zornitza Stark Gene: pex12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.774 | PEX12 | Zornitza Stark Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger), 614859 to Peroxisome biogenesis disorder 3A (Zellweger), MIM#614859; Peroxisome biogenesis disorder 3B, MIM#266510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.773 | PEX10 | Zornitza Stark Marked gene: PEX10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.773 | PEX10 | Zornitza Stark Gene: pex10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.773 | PEX10 | Zornitza Stark Phenotypes for gene: PEX10 were changed from Peroxisome biogenesis disorder 6A (Zellweger), 614870 to Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870; Peroxisome biogenesis disorder 6B MIM#614871 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.772 | PEX10 | Zornitza Stark Publications for gene: PEX10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.771 | PEX1 | Zornitza Stark Marked gene: PEX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.771 | PEX1 | Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.771 | PEX1 | Zornitza Stark Phenotypes for gene: PEX1 were changed from Peroxisome biogenesis disorder 1A (Zellweger), 214100 to Peroxisome biogenesis disorder 1A (Zellweger), MIM #214100; Heimler syndrome 1, MIM #234580; Peroxisome biogenesis disorder 1B (NALD/IRD), MIM #601539; MONDO:0100259 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.770 | PEX1 | Zornitza Stark Publications for gene: PEX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.769 | PET100 | Zornitza Stark Marked gene: PET100 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.769 | PET100 | Zornitza Stark Gene: pet100 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.769 | PET100 | Zornitza Stark Phenotypes for gene: PET100 were changed from Mitochondrial complex IV deficiency, 220110 (3) to Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.768 | PEPD | Zornitza Stark Marked gene: PEPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.768 | PEPD | Zornitza Stark Gene: pepd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.768 | PEPD | Zornitza Stark Phenotypes for gene: PEPD were changed from Prolidase deficiency, 170100 (3) to Prolidase deficiency, MIM# 170100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.767 | PEPD | Zornitza Stark Publications for gene: PEPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.766 | PDHB | Zornitza Stark Marked gene: PDHB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.766 | PDHB | Zornitza Stark Gene: pdhb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.766 | PDHB | Zornitza Stark Phenotypes for gene: PDHB were changed from Pyruvate dehydrogenase E1-beta deficiency, 614111 (3) to Pyruvate dehydrogenase E1-beta deficiency, MIM #614111 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.765 | PDHB | Zornitza Stark Publications for gene: PDHB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.764 | PDHA1 | Zornitza Stark Marked gene: PDHA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.764 | PDHA1 | Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.764 | PCNT | Zornitza Stark Marked gene: PCNT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.764 | PCNT | Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.764 | PCNT | Zornitza Stark Phenotypes for gene: PCNT were changed from Microcephalic osteodysplastic primordial dwarfism, type II, 210720 (3) to Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720; MONDO:0008872 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.763 | PCNT | Zornitza Stark Publications for gene: PCNT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.762 | PCDH19 | Zornitza Stark changed review comment from: Severe condition meets criteria for screening. Note it needs special filtering.; to: Severe condition meets criteria for screening. Note it needs special filtering to detect male carriers at risk of having affected female children. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.762 | PCDH19 | Zornitza Stark Marked gene: PCDH19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.762 | PCDH19 | Zornitza Stark Gene: pcdh19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.762 | PCDH15 | Zornitza Stark Marked gene: PCDH15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.762 | PCDH15 | Zornitza Stark Gene: pcdh15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.762 | PCDH15 | Zornitza Stark Phenotypes for gene: PCDH15 were changed from Usher syndrome, type 1F, 602083 (3) to Usher syndrome, type 1F, MIM# 602083 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.761 | PCDH15 | Zornitza Stark Publications for gene: PCDH15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.760 | PCCB | Zornitza Stark Marked gene: PCCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.760 | PCCB | Zornitza Stark Gene: pccb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.760 | PCCB | Zornitza Stark Phenotypes for gene: PCCB were changed from Propionicacidemia, 606054 (3) to Propionicacidemia MIM#606054; propionic acidemia MONDO:0011628 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.759 | PCCB | Zornitza Stark Publications for gene: PCCB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.758 | PCCA | Zornitza Stark Marked gene: PCCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.758 | PCCA | Zornitza Stark Gene: pcca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.758 | PCCA | Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, MIM#606054 to Propionicacidaemia, MIM#606054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.757 | PCCA | Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, 606054 (3) to Propionicacidemia, MIM#606054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.756 | PCCA | Zornitza Stark Publications for gene: PCCA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.755 | PC | Zornitza Stark Marked gene: PC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.755 | PC | Zornitza Stark Gene: pc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.755 | PC | Zornitza Stark Phenotypes for gene: PC were changed from Pyruvate carboxylase deficiency, 266150 (3) to Pyruvate carboxylase deficiency (MIM#266150) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.754 | PC | Zornitza Stark Publications for gene: PC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.753 | PANK2 | Zornitza Stark Marked gene: PANK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.753 | PANK2 | Zornitza Stark Gene: pank2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.753 | PANK2 | Zornitza Stark Phenotypes for gene: PANK2 were changed from Neurodegeneration with brain iron accumulation 1, MIM#234200 to HARP syndrome (MIM#607236); Neurodegeneration with brain iron accumulation 1 (MIM#234200) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.752 | PAK3 | Zornitza Stark Marked gene: PAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.752 | PAK3 | Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.752 | PAK3 | Zornitza Stark Phenotypes for gene: PAK3 were changed from Mental retardation, X-linked 30/47, 300558 (3) to Intellectual developmental disorder, X-linked 30 MIM#300558 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.751 | PAK3 | Zornitza Stark Publications for gene: PAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.750 | PAH | Zornitza Stark Marked gene: PAH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.750 | PAH | Zornitza Stark Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.750 | PAH | Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria,MIM#261600 to Phenylketonuria, MIM#261600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.749 | PAH | Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria, 261600 (3) to Phenylketonuria,MIM#261600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.748 | PAH | Zornitza Stark Publications for gene: PAH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.747 | P3H1 | Zornitza Stark Marked gene: P3H1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.747 | P3H1 | Zornitza Stark Gene: p3h1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.747 | P3H1 | Zornitza Stark Phenotypes for gene: P3H1 were changed from Osteogenesis imperfecta, type VIII, 610915 (3) to Osteogenesis imperfecta, type VIII, MIM#610915 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.746 | P3H1 | Zornitza Stark Publications for gene: P3H1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.121 | TRPM4 | Zornitza Stark Phenotypes for gene: TRPM4 were changed from Progressive familial heart block, type IB 604559 to Progressive familial heart block, type IB, MIM# 604559 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.120 | TRPM4 | Zornitza Stark Classified gene: TRPM4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.120 | TRPM4 | Zornitza Stark Gene: trpm4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.119 | TRPM4 | Zornitza Stark reviewed gene: TRPM4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Progressive familial heart block, type IB, MIM# 604559; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.119 | KCNE2 | Zornitza Stark Marked gene: KCNE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.119 | KCNE2 | Zornitza Stark Gene: kcne2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.119 | KCNE2 | Zornitza Stark Phenotypes for gene: KCNE2 were changed from Long QT syndrome-6 to Long QT syndrome 6, MIM# 613693 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.118 | KCNE2 | Zornitza Stark Classified gene: KCNE2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.118 | KCNE2 | Zornitza Stark Gene: kcne2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.117 | KCNE2 | Zornitza Stark edited their review of gene: KCNE2: Changed phenotypes: Long QT syndrome 6, MIM# 613693 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.117 | KCNE2 | Zornitza Stark reviewed gene: KCNE2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.745 | OTC | Zornitza Stark Marked gene: OTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.745 | OTC | Zornitza Stark Gene: otc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.745 | OTC | Zornitza Stark Phenotypes for gene: OTC were changed from Ornithine transcarbamylase deficiency, 311250 (3) to Ornithine transcarbamylase deficiency, MIM# 311250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.744 | OTC | Zornitza Stark Publications for gene: OTC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.743 | OSTM1 | Zornitza Stark Marked gene: OSTM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.743 | OSTM1 | Zornitza Stark Gene: ostm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.743 | OSTM1 | Zornitza Stark Phenotypes for gene: OSTM1 were changed from Osteopetrosis, autosomal recessive 5, 259720 (3) to Osteopetrosis, autosomal recessive 5, MIM#259720 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.742 | OSTM1 | Zornitza Stark Publications for gene: OSTM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.741 | OPHN1 | Zornitza Stark Marked gene: OPHN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.741 | OPHN1 | Zornitza Stark Gene: ophn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.741 | OPHN1 | Zornitza Stark Phenotypes for gene: OPHN1 were changed from Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 (3) to Intellectual developmental disorder, X-linked syndromic, Billuart type MIM#300486; X-linked intellectual disability-cerebellar hypoplasia syndrome MONDO:0010337 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.740 | OPHN1 | Zornitza Stark Publications for gene: OPHN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.739 | OPA3 | Zornitza Stark Marked gene: OPA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.739 | OPA3 | Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.739 | OPA3 | Zornitza Stark Phenotypes for gene: OPA3 were changed from 3-methylglutaconic aciduria, type III, 258501 (3) to 3-methylglutaconic aciduria, type III MIM#258501; 3-methylglutaconic aciduria type 3 MONDO:0009787 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.738 | OPA3 | Zornitza Stark Publications for gene: OPA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.737 | OPA1 | Zornitza Stark Marked gene: OPA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.737 | OPA1 | Zornitza Stark Gene: opa1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.737 | OPA1 | Zornitza Stark Phenotypes for gene: OPA1 were changed from Behr syndrome, 210000 (3), Autosomal recessive to Behr syndrome, MIM#210000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.736 | OPA1 | Zornitza Stark Publications for gene: OPA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.735 | OFD1 | Zornitza Stark Marked gene: OFD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.735 | OFD1 | Zornitza Stark Gene: ofd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.735 | OFD1 | Zornitza Stark Phenotypes for gene: OFD1 were changed from Joubert syndrome 10, 300804 (3) to Joubert syndrome 10 MIM#300804; Simpson-Golabi-Behmel syndrome, type 2 MIM#300209; Retinitis pigmentosa 23 MIM#300424 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.734 | OFD1 | Zornitza Stark Publications for gene: OFD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.733 | OCRL | Zornitza Stark Marked gene: OCRL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.733 | OCRL | Zornitza Stark Gene: ocrl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.733 | OCRL | Zornitza Stark Phenotypes for gene: OCRL were changed from Lowe syndrome, 309000 (3) to Dent disease 2 MIM#300555; Lowe syndrome MIM#309000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.732 | OCRL | Zornitza Stark Publications for gene: OCRL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.731 | NTRK1 | Zornitza Stark Marked gene: NTRK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.731 | NTRK1 | Zornitza Stark Gene: ntrk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.731 | NTRK1 | Zornitza Stark Phenotypes for gene: NTRK1 were changed from Insensitivity to pain, congenital, with anhidrosis, 256800 (3) to Insensitivity to pain, congenital, with anhidrosis MIM#256800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.730 | NTRK1 | Zornitza Stark Publications for gene: NTRK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.729 | NR0B1 | Zornitza Stark Marked gene: NR0B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.729 | NR0B1 | Zornitza Stark Gene: nr0b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.729 | NR0B1 | Zornitza Stark Phenotypes for gene: NR0B1 were changed from 46XY sex reversal 2, dosage-sensitive, 300018 (3) to Adrenal hypoplasia, congenital, MIM#300200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.728 | NR0B1 | Zornitza Stark Publications for gene: NR0B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.727 | NPHS2 | Zornitza Stark Marked gene: NPHS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.727 | NPHS2 | Zornitza Stark Gene: nphs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.727 | NPHS2 | Zornitza Stark Phenotypes for gene: NPHS2 were changed from Nephrotic syndrome, type 2, 600995 (3) to Nephrotic syndrome, type 2 MIM#600995 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.726 | NPHS2 | Zornitza Stark Publications for gene: NPHS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.725 | NPHS1 | Zornitza Stark Marked gene: NPHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.725 | NPHS1 | Zornitza Stark Gene: nphs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.725 | NPHS1 | Zornitza Stark Phenotypes for gene: NPHS1 were changed from Nephrotic syndrome, type 1, 256300 (3) to Nephrotic syndrome, type 1, MIM# 256300; congenital nephrotic syndrome, Finnish type MONDO:0009732 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.724 | NPHS1 | Zornitza Stark Publications for gene: NPHS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.723 | NPHP3 | Zornitza Stark Marked gene: NPHP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.723 | NPHP3 | Zornitza Stark Gene: nphp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.723 | NPHP3 | Zornitza Stark Phenotypes for gene: NPHP3 were changed from Meckel syndrome 7, 267010 (3) to Renal-hepatic-pancreatic dysplasia 1 MIM#208540; Meckel syndrome 7 MIM#267010; Nephronophthisis 3 MIM#604387 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.722 | NPHP1 | Zornitza Stark Marked gene: NPHP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.722 | NPHP1 | Zornitza Stark Gene: nphp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.722 | NPHP1 | Zornitza Stark Phenotypes for gene: NPHP1 were changed from Joubert syndrome 4, 609583 (3) to Nephronophthisis 1, juvenile MIM#256100; Joubert syndrome 4 MIM#609583; Senior-Loken syndrome-1 MIM#266900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.721 | NPC2 | Zornitza Stark Marked gene: NPC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.721 | NPC2 | Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.721 | NPC1 | Zornitza Stark Marked gene: NPC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.721 | NPC1 | Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.721 | NPC1 | Zornitza Stark Publications for gene: NPC1 were set to 11333381; 26910362 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.720 | NNT | Zornitza Stark Marked gene: NNT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.720 | NNT | Zornitza Stark Gene: nnt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.720 | NNT | Zornitza Stark Phenotypes for gene: NNT were changed from Glucocorticoid deficiency 4, 614736 (3) to Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency MIM#614736; MONDO:0013874 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.719 | NNT | Zornitza Stark Publications for gene: NNT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.718 | NGLY1 | Zornitza Stark Marked gene: NGLY1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.718 | NGLY1 | Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.718 | NGLY1 | Zornitza Stark Phenotypes for gene: NGLY1 were changed from Congenital disorder of deglycosylation, 615273 (3) to Congenital disorder of deglycosylation, MIM#615273 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.717 | NGLY1 | Zornitza Stark Publications for gene: NGLY1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.716 | NEU1 | Zornitza Stark Marked gene: NEU1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.716 | NEU1 | Zornitza Stark Gene: neu1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.716 | NEU1 | Zornitza Stark Phenotypes for gene: NEU1 were changed from Sialidosis, type I, 256550 (3) to Sialidosis, type I, MIM #256550; Sialidosis, type II, MIM #256550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.715 | NEU1 | Zornitza Stark Publications for gene: NEU1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.714 | NEB | Zornitza Stark Marked gene: NEB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.714 | NEB | Zornitza Stark Gene: neb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.714 | NEB | Zornitza Stark Publications for gene: NEB were set to 27228465 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.713 | NDUFV1 | Zornitza Stark Marked gene: NDUFV1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.713 | NDUFV1 | Zornitza Stark Gene: ndufv1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.713 | NDUFV1 | Zornitza Stark Phenotypes for gene: NDUFV1 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 4 MIM#618225 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.712 | NDUFV1 | Zornitza Stark Publications for gene: NDUFV1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.711 | NDUFS7 | Zornitza Stark Marked gene: NDUFS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.711 | NDUFS7 | Zornitza Stark Gene: ndufs7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.711 | NDUFS7 | Zornitza Stark Phenotypes for gene: NDUFS7 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 3 MIM#618224 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.710 | NDUFS7 | Zornitza Stark Publications for gene: NDUFS7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.709 | NDUFS6 | Zornitza Stark Marked gene: NDUFS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.709 | NDUFS6 | Zornitza Stark Gene: ndufs6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.709 | NDUFS6 | Zornitza Stark Phenotypes for gene: NDUFS6 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 9 (MIM#618232) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.708 | NDUFS6 | Zornitza Stark Publications for gene: NDUFS6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.707 | NDUFS4 | Zornitza Stark Marked gene: NDUFS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.707 | NDUFS4 | Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.707 | NDUFS4 | Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 1, MIM#252010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.706 | NDUFAF5 | Zornitza Stark Marked gene: NDUFAF5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.706 | NDUFAF5 | Zornitza Stark Gene: ndufaf5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.706 | NDUFAF5 | Zornitza Stark Phenotypes for gene: NDUFAF5 were changed from Mitochondrial complex 1 deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 16 MIM#618238 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.705 | NDUFAF2 | Zornitza Stark Marked gene: NDUFAF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.705 | NDUFAF2 | Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.705 | NDUFAF2 | Zornitza Stark Phenotypes for gene: NDUFAF2 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 10, MIM#618233 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.704 | NDUFAF2 | Zornitza Stark Publications for gene: NDUFAF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.703 | NDRG1 | Zornitza Stark Marked gene: NDRG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.703 | NDRG1 | Zornitza Stark Gene: ndrg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.703 | NDRG1 | Zornitza Stark Phenotypes for gene: NDRG1 were changed from Charcot-Marie-Tooth disease, type 4D, 601455 (3) to Charcot-Marie-Tooth disease, type 4D MIM#601455 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.702 | NDP | Zornitza Stark Marked gene: NDP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.702 | NDP | Zornitza Stark Gene: ndp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.702 | NDP | Zornitza Stark Phenotypes for gene: NDP were changed from Norrie disease, 310600 (3) to Norrie disease, MIM# 310600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.701 | NDP | Zornitza Stark Publications for gene: NDP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.700 | NDE1 | Zornitza Stark Marked gene: NDE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.700 | NDE1 | Zornitza Stark Gene: nde1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.700 | NDE1 | Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), 614019 (3) to Lissencephaly 4 (with microcephaly), MIM#614019 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.699 | NDE1 | Zornitza Stark Publications for gene: NDE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.698 | NCF2 | Zornitza Stark Marked gene: NCF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.698 | NCF2 | Zornitza Stark Gene: ncf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.698 | NCF2 | Zornitza Stark Phenotypes for gene: NCF2 were changed from Chronic granulomatous disease due to deficiency of NCF-2, 233710 (3) to Chronic granulomatous disease 2, autosomal recessive, MIM# 233710 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.697 | NCF2 | Zornitza Stark Publications for gene: NCF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.696 | NBN | Zornitza Stark Marked gene: NBN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.696 | NBN | Zornitza Stark Gene: nbn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.696 | NBN | Zornitza Stark Phenotypes for gene: NBN were changed from Nijmegen breakage syndrome, 251260 (3) to Nijmegen breakage syndrome (MIM#251260) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.695 | NBN | Zornitza Stark Publications for gene: NBN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.694 | NARS2 | Zornitza Stark Marked gene: NARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.694 | NARS2 | Zornitza Stark Gene: nars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.694 | NARS2 | Zornitza Stark Phenotypes for gene: NARS2 were changed from Combined oxidative phosphorylation deficiency 24, 616239 (3) to Combined oxidative phosphorylation deficiency 24 - MIM#616239, MONDO:0014547 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.693 | NARS2 | Zornitza Stark Publications for gene: NARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.692 | NALCN | Zornitza Stark Marked gene: NALCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.692 | NALCN | Zornitza Stark Gene: nalcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.692 | NALCN | Zornitza Stark Phenotypes for gene: NALCN were changed from Hypotonia, infantile, with psychomotor retardation and characteristic facies, 615419 (3) to Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 (MIM#615419) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.691 | NALCN | Zornitza Stark Publications for gene: NALCN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.690 | NAGS | Zornitza Stark Marked gene: NAGS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.690 | NAGS | Zornitza Stark Gene: nags has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.690 | NAGS | Zornitza Stark Phenotypes for gene: NAGS were changed from N-acetylglutamate synthase deficiency, 237310 (3) to N-acetylglutamate synthase deficiency MIM#237310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.689 | NAGS | Zornitza Stark Publications for gene: NAGS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.688 | NAGLU | Zornitza Stark Marked gene: NAGLU as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.688 | NAGLU | Zornitza Stark Gene: naglu has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.688 | NAGLU | Zornitza Stark Phenotypes for gene: NAGLU were changed from Mucopolysaccharidosis type IIIB (Sanfilippo B), 252920 (3) to Mucopolysaccharidosis type IIIB (Sanfilippo B) MIM#252920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.687 | NAGLU | Zornitza Stark Publications for gene: NAGLU were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.686 | NAGA | Zornitza Stark Marked gene: NAGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.686 | NAGA | Zornitza Stark Gene: naga has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.686 | NAGA | Zornitza Stark Phenotypes for gene: NAGA were changed from Schindler disease, type I, 609241 (3) to Schindler disease, type I MIM#609241; Schindler disease, type III MIM#609241 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.685 | NAGA | Zornitza Stark Publications for gene: NAGA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.684 | MYO7A | Zornitza Stark Marked gene: MYO7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.684 | MYO7A | Zornitza Stark Gene: myo7a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.684 | MYO7A | Zornitza Stark Phenotypes for gene: MYO7A were changed from Usher syndrome, type 1B, 276900 (3) to Usher syndrome, type 1B, MIM# 276900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.683 | MYO7A | Zornitza Stark Publications for gene: MYO7A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.682 | MYO5B | Zornitza Stark Marked gene: MYO5B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.682 | MYO5B | Zornitza Stark Gene: myo5b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.682 | MYO5B | Zornitza Stark Phenotypes for gene: MYO5B were changed from Microvillus inclusion disease, 251850 (3) to Cholestasis, progressive familial intrahepatic, 10, MIM#619868; Diarrhea 2, with microvillus atrophy, with or without cholestasis, MIM#251850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.681 | MYO5B | Zornitza Stark Publications for gene: MYO5B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.680 | MVK | Zornitza Stark Marked gene: MVK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.680 | MVK | Zornitza Stark Gene: mvk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.680 | MVK | Zornitza Stark Phenotypes for gene: MVK were changed from Mevalonic aciduria, 610377 (3) to Mevalonic aciduria, MIM#610377; Hyper-IgD syndrome, MIM#260920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.679 | MVK | Zornitza Stark Publications for gene: MVK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.678 | MUT | Zornitza Stark Marked gene: MUT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.678 | MUT | Zornitza Stark Gene: mut has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.678 | MUT | Zornitza Stark Phenotypes for gene: MUT were changed from Methylmalonic aciduria, mut(0) type, 251000 (3) to Methylmalonic aciduria, mut(0) type, MIM# 251000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.677 | MUSK | Zornitza Stark Marked gene: MUSK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.677 | MUSK | Zornitza Stark Gene: musk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.677 | MUSK | Zornitza Stark Phenotypes for gene: MUSK were changed from Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 (3) to Fetal akinesia deformation sequence 1 MIM#208150; Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.676 | MUSK | Zornitza Stark Publications for gene: MUSK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.675 | MTTP | Zornitza Stark Marked gene: MTTP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.675 | MTTP | Zornitza Stark Gene: mttp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.675 | MTTP | Zornitza Stark Phenotypes for gene: MTTP were changed from Abetalipoproteinemia, 200100 (3) to Abetalipoproteinaemia MIM#200100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.674 | MTTP | Zornitza Stark Publications for gene: MTTP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.673 | MTRR | Zornitza Stark Marked gene: MTRR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.673 | MTRR | Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.673 | MTRR | Zornitza Stark Phenotypes for gene: MTRR were changed from Homocystinuria-megaloblastic anemia, cbl E type, 236270 (3) to Homocystinuria-megaloblastic anemia, cbl E type, MIM #236270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.672 | MTRR | Zornitza Stark Publications for gene: MTRR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.671 | MTR | Zornitza Stark Marked gene: MTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.671 | MTR | Zornitza Stark Gene: mtr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.671 | MTR | Zornitza Stark Phenotypes for gene: MTR were changed from Homocystinuria-megaloblastic anemia, cblG complementation type, 250940 (3) to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.670 | MTR | Zornitza Stark Publications for gene: MTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.669 | MTMR2 | Zornitza Stark Marked gene: MTMR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.669 | MTMR2 | Zornitza Stark Gene: mtmr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.669 | MTMR2 | Zornitza Stark Phenotypes for gene: MTMR2 were changed from Charcot-Marie-Tooth disease, type 4B1, 601382 (3) to Charcot-Marie-Tooth disease, type 4B1, MIM#601382 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.668 | MTM1 | Zornitza Stark Marked gene: MTM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.668 | MTM1 | Zornitza Stark Gene: mtm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.668 | MTM1 | Zornitza Stark Phenotypes for gene: MTM1 were changed from Myotubular myopathy, X-linked, 310400 (3) to Myopathy, centronuclear, X-linked MIM#310400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.667 | MTM1 | Zornitza Stark Publications for gene: MTM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.666 | MTHFR | Zornitza Stark Marked gene: MTHFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.666 | MTHFR | Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.666 | MTHFR | Zornitza Stark Phenotypes for gene: MTHFR were changed from Homocystinuria due to MTHFR deficiency, 236250 (3) to Homocystinuria due to MTHFR deficiency, MIM# 236250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.665 | MTHFR | Zornitza Stark Publications for gene: MTHFR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.664 | MTFMT | Zornitza Stark Marked gene: MTFMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.664 | MTFMT | Zornitza Stark Gene: mtfmt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.664 | MTFMT | Zornitza Stark Phenotypes for gene: MTFMT were changed from Combined oxidative phosphorylation deficiency 15, 614947 (3) to Combined oxidative phosphorylation deficiency 15, MIM#614947 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.663 | MTFMT | Zornitza Stark Publications for gene: MTFMT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.662 | MRE11 | Zornitza Stark Marked gene: MRE11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.662 | MRE11 | Zornitza Stark Gene: mre11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.662 | MRE11 | Zornitza Stark Phenotypes for gene: MRE11 were changed from Ataxia-telangiectasia-like disorder, 604391 (3) to Ataxia-telangiectasia-like disorder, MIM#604391 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.661 | MRE11 | Zornitza Stark Publications for gene: MRE11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.660 | MPV17 | Zornitza Stark Marked gene: MPV17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.660 | MPV17 | Zornitza Stark Gene: mpv17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.660 | MPV17 | Zornitza Stark Phenotypes for gene: MPV17 were changed from Mitochondrial DNA depletion syndrome 6 (hepatocerebral type), 256810 (3) to Charcot-Marie-Tooth disease, axonal, type 2EE, MIM#618400; Mitochondrial DNA depletion syndrome 6 (hepatocerebral type), MIM#256810 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.659 | MPV17 | Zornitza Stark Publications for gene: MPV17 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.658 | MPL | Zornitza Stark Marked gene: MPL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.658 | MPL | Zornitza Stark Gene: mpl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.658 | MPL | Zornitza Stark Phenotypes for gene: MPL were changed from Thrombocytopenia, congenital amegakaryocytic, 604498 (3) to Amegakaryocytic thrombocytopenia, congenital, 1, MIM# 604498 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.657 | MPL | Zornitza Stark Publications for gene: MPL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.656 | MPI | Zornitza Stark Marked gene: MPI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.656 | MPI | Zornitza Stark Gene: mpi has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.656 | MPI | Zornitza Stark Phenotypes for gene: MPI were changed from Congenital disorder of glycosylation, type Ib, 602579 (3) to Congenital disorder of glycosylation, type Ib, MIM# 602579 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.655 | MPI | Zornitza Stark Publications for gene: MPI were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.654 | MOCS2 | Zornitza Stark Marked gene: MOCS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.654 | MOCS2 | Zornitza Stark Gene: mocs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.654 | MOCS2 | Zornitza Stark Phenotypes for gene: MOCS2 were changed from Molybdenum cofactor deficiency B, 252160 (3) to Molybdenum cofactor deficiency B (MIM#252160) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.653 | MOCS2 | Zornitza Stark Publications for gene: MOCS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.652 | MOCS1 | Zornitza Stark Marked gene: MOCS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.652 | MOCS1 | Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.652 | MOCS1 | Zornitza Stark Phenotypes for gene: MOCS1 were changed from Molybdenum cofactor deficiency A, 252150 (3) to Molybdenum cofactor deficiency A (MIM#252150) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.651 | MOCS1 | Zornitza Stark Publications for gene: MOCS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.650 | MMADHC | Zornitza Stark Marked gene: MMADHC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.650 | MMADHC | Zornitza Stark Gene: mmadhc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.650 | MMADHC | Zornitza Stark Phenotypes for gene: MMADHC were changed from Methylmalonic aciduria and homocystinuria, cblD type, 277410 (3) to Homocystinuria, cblD type, variant 1 MIM#277410; Methylmalonic aciduria and homocystinuria, cblD type MIM#277410; Methylmalonic aciduria, cblD type, variant 2 MIM#277410; Disorders of cobalamin absorption, transport and metabolism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.649 | MMADHC | Zornitza Stark Publications for gene: MMADHC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.648 | MMACHC | Zornitza Stark Marked gene: MMACHC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.648 | MMACHC | Zornitza Stark Gene: mmachc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.648 | MMACHC | Zornitza Stark Phenotypes for gene: MMACHC were changed from Methylmalonic aciduria and homocystinuria, cblC type, 277400 (3) to Methylmalonic aciduria and homocystinuria, cblC type MIM#277400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.647 | MMACHC | Zornitza Stark Publications for gene: MMACHC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.646 | MMAB | Zornitza Stark Marked gene: MMAB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.646 | MMAB | Zornitza Stark Gene: mmab has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.646 | MMAB | Zornitza Stark Phenotypes for gene: MMAB were changed from Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type, 251110 (3) to Methylmalonic aciduria, vitamin B12-responsive, cblB type MIM#251110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.645 | MMAB | Zornitza Stark Publications for gene: MMAB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.644 | MMAA | Zornitza Stark Marked gene: MMAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.644 | MMAA | Zornitza Stark Gene: mmaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.644 | MMAA | Zornitza Stark Phenotypes for gene: MMAA were changed from Methylmalonic aciduria, vitamin B12-responsive, 251100 (3) to Methylmalonic aciduria, vitamin B12-responsive, MIM#251100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.643 | MLYCD | Zornitza Stark Marked gene: MLYCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.643 | MLYCD | Zornitza Stark Gene: mlycd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.643 | MLYCD | Zornitza Stark Phenotypes for gene: MLYCD were changed from Malonyl-CoA decarboxylase deficiency, 248360 (3) to Malonyl-CoA decarboxylase deficiency, MIM#248360 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.642 | MLC1 | Zornitza Stark Marked gene: MLC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.642 | MLC1 | Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.642 | MLC1 | Zornitza Stark Phenotypes for gene: MLC1 were changed from Megalencephalic leukoencephalopathy with subcortical cysts, 604004 (3) to Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.641 | MLC1 | Zornitza Stark Publications for gene: MLC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.640 | MKS1 | Zornitza Stark Marked gene: MKS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.640 | MKS1 | Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.640 | MKS1 | Zornitza Stark Phenotypes for gene: MKS1 were changed from Meckel syndrome 1, 249000 (3) to Bardet-Biedl syndrome 13 MIM#615990; Joubert syndrome 28 MIM#617121; Meckel syndrome 1 MIM#249000; Ciliopathy MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.639 | MKS1 | Zornitza Stark Publications for gene: MKS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.638 | MKKS | Zornitza Stark Marked gene: MKKS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.638 | MKKS | Zornitza Stark Gene: mkks has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.638 | MKKS | Zornitza Stark Phenotypes for gene: MKKS were changed from McKusick-Kaufman syndrome, 236700 (3) to Bardet-Biedl syndrome 6 MIM#605231; McKusick-Kaufman syndrome MIM#236700; MKKS-related ciliopathy MONDO:1040050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.637 | MKKS | Zornitza Stark Publications for gene: MKKS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.636 | MID1 | Zornitza Stark Marked gene: MID1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.636 | MID1 | Zornitza Stark Gene: mid1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.636 | MID1 | Zornitza Stark Phenotypes for gene: MID1 were changed from Opitz GBBB syndrome, type I, 300000 (3) to Opitz GBBB syndrome MIM#300000; MONDO:0017138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.635 | MID1 | Zornitza Stark Publications for gene: MID1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.634 | MFSD8 | Zornitza Stark Marked gene: MFSD8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.634 | MFSD8 | Zornitza Stark Gene: mfsd8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.634 | MFSD8 | Zornitza Stark Phenotypes for gene: MFSD8 were changed from Ceroid lipofuscinosis, neuronal, 7, 610951 (3) to Ceroid lipofuscinosis, neuronal, 7, MIM# 610951; MONDO:0012588 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.633 | MFSD8 | Zornitza Stark Publications for gene: MFSD8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.632 | MFN2 | Zornitza Stark Marked gene: MFN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.632 | MFN2 | Zornitza Stark Gene: mfn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.632 | MFN2 | Zornitza Stark Phenotypes for gene: MFN2 were changed from Charcot-Marie-Tooth disease, axonal, type 2A2B, 617087 (3), Autosomal recessive to Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.631 | MFN2 | Zornitza Stark Publications for gene: MFN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.630 | METTL23 | Zornitza Stark Marked gene: METTL23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.630 | METTL23 | Zornitza Stark Gene: mettl23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.630 | METTL23 | Zornitza Stark Phenotypes for gene: METTL23 were changed from Mental retardation, autosomal recessive 44, 615942 (3) to Intellectual developmental disorder, autosomal recessive 44, MIM #615942 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.629 | METTL23 | Zornitza Stark Publications for gene: METTL23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.628 | MESP2 | Zornitza Stark Marked gene: MESP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.628 | MESP2 | Zornitza Stark Gene: mesp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.628 | MESP2 | Zornitza Stark Phenotypes for gene: MESP2 were changed from Spondylocostal dysostosis 2, autosomal recessive, 608681 (3) to Spondylocostal dysostosis 2, MIM #608681 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.627 | MESP2 | Zornitza Stark Publications for gene: MESP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.626 | MED17 | Zornitza Stark Marked gene: MED17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.626 | MED17 | Zornitza Stark Gene: med17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.626 | MED17 | Zornitza Stark Phenotypes for gene: MED17 were changed from Microcephaly, postnatal progressive, with seizures and brain atrophy, 613668 (3) to Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM#613668 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.625 | MED17 | Zornitza Stark Publications for gene: MED17 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.624 | MED12 | Zornitza Stark Marked gene: MED12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.624 | MED12 | Zornitza Stark Gene: med12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.624 | MED12 | Zornitza Stark Phenotypes for gene: MED12 were changed from Lujan-Fryns syndrome, 309520 (3) to MED12-related intellectual disability syndrome, MONDO:0100000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.623 | MED12 | Zornitza Stark Publications for gene: MED12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.622 | MECP2 | Zornitza Stark Marked gene: MECP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.622 | MECP2 | Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.622 | MECP2 | Zornitza Stark Phenotypes for gene: MECP2 were changed from Encephalopathy, neonatal severe, 300673 (3) to Encephalopathy, neonatal severe MIM#300673; Intellectual developmental disorder, X-linked syndromic 13 MIM#300055; Intellectual developmental disorder, X-linked syndromic, Lubs type MIM#300260 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.621 | MECP2 | Zornitza Stark Publications for gene: MECP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.620 | MCPH1 | Zornitza Stark Marked gene: MCPH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.620 | MCPH1 | Zornitza Stark Gene: mcph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.620 | MCPH1 | Zornitza Stark Phenotypes for gene: MCPH1 were changed from Microcephaly 1, primary, autosomal recessive, 251200 (3) to Microcephaly 1, primary, autosomal recessive, MIM#251200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.619 | MCPH1 | Zornitza Stark Publications for gene: MCPH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.618 | MCOLN1 | Zornitza Stark Marked gene: MCOLN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.618 | MCOLN1 | Zornitza Stark Gene: mcoln1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.618 | MCOLN1 | Zornitza Stark Phenotypes for gene: MCOLN1 were changed from Mucolipidosis IV, 252650 (3) to Mucolipidosis IV MIM#252650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.617 | MCOLN1 | Zornitza Stark Publications for gene: MCOLN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.616 | MASP1 | Zornitza Stark Marked gene: MASP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.616 | MASP1 | Zornitza Stark Gene: masp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.616 | MASP1 | Zornitza Stark Phenotypes for gene: MASP1 were changed from 3MC syndrome 1, 257920 (3) to 3MC syndrome 1, MIM# 257920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.615 | MASP1 | Zornitza Stark Publications for gene: MASP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.614 | MANBA | Zornitza Stark Marked gene: MANBA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.614 | MANBA | Zornitza Stark Gene: manba has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.614 | MANBA | Zornitza Stark Phenotypes for gene: MANBA were changed from Mannosidosis, beta, 248510 (3) to Mannosidosis, beta, MIM#248510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.613 | MAN2B1 | Zornitza Stark Marked gene: MAN2B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.613 | MAN2B1 | Zornitza Stark Gene: man2b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.613 | MAN2B1 | Zornitza Stark Phenotypes for gene: MAN2B1 were changed from Mannosidosis, alpha-, types I and II, 248500 (3) to Mannosidosis, alpha-, types I and II, MIM# 248500; MONDO:0009561 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.141 | LSM1 | Zornitza Stark Phenotypes for gene: LSM1 were changed from Neurodevelopmental disorder, MONDO:0700092, LSM1-related to FICUS syndrome, MIM# 621193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.140 | LSM1 | Zornitza Stark reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: FICUS syndrome, MIM# 621193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2588 | LSM1 | Zornitza Stark Phenotypes for gene: LSM1 were changed from Neurodevelopmental disorder, MONDO:0700092, LSM1-related to FICUS syndrome, MIM# 621193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2587 | LSM1 | Zornitza Stark edited their review of gene: LSM1: Changed phenotypes: FICUS syndrome, MIM# 621193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.612 | ZDHHC9 | Seb Lunke Marked gene: ZDHHC9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.612 | ZDHHC9 | Seb Lunke Gene: zdhhc9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.612 | ZDHHC9 | Seb Lunke Tag SV/CNV tag was added to gene: ZDHHC9. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.612 | ZDHHC9 | Seb Lunke Phenotypes for gene: ZDHHC9 were changed from Mental retardation, X-linked syndromic, Raymond type, 300799 (3) to Syndromic X-linked intellectual disability, Raymond type MIM#300799 MONDO:0010427 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.611 | ZDHHC9 | Seb Lunke Publications for gene: ZDHHC9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.610 | ZFYVE26 | Seb Lunke Marked gene: ZFYVE26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.610 | ZFYVE26 | Seb Lunke Gene: zfyve26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.610 | ZFYVE26 | Seb Lunke Phenotypes for gene: ZFYVE26 were changed from Spastic paraplegia 15, autosomal recessive, 270700 (3) to Spastic paraplegia 15, autosomal recessive MIM#270700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.609 | ZFYVE26 | Seb Lunke Publications for gene: ZFYVE26 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.608 | ZNF711 | Seb Lunke Marked gene: ZNF711 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.608 | ZNF711 | Seb Lunke Gene: znf711 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.608 | ZNF711 | Seb Lunke Phenotypes for gene: ZNF711 were changed from Mental retardation, X-linked 97, 300803 (3) to Intellectual developmental disorder, X-linked 97, MIM# 300803 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.12 | PUS7 | Zornitza Stark Tag for review was removed from gene: PUS7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.12 | PEX19 | Zornitza Stark Tag for review was removed from gene: PEX19. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.12 | ZNF469 | Zornitza Stark Classified gene: ZNF469 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.12 | ZNF469 | Zornitza Stark Gene: znf469 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.11 | ZNF469 | Zornitza Stark Tag for review was removed from gene: ZNF469. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.11 | TRAPPC12 | Zornitza Stark Classified gene: TRAPPC12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.11 | TRAPPC12 | Zornitza Stark Gene: trappc12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.10 | TRAPPC12 | Zornitza Stark Tag for review was removed from gene: TRAPPC12. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.10 | PUS7 | Zornitza Stark Classified gene: PUS7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.10 | PUS7 | Zornitza Stark Gene: pus7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.9 | PTPN23 | Zornitza Stark Tag for review was removed from gene: PTPN23. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.9 | PTPN23 | Zornitza Stark Classified gene: PTPN23 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.9 | PTPN23 | Zornitza Stark Gene: ptpn23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.8 | GPR143 | Zornitza Stark Tag for review was removed from gene: GPR143. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.607 | LZTFL1 | Zornitza Stark Marked gene: LZTFL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.607 | LZTFL1 | Zornitza Stark Gene: lztfl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.607 | LZTFL1 | Zornitza Stark Phenotypes for gene: LZTFL1 were changed from Bardet-Biedl syndrome 17, 615994 (3) to Bardet-Biedl syndrome 17 MIM#615994; MONDO:0014445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.606 | LZTFL1 | Zornitza Stark Publications for gene: LZTFL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.605 | LYST | Zornitza Stark Marked gene: LYST as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.605 | LYST | Zornitza Stark Gene: lyst has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.605 | LYST | Zornitza Stark Phenotypes for gene: LYST were changed from Chediak-Higashi syndrome, 214500 (3) to Chediak-Higashi syndrome MIM#214500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.604 | LYST | Zornitza Stark Publications for gene: LYST were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.603 | LRPPRC | Zornitza Stark Marked gene: LRPPRC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.603 | LRPPRC | Zornitza Stark Gene: lrpprc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.603 | LRPPRC | Zornitza Stark Phenotypes for gene: LRPPRC were changed from Leigh syndrome, French-Canadian type, 220111 (3) to Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) 220111 (3) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.602 | LRPPRC | Zornitza Stark Publications for gene: LRPPRC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.601 | LRP2 | Zornitza Stark Marked gene: LRP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.601 | LRP2 | Zornitza Stark Gene: lrp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.601 | LRP2 | Zornitza Stark Phenotypes for gene: LRP2 were changed from Donnai-Barrow syndrome, 222448 (3) to Donnai-Barrow syndrome, MIM #222448 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.600 | LRP2 | Zornitza Stark Publications for gene: LRP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.599 | LRAT | Zornitza Stark Marked gene: LRAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.599 | LRAT | Zornitza Stark Gene: lrat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.599 | LRAT | Zornitza Stark Phenotypes for gene: LRAT were changed from Leber congenital amaurosis 14, 613341 (3) to Retinal dystrophy, early-onset severe; Leber congenital amaurosis 14; Retinitis pigmentosa, juvenile, all under MIM #613341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.598 | LRAT | Zornitza Stark Publications for gene: LRAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.597 | LPL | Zornitza Stark Marked gene: LPL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.597 | LPL | Zornitza Stark Gene: lpl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.597 | LPL | Zornitza Stark Phenotypes for gene: LPL were changed from Lipoprotein lipase deficiency, 238600 (3) to Lipoprotein lipase deficiency MIM#238600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.596 | LMNA | Zornitza Stark Marked gene: LMNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.596 | LMNA | Zornitza Stark Gene: lmna has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.596 | LMNA | Zornitza Stark Phenotypes for gene: LMNA were changed from Restrictive dermopathy, lethal, 275210 (3) to Restrictive dermopathy, lethal, MIM#275210; Mandibuloacral dysplasia, MIM# 248370 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.595 | LMBRD1 | Zornitza Stark Marked gene: LMBRD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.595 | LMBRD1 | Zornitza Stark Gene: lmbrd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.595 | LMBRD1 | Zornitza Stark Phenotypes for gene: LMBRD1 were changed from Methylmalonic aciduria and homocystinuria, cblF type, 277380 (3) to Methylmalonic aciduria and homocystinuria, cblF type, MIM#277380 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.594 | LMBRD1 | Zornitza Stark Publications for gene: LMBRD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.593 | LIPA | Zornitza Stark Marked gene: LIPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.593 | LIPA | Zornitza Stark Gene: lipa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.593 | LIPA | Zornitza Stark Phenotypes for gene: LIPA were changed from Cholesteryl ester storage disease, 278000 (3) to Wolman disease, MIM#620151; Cholesteryl ester storage disease, MIM#278000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.592 | LIPA | Zornitza Stark Publications for gene: LIPA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.591 | LIG4 | Zornitza Stark Marked gene: LIG4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.591 | LIG4 | Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.591 | LIG4 | Zornitza Stark Phenotypes for gene: LIG4 were changed from LIG4 syndrome, 606593 (3) to LIG4 syndrome, MIM# 606593 DNA ligase IV deficiency, MONDO:0011686 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.590 | LIG4 | Zornitza Stark Publications for gene: LIG4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.589 | LIFR | Zornitza Stark Marked gene: LIFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.589 | LIFR | Zornitza Stark Gene: lifr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.589 | LIFR | Zornitza Stark Phenotypes for gene: LIFR were changed from Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome, 601559 (3) to Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome, MIM#601559 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.588 | LIFR | Zornitza Stark Publications for gene: LIFR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.587 | LHX3 | Zornitza Stark Marked gene: LHX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.587 | LHX3 | Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.587 | LHX3 | Zornitza Stark Phenotypes for gene: LHX3 were changed from Pituitary hormone deficiency, combined, 3, 221750 (3) to Pituitary hormone deficiency, combined, 3 (MIM# 221750) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.586 | LHX3 | Zornitza Stark Publications for gene: LHX3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.585 | LDLRAP1 | Zornitza Stark Marked gene: LDLRAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.585 | LDLRAP1 | Zornitza Stark Gene: ldlrap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.585 | LDLRAP1 | Zornitza Stark Phenotypes for gene: LDLRAP1 were changed from Hypercholesterolemia, familial, autosomal recessive, 603813 (3) to Familial hypercholesterolemia 4, MIM#603813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.584 | LDLRAP1 | Zornitza Stark Publications for gene: LDLRAP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.583 | LDLR | Zornitza Stark Marked gene: LDLR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.583 | LDLR | Zornitza Stark Gene: ldlr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.583 | LDLR | Zornitza Stark Phenotypes for gene: LDLR were changed from LDL cholesterol level QTL2/Hypercholesterolemia, familial to Hypercholesterolaemia, familial, 1, MIM# 143890 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.582 | LCA5 | Zornitza Stark Marked gene: LCA5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.582 | LCA5 | Zornitza Stark Gene: lca5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.582 | LCA5 | Zornitza Stark Phenotypes for gene: LCA5 were changed from Leber congenital amaurosis 5, 604537 (3) to Leber congenital amaurosis 5, MIM# 604537 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.581 | LCA5 | Zornitza Stark Publications for gene: LCA5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.580 | LARS | Zornitza Stark Tag new gene name tag was added to gene: LARS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.580 | LARS | Zornitza Stark Marked gene: LARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.580 | LARS | Zornitza Stark Gene: lars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.580 | LARGE1 | Zornitza Stark Marked gene: LARGE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.580 | LARGE1 | Zornitza Stark Gene: large1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.580 | LARGE1 | Zornitza Stark Phenotypes for gene: LARGE1 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, 613154 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, MIM #613154; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 6, MIM #608840 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.579 | LARGE1 | Zornitza Stark Publications for gene: LARGE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.578 | LAMC2 | Zornitza Stark Marked gene: LAMC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.578 | LAMC2 | Zornitza Stark Gene: lamc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.578 | LAMC2 | Zornitza Stark Phenotypes for gene: LAMC2 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 3B, severe MIM #619786; Epidermolysis bullosa, junctional 3A, intermediate MIM #619785 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.577 | LAMC2 | Zornitza Stark Publications for gene: LAMC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.576 | LAMB3 | Zornitza Stark Marked gene: LAMB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.576 | LAMB3 | Zornitza Stark Gene: lamb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.576 | LAMB3 | Zornitza Stark Phenotypes for gene: LAMB3 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 1A, intermediate MIM#226650; Epidermolysis bullosa, junctional 1B, severe MIM#226700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.575 | LAMB3 | Zornitza Stark Publications for gene: LAMB3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.574 | LAMB2 | Zornitza Stark Marked gene: LAMB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.574 | LAMB2 | Zornitza Stark Gene: lamb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.574 | LAMB2 | Zornitza Stark Phenotypes for gene: LAMB2 were changed from Pierson syndrome, 609049 (3) to Pierson syndrome, MIM# 609049; Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.573 | LAMB1 | Zornitza Stark Marked gene: LAMB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.573 | LAMB1 | Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.573 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from Lissencephaly 5, 615191 (3) to Lissencephaly 5 MIM#615191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.572 | LAMB1 | Zornitza Stark Publications for gene: LAMB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.571 | LAMA3 | Zornitza Stark Marked gene: LAMA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.571 | LAMA3 | Zornitza Stark Gene: lama3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.571 | LAMA3 | Zornitza Stark Phenotypes for gene: LAMA3 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 2B, severe (MIM#619784); 3. Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous (MIM#245660); Epidermolysis bullosa, junctional 2A, intermediate (MIM#619783) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.570 | LAMA3 | Zornitza Stark Publications for gene: LAMA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2587 | CERS1 | Zornitza Stark Marked gene: CERS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2587 | CERS1 | Zornitza Stark Gene: cers1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2587 | CERS1 | Zornitza Stark Classified gene: CERS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2587 | CERS1 | Zornitza Stark Gene: cers1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2586 | DBF4 | Zornitza Stark Marked gene: DBF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2586 | DBF4 | Zornitza Stark Gene: dbf4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2586 | DBF4 | Zornitza Stark Classified gene: DBF4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2586 | DBF4 | Zornitza Stark Gene: dbf4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2585 | GINS4 | Zornitza Stark Marked gene: GINS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2585 | GINS4 | Zornitza Stark Gene: gins4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2585 | GINS4 | Zornitza Stark Classified gene: GINS4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2585 | GINS4 | Zornitza Stark Gene: gins4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2584 | ARSI | Zornitza Stark Marked gene: ARSI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2584 | ARSI | Zornitza Stark Gene: arsi has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2584 | ARSI | Zornitza Stark Classified gene: ARSI as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2584 | ARSI | Zornitza Stark Gene: arsi has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2583 | ADGRB3 | Zornitza Stark Marked gene: ADGRB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2583 | ADGRB3 | Zornitza Stark Gene: adgrb3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2583 | ADGRB3 | Zornitza Stark Classified gene: ADGRB3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2583 | ADGRB3 | Zornitza Stark Gene: adgrb3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.9 | BRCC3 | Zornitza Stark Phenotypes for gene: BRCC3 were changed from Moyamoya disease to MoyaMoya Disease, syndromic, MONDO:0016820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.8 | BRCC3 | Zornitza Stark Mode of inheritance for gene: BRCC3 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.7 | BRCC3 | Zornitza Stark Classified gene: BRCC3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.7 | BRCC3 | Zornitza Stark Gene: brcc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.6 | BRCC3 | Zornitza Stark Tag SV/CNV tag was added to gene: BRCC3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.6 | BRCC3 | Zornitza Stark edited their review of gene: BRCC3: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2582 | BRCC3 | Zornitza Stark Marked gene: BRCC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2582 | BRCC3 | Zornitza Stark Gene: brcc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2582 | BRCC3 | Zornitza Stark Classified gene: BRCC3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2582 | BRCC3 | Zornitza Stark Gene: brcc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2581 | BRCC3 | Zornitza Stark Tag SV/CNV tag was added to gene: BRCC3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2581 | SH3BP4 | Zornitza Stark Marked gene: SH3BP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2581 | SH3BP4 | Zornitza Stark Gene: sh3bp4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2581 | SH3BP4 | Zornitza Stark Classified gene: SH3BP4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2581 | SH3BP4 | Zornitza Stark Gene: sh3bp4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2580 | WDR48 | Zornitza Stark Marked gene: WDR48 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2580 | WDR48 | Zornitza Stark Gene: wdr48 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2580 | WDR48 | Zornitza Stark Classified gene: WDR48 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2580 | WDR48 | Zornitza Stark Gene: wdr48 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2579 | SNRPA | Zornitza Stark Marked gene: SNRPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2579 | SNRPA | Zornitza Stark Gene: snrpa has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2579 | SNRPA | Zornitza Stark Classified gene: SNRPA as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2579 | SNRPA | Zornitza Stark Gene: snrpa has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2578 | ZFR | Zornitza Stark Marked gene: ZFR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2578 | ZFR | Zornitza Stark Gene: zfr has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2578 | ZFR | Zornitza Stark Classified gene: ZFR as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2578 | ZFR | Zornitza Stark Gene: zfr has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.140 | ZNF674 | Zornitza Stark Phenotypes for gene: ZNF674 were changed from to X-linked intellectual disability MONDO:0100284 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2577 | ZNF674 | Zornitza Stark Marked gene: ZNF674 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2577 | ZNF674 | Zornitza Stark Gene: znf674 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2577 | ZNF674 | Zornitza Stark Classified gene: ZNF674 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2577 | ZNF674 | Zornitza Stark Gene: znf674 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2576 | ZNF674 | Zornitza Stark Tag disputed tag was added to gene: ZNF674. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2576 | FAAHP1 | Zornitza Stark Marked gene: FAAHP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2576 | FAAHP1 | Zornitza Stark Gene: faahp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2576 | FAAHP1 | Zornitza Stark Classified gene: FAAHP1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2576 | FAAHP1 | Zornitza Stark Gene: faahp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2575 | ERN1 | Zornitza Stark Marked gene: ERN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2575 | ERN1 | Zornitza Stark Gene: ern1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2575 | ERN1 | Zornitza Stark Classified gene: ERN1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2575 | ERN1 | Zornitza Stark Gene: ern1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.321 | GLT8D1 | Zornitza Stark Marked gene: GLT8D1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.321 | GLT8D1 | Zornitza Stark Gene: glt8d1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.321 | GLT8D1 | Zornitza Stark Classified gene: GLT8D1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.321 | GLT8D1 | Zornitza Stark Gene: glt8d1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.320 | TAF15 | Zornitza Stark Marked gene: TAF15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.320 | TAF15 | Zornitza Stark Gene: taf15 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.320 | TAF15 | Zornitza Stark Classified gene: TAF15 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.320 | TAF15 | Zornitza Stark Gene: taf15 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.319 | UBQLN4 | Zornitza Stark Marked gene: UBQLN4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.319 | UBQLN4 | Zornitza Stark Gene: ubqln4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.319 | UBQLN4 | Zornitza Stark Classified gene: UBQLN4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.319 | UBQLN4 | Zornitza Stark Gene: ubqln4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.318 | TMEM230 | Zornitza Stark Marked gene: TMEM230 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.318 | TMEM230 | Zornitza Stark Gene: tmem230 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.318 | TMEM230 | Zornitza Stark Classified gene: TMEM230 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.318 | TMEM230 | Zornitza Stark Gene: tmem230 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.317 | LGALSL | Zornitza Stark Marked gene: LGALSL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.317 | LGALSL | Zornitza Stark Gene: lgalsl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.317 | LGALSL | Zornitza Stark Classified gene: LGALSL as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.317 | LGALSL | Zornitza Stark Gene: lgalsl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.8 | AGXT2 | Zornitza Stark Marked gene: AGXT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.8 | AGXT2 | Zornitza Stark Gene: agxt2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2574 | AGXT2 | Zornitza Stark Marked gene: AGXT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2574 | AGXT2 | Zornitza Stark Gene: agxt2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2574 | AGXT2 | Zornitza Stark Classified gene: AGXT2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2574 | AGXT2 | Zornitza Stark Gene: agxt2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.8 | SLC29A1 | Zornitza Stark Marked gene: SLC29A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.8 | SLC29A1 | Zornitza Stark Gene: slc29a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.8 | SLC29A1 | Zornitza Stark Phenotypes for gene: SLC29A1 were changed from to Disorders of ectonucleotide and nucleic acid metabolism; Equilibrative nucleoside transporter 1 deficiency MONDO:0019052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.7 | SLC29A1 | Zornitza Stark Publications for gene: SLC29A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.6 | SLC29A1 | Zornitza Stark Mode of inheritance for gene: SLC29A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2573 | SLC29A1 | Zornitza Stark Marked gene: SLC29A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2573 | SLC29A1 | Zornitza Stark Gene: slc29a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2573 | SLC29A1 | Zornitza Stark Classified gene: SLC29A1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2573 | SLC29A1 | Zornitza Stark Gene: slc29a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.333 | PLK1 | Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.139 | PLK1 | Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.138 | PLK1 | Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.149 | PLK1 | Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.148 | PLK1 | Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.311 | PLK1 | Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2572 | PLK1 | Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stickler Syndrome v1.10 | PLOD3 | Zornitza Stark Phenotypes for gene: PLOD3 were changed from Stickler-like phenotype with high myopia, midface hypoplasia, microretrognathia to Lysyl hydroxylase 3 deficiency, MIM#612394; Stickler-like phenotype with high myopia, midface hypoplasia, microretrognathia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.374 | PLOD3 | Zornitza Stark Phenotypes for gene: PLOD3 were changed from cataract to Lysyl hydroxylase 3 deficiency, MIM#612394 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2571 | PLOD3 | Zornitza Stark Phenotypes for gene: PLOD3 were changed from to Lysyl hydroxylase 3 deficiency, MIM#612394; Bone fragility with contractures, arterial rupture, and deafness (BCARD syndrome) MONDO:0012892 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2570 | PLOD3 | Zornitza Stark Publications for gene: PLOD3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.138 | PLXNA2 | Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2569 | PLXNA2 | Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Photosensitivity Syndromes v1.9 | RECQL | Zornitza Stark Phenotypes for gene: RECQL were changed from Photosensitivity; facial dysmorphism; xeropthalmia; skeletal abnormalities to RECON progeroid syndrome MONDO:0957266 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2568 | RECQL | Zornitza Stark Phenotypes for gene: RECQL were changed from Photosensitivity; facial dysmorphism; xeropthalmia; skeletal abnormalities to RECON progeroid syndrome MONDO:0957266 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.137 | RFX3 | Zornitza Stark Phenotypes for gene: RFX3 were changed from ID, ASD, ADHD to RFX3-related neurodevelopmental disorder MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2567 | RFX3 | Zornitza Stark Phenotypes for gene: RFX3 were changed from ID, ASD, ADHD to RFX3-related neurodevelopmental disorder MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.136 | RFX4 | Zornitza Stark Phenotypes for gene: RFX4 were changed from ID, ASD, ADHD to RFX4-related neurodevelopmental disorder, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2566 | RFX4 | Zornitza Stark Phenotypes for gene: RFX4 were changed from ID, ASD, ADHD to RFX4-related neurodevelopmental disorder, MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2565 | ROBO4 | Zornitza Stark Publications for gene: ROBO4 were set to 30455415; 32748548 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2564 | ROBO4 | Rylee Peters reviewed gene: ROBO4: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 36855159; Phenotypes: Aortic valve disease 8 MIM#618496; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.569 | GPR143 | Seb Lunke Classified gene: GPR143 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.569 | GPR143 | Seb Lunke Added comment: Comment on list classification: Marked red in line with LD comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.569 | GPR143 | Seb Lunke Gene: gpr143 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.8 | GPR143 | Seb Lunke Classified gene: GPR143 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.8 | GPR143 | Seb Lunke Added comment: Comment on list classification: Marked red in line with LD comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.8 | GPR143 | Seb Lunke Gene: gpr143 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.332 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.331 | AMOTL1 | Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.265 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | AMOTL1 | Zornitza Stark edited their review of gene: AMOTL1: Changed rating: GREEN; Changed phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.135 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.134 | AMOTL1 | Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2564 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2563 | AMOTL1 | Zornitza Stark edited their review of gene: AMOTL1: Changed phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.443 | AMOTL1 | Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.442 | AMOTL1 | Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2563 | LSM7 | Zornitza Stark Phenotypes for gene: LSM7 were changed from leukodystrophy MONDO:0019046, LRM7-related to Leukodystrophy and cerebellar atrophy, MIM# 621191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | LSM7 | Zornitza Stark reviewed gene: LSM7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy and cerebellar atrophy, MIM# 621191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.321 | LSM7 | Zornitza Stark Phenotypes for gene: LSM7 were changed from leukodystrophy MONDO:0019046, LRM7-related to Leukodystrophy and cerebellar atrophy, MIM# 621191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.320 | LSM7 | Zornitza Stark edited their review of gene: LSM7: Changed phenotypes: Leukodystrophy and cerebellar atrophy, MIM# 621191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | RFX4 | Sangavi Sivagnanasundram reviewed gene: RFX4: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: RFX4-related neurodevelopmental disorder, MONDO:0700092; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | RFX3 | Sangavi Sivagnanasundram reviewed gene: RFX3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: RFX3-related neurodevelopmental disorder MONDO:0700092; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | RECQL | Sangavi Sivagnanasundram reviewed gene: RECQL: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: RECON progeroid syndrome MONDO:0957266; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | PYCR1 | Sangavi Sivagnanasundram reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: autosomal recessive cutis laxa type 2B MONDO:0013051; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | PLXNA2 | Sangavi Sivagnanasundram reviewed gene: PLXNA2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | PLOD3 | Sangavi Sivagnanasundram reviewed gene: PLOD3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Bone fragility with contractures, arterial rupture, and deafness (BCARD syndrome) MONDO:0012892; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | PLK1 | Sangavi Sivagnanasundram reviewed gene: PLK1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | SLC29A1 | Sangavi Sivagnanasundram edited their review of gene: SLC29A1: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.5 | SLC29A1 |
Sangavi Sivagnanasundram changed review comment from: This gene-disease association is an inborn error of metabolism known as disorders of ectonucleotide and nucleic acid metabolism. Not enough evidence to support the gene-disease association. - https://iembase.com/disorder/783 PMID: 35955904 Homozygous Glu391Lys responsible for the A-negative blood time in people of African ancestry however is not shown to alter the protein function. Affected individuals will likely not have any phenotypes except the A- blood type. Missense variant is present in gnomAD v4.1 (GrpMax FAF - 1.159% in African/African American Population) PMID: 25896650 3 sibs of European ancestry identified with homozygous c.589+1G>C (rare on gnomAD v4.1 for AR gene) No severe phenotype was observed however periarticular and ectopic mineralization was observed which important regarding bone homeostasis.; to: This gene-disease association is an inborn error of metabolism known as disorders of ectonucleotide and nucleic acid metabolism. More evidence is required to support the gene-disease association. - https://iembase.com/disorder/783 PMID: 35955904 Homozygous Glu391Lys responsible for the A-negative blood time in people of African ancestry however is not shown to alter the protein function. Affected individuals will likely not have any phenotypes except the A- blood type. Missense variant is present in gnomAD v4.1 (GrpMax FAF - 1.159% in African/African American Population) PMID: 25896650 3 sibs of European ancestry identified with homozygous c.589+1G>C (rare on gnomAD v4.1 for AR gene) No severe phenotype was observed however periarticular and ectopic mineralization was observed which important regarding bone homeostasis. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | SLC29A1 |
Sangavi Sivagnanasundram gene: SLC29A1 was added gene: SLC29A1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SLC29A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SLC29A1 were set to 35955904; 25896650 Phenotypes for gene: SLC29A1 were set to Disorders of ectonucleotide and nucleic acid metabolism; Equilibrative nucleoside transporter 1 deficiency MONDO:0019052 Review for gene: SLC29A1 was set to AMBER Added comment: This gene-disease association is an inborn error of metabolism known as disorders of ectonucleotide and nucleic acid metabolism. More evidence is required to support the gene-disease association. - https://iembase.com/disorder/783 PMID: 35955904 Homozygous Glu391Lys responsible for the A-negative blood time in people of African ancestry however is not shown to alter the protein function. Affected individuals will likely not have any phenotypes except the A- blood type. Missense variant is present in gnomAD v4.1 (GrpMax FAF - 1.159% in African/African American Population) PMID: 25896650 3 sibs of European ancestry identified with homozygous c.589+1G>C (rare on gnomAD v4.1 for AR gene) No severe phenotype was observed however periarticular and ectopic mineralization was observed which important regarding bone homeostasis. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.5 | SLC29A1 | Sangavi Sivagnanasundram reviewed gene: SLC29A1: Rating: RED; Mode of pathogenicity: None; Publications: 35955904, 25896650; Phenotypes: Disorders of ectonucleotide and nucleic acid metabolism, Equilibrative nucleoside transporter 1 deficiency MONDO:0019052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | AGXT2 |
Sangavi Sivagnanasundram gene: AGXT2 was added gene: AGXT2 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: AGXT2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AGXT2 were set to 21572414 Phenotypes for gene: AGXT2 were set to beta-aminoisobutyric acid, urinary excretion of MONDO:0008860 Review for gene: AGXT2 was set to RED Added comment: This gene-disease association needs further evidence to support pathogenicity. PMID: 21572414 GWAS study identified common SNP (V140I - https://gnomad.broadinstitute.org/variant/5-35037010-C-T?dataset=gnomad_r4) showing the strongest association with BAIB in the present study. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Nucleotide metabolism disorders v0.5 | AGXT2 | Sangavi Sivagnanasundram reviewed gene: AGXT2: Rating: RED; Mode of pathogenicity: None; Publications: 21572414; Phenotypes: beta-aminoisobutyric acid, urinary excretion of MONDO:0008860; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | LGALSL |
Sangavi Sivagnanasundram gene: LGALSL was added gene: LGALSL was added to Incidentalome. Sources: ClinGen Mode of inheritance for gene: LGALSL was set to Unknown Publications for gene: LGALSL were set to 30940688 Phenotypes for gene: LGALSL were set to Amyotrophic lateral sclerosis MONDO:0004976 Review for gene: LGALSL was set to AMBER Added comment: Classified as LIMITED by ClinGen ALS spectrum disorder GCEP on 14/02/2023 -https://search.clinicalgenome.org/CCID:005279. Significant enrichment in a cohort of 3,239 ALS cases compared to 11,808 controls - OR = 14.63; P = 2.29e-6. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | TMEM230 | Sangavi Sivagnanasundram edited their review of gene: TMEM230: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | TMEM230 |
Sangavi Sivagnanasundram gene: TMEM230 was added gene: TMEM230 was added to Incidentalome. Sources: Expert Review Mode of inheritance for gene: TMEM230 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TMEM230 were set to 30804554; 27270108; 28115417; 28017548; 30804555; 30804556; 31323517 Phenotypes for gene: TMEM230 were set to Parkinson disease 21, MONDO:0005180 Review for gene: TMEM230 was set to AMBER Added comment: No new evidence/proband supportive of gene-disease association. Review copied from Parkinson Panel: "A single family segregating a heterozygous missense (p.Arg141Leu) and supporting functional evidence. However, another group found a DNAJC13 variant in the same family also with supporting functional evidence. A stoploss was also identified in 9 Chinese Parkinson disease probands, however it was identified homozygous in 7 of these with no difference in the severity of phenotype. A similar stop loss was identified in a North American PD case. Another missense was identified in an apparently sporadic PD case (p.Tyr92Cys), but was also present in the unaffected mother (age 57 yrs). Another rare missense has been reported in a case with familial PD. The missense reported in a family from Southern Italy is too common in gnomAD v2.1 for a dominant disease (PMID: 31323517 - p.Ile125Met)." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | UBQLN4 |
Sangavi Sivagnanasundram gene: UBQLN4 was added gene: UBQLN4 was added to Incidentalome. Sources: Expert Review Mode of inheritance for gene: UBQLN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: UBQLN4 were set to 28463112; 30804504 Phenotypes for gene: UBQLN4 were set to amyotrophic lateral sclerosis MONDO:0004976 Review for gene: UBQLN4 was set to AMBER Added comment: No new evidence/proband supporting gene-disease association. Review copied from MND panel: "A single familial case and supporting functional studies and animal model." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | TAF15 |
Sangavi Sivagnanasundram gene: TAF15 was added gene: TAF15 was added to Incidentalome. Sources: ClinGen Mode of inheritance for gene: TAF15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TAF15 were set to 28889094; 21438137; 22065782; 27810362; 28889094 Phenotypes for gene: TAF15 were set to amyotrophic lateral sclerosis MONDO:0004976; frontotemporal dementia MONDO:0017276 Review for gene: TAF15 was set to AMBER Added comment: Classified as LIMITED by ClinGen ALS GCEP on 11/03/2021 - https://search.clinicalgenome.org/CCID:006311 Reported in individuals with sporadic and familial ALS and in individuals with behavourial FTD. The variants reported in the publications were reported in gnomAD non-neuro cohort including elderly individuals, therefore leading to ClinGen's limited classification. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | GLT8D1 |
Sangavi Sivagnanasundram gene: GLT8D1 was added gene: GLT8D1 was added to Incidentalome. Sources: ClinGen Mode of inheritance for gene: GLT8D1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GLT8D1 were set to 30811981; 35525134; 34746377; 33714647; 31653410; 35873773; 33581933 Phenotypes for gene: GLT8D1 were set to amyotrophic lateral sclerosis MONDO:0004976 Review for gene: GLT8D1 was set to AMBER Added comment: Classified as LIMITED by ClinGen ALS GCEP on 14/01/2025 - https://search.clinicalgenome.org/CCID:004967 Variants have been reported in 22 probands however the variants identified had a high population frequency which led to ClinGen's limited classification Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | ERN1 |
Sangavi Sivagnanasundram gene: ERN1 was added gene: ERN1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: ERN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ERN1 were set to Immune Dysregulation, MONDO:0005046 Review for gene: ERN1 was set to RED Added comment: No new evidence to support gene-disease association. Review copied from Disorders of immune dysregulation Panel: "On the IUIS 2024 update for IEIs as a gene associated with an AD disease of immune dysregulation, I cannot find any evidence of Mendelian disease." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | FAAHP1 |
Sangavi Sivagnanasundram gene: FAAHP1 was added gene: FAAHP1 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: FAAHP1 was set to Unknown Publications for gene: FAAHP1 were set to 30929760 Phenotypes for gene: FAAHP1 were set to Pain insensitivity Review for gene: FAAHP1 was set to RED Added comment: Review from Pain Syndromes Panel: "This is a pseudogene. A single case with pain insensitivity has been reported with co-inheritance of a microdeletion in dorsal root ganglia and brain-expressed pseudogene and a common functional SNP in FAAH (rs324420 ) conferring reduced expression and activity." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | ZNF674 |
Sangavi Sivagnanasundram gene: ZNF674 was added gene: ZNF674 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: ZNF674 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: ZNF674 were set to https://search.clinicalgenome.org/CCID:006588 Phenotypes for gene: ZNF674 were set to X-linked intellectual disability MONDO:0100284 Review for gene: ZNF674 was set to RED Added comment: Classified DISPUTED by ClinGen ID and Autism GCEP on 04/05/2021 - https://search.clinicalgenome.org/CCID:006588 Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | ZFR |
Sangavi Sivagnanasundram gene: ZFR was added gene: ZFR was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: ZFR was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZFR were set to 24482476 Phenotypes for gene: ZFR were set to hereditary spastic paraplegia, MONDO:0019064 Review for gene: ZFR was set to RED Added comment: No new proband/evidence supporting gene-disease association. Review copied from HSP paediatric panel: "A single family reported with a homozygous variant." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | SNRPA |
Sangavi Sivagnanasundram gene: SNRPA was added gene: SNRPA was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: SNRPA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNRPA were set to 29437235 Phenotypes for gene: SNRPA were set to complex neurodevelopmental disorder, SNRPA-related MONDO:0100038 Review for gene: SNRPA was set to RED Added comment: No new reported probands supporting the gene-disease association. Review copied from ID panel: "1 report of concurrence of intellectual disability, short stature, poor speech, and minor craniofacial and hand anomalies in 2 female siblings with 3 homozygous missense variants in SNRPA. Combined, c.97A>G, c.98T>C, and c.100T>A, in exon 2 of SNRPA lead to p.Ile33Ala and p.Phe34Ile exchanges, which were predicted in silico to be deleterious. No functional studies." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | WDR48 |
Sangavi Sivagnanasundram gene: WDR48 was added gene: WDR48 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: WDR48 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR48 were set to 24482476 Phenotypes for gene: WDR48 were set to Hereditary spastic paraplegia MONDO:0015150 Review for gene: WDR48 was set to RED Added comment: Gene Reviews - https://www.ncbi.nlm.nih.gov/books/NBK1509/ SPG60 - paediatric onset of complex HSP. Polyneuropathy and DD are the typical onset of symptoms No new reported probands - review copied from HSP paediatric panel: "A single family reported with a homozygous in-frame deletion." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | SH3BP4 |
Sangavi Sivagnanasundram gene: SH3BP4 was added gene: SH3BP4 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: SH3BP4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SH3BP4 were set to 24627108 Phenotypes for gene: SH3BP4 were set to Peripheral neuropathy, MONDO:0005244 Review for gene: SH3BP4 was set to RED Added comment: No new information supportive of gene-disease association. Review copied from Hereditary Neuropathy_CMT - isolated Panel: "A single family reported with inherited peripheral neuropathy, with no functional analyses." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | BRCC3 |
Sangavi Sivagnanasundram gene: BRCC3 was added gene: BRCC3 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: BRCC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: BRCC3 were set to 21596366; 33868155; 35815106; 39552268 Phenotypes for gene: BRCC3 were set to MoyaMoya Disease, syndromic, MONDO:0016820 Review for gene: BRCC3 was set to AMBER Added comment: The same common ~26kb Xq28 deletion was identified in all affected individuals below. No other evidence of any SNVs. Additional probands with MoyaMoya: PMID: 35815106 & 39552268 Two unrelated individuals with MoyaMoya and other neurodevelopmental features. A hemizygous ~26kb Xq28 deletion was identified in both individuals ------------------------------ Review from CVM panel: “PMID 21596366: three unrelated families with multiple affected males segregating a deletion involving MTCP1 and BRCC3. Positional approach used. Supportive zebrafish model, knockdown of BRCC3; angiogenesis affected. PMID 33868155, additional report of affected male, with similar deletion. No reports of SNVs identified, including in ClinVar.” Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | ADGRB3 |
Sangavi Sivagnanasundram gene: ADGRB3 was added gene: ADGRB3 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: ADGRB3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADGRB3 were set to 30659260; 18628273 Phenotypes for gene: ADGRB3 were set to Intellectual disability MONDO:0001071 Review for gene: ADGRB3 was set to RED Added comment: No new information supportive of gene-disease association. Review copied from ID panel: "Single family with intragenic bi-allelic duplications and ID reported; association studies with schizophrenia." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | ARSI |
Sangavi Sivagnanasundram gene: ARSI was added gene: ARSI was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: ARSI was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ARSI were set to 24482476 Phenotypes for gene: ARSI were set to Complex spastic paraplegia, MONDO:0015150 Review for gene: ARSI was set to RED Added comment: No new information supporting gene-disease association. Review from HSP paediatric panel - "Single family reported" Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | GINS4 |
Sangavi Sivagnanasundram gene: GINS4 was added gene: GINS4 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: GINS4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GINS4 were set to 36345943 Phenotypes for gene: GINS4 were set to combined immunodeficiency MONDO:0015131 Review for gene: GINS4 was set to RED Added comment: No further information has been published to support the gene-disease association. Review copied from Combined Immunodeficiency panel: "2 affected siblings with compound het variants are reported in a single family." Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | DBF4 |
Sangavi Sivagnanasundram changed review comment from: Review taken from Phagocyte Defects panel: "A single case with a homozygous variant & some supporting in vitro functional assay." Sources: Literature; to: No new information supporting gene-disease association. Review taken from Phagocyte Defects panel: "A single case with a homozygous variant & some supporting in vitro functional assay." Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | DBF4 |
Sangavi Sivagnanasundram gene: DBF4 was added gene: DBF4 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: DBF4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DBF4 were set to 36841265 Phenotypes for gene: DBF4 were set to severe congenital neutropenia MONDO:0018542 Review for gene: DBF4 was set to RED Added comment: Review taken from Phagocyte Defects panel: "A single case with a homozygous variant & some supporting in vitro functional assay." Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | CERS1 |
Sangavi Sivagnanasundram gene: CERS1 was added gene: CERS1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CERS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CERS1 were set to 24782409; 21625621; 30800706 Phenotypes for gene: CERS1 were set to Epilepsy, progressive myoclonic, 8, MONDO:0020074 Review for gene: CERS1 was set to GREEN Added comment: Addition of this gene to the Mendeliome - review taken from Genetic Epilepsy Panel "Two unrelated families with PME identified, and functional assays in vitro and in patient cells demonstrating impaired ceramide biosynthesis. Mouse model shows neurodegeneration and lipofuscin accumulation" Classified as MODERATE by ClinGen Epilepsy GCEP on 16/07/2024 - https://search.clinicalgenome.org/CCID:008331 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.134 | NAV3 | Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.133 | NAV3 | Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2562 | NAV3 | Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2561 | NAV3 | Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.331 | GPKOW | Zornitza Stark Publications for gene: GPKOW were set to 28612833 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.330 | GPKOW | Zornitza Stark Phenotypes for gene: GPKOW were changed from male-lethal microcephaly with intrauterine growth restriction to syndromic disease, MONDO:0002254, GPKOW-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.310 | GPKOW | Zornitza Stark Marked gene: GPKOW as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.310 | GPKOW | Zornitza Stark Gene: gpkow has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.310 | GPKOW | Zornitza Stark Phenotypes for gene: GPKOW were changed from microcephaly MONDO:0001149; fetal growth restriction MONDO:0005030 to syndromic disease, MONDO:0002254, GPKOW-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2561 | GPKOW | Zornitza Stark Phenotypes for gene: GPKOW were changed from male-lethal microcephaly with intrauterine growth restriction to syndromic disease, MONDO:0002254, GPKOW-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2560 | GPKOW | Zornitza Stark Publications for gene: GPKOW were set to 28612833 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2559 | FBXO22 | Zornitza Stark Marked gene: FBXO22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2559 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2559 | FBXO22 | Zornitza Stark Classified gene: FBXO22 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2559 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Marked gene: FBXO22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Classified gene: FBXO22 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.133 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.77 | FBXO22 | Zornitza Stark Marked gene: FBXO22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.77 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.77 | FBXO22 | Zornitza Stark Classified gene: FBXO22 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.77 | FBXO22 | Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Immunological disorders_SuperPanel v15.2 | Bryony Thompson Changed child panels to: Autoinflammatory Disorders; Combined Immunodeficiency; Bone Marrow Failure; Phagocyte Defects; Defects of intrinsic and innate immunity; Disorders of immune dysregulation; Severe Combined Immunodeficiency (absent T present B cells); Severe Combined Immunodeficiency (absent T absent B cells); Hereditary angioedema; Predominantly Antibody Deficiency; Autoimmune Lymphoproliferative Syndrome; Susceptibility to Viral Infections; Complement Deficiencies; Inflammatory bowel disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v1.0 | Bryony Thompson promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.133 | STAT2 | Bryony Thompson Phenotypes for gene: STAT2 were changed from to Susceptibility to viral disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.132 | STAT2 | Bryony Thompson Mode of inheritance for gene: STAT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Immunological disorders_SuperPanel v14.1 | Bryony Thompson Changed child panels to: Autoinflammatory Disorders; Combined Immunodeficiency; Bone Marrow Failure; Phagocyte Defects; Defects of intrinsic and innate immunity; Disorders of immune dysregulation; Severe Combined Immunodeficiency (absent T present B cells); Severe Combined Immunodeficiency (absent T absent B cells); Susceptibility to Fungal Infections; Hereditary angioedema; Predominantly Antibody Deficiency; Autoimmune Lymphoproliferative Syndrome; Complement Deficiencies; Susceptibility to Viral Infections; Inflammatory bowel disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Growth failure v1.76 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Growth failure. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2558 | FBXO22 |
Sarah Milton gene: FBXO22 was added gene: FBXO22 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO22 were set to PMID: 40215970 Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related Review for gene: FBXO22 was set to GREEN Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases. 14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4). Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies. Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.148 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2558 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors); to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2558 | RNU2-2P | Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.148 | RNU2-2P | Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.309 | GPKOW | Chirag Patel Classified gene: GPKOW as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.309 | GPKOW | Chirag Patel Gene: gpkow has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2558 | GPKOW | Chirag Patel Classified gene: GPKOW as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2558 | GPKOW | Chirag Patel Gene: gpkow has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.329 | GPKOW | Chirag Patel Classified gene: GPKOW as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.329 | GPKOW | Chirag Patel Gene: gpkow has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.308 | GPKOW |
Chirag Patel gene: GPKOW was added gene: GPKOW was added to Microcephaly. Sources: Literature Mode of inheritance for gene: GPKOW was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: GPKOW were set to PMID: 40221893, 28612833 Phenotypes for gene: GPKOW were set to microcephaly MONDO:0001149; fetal growth restriction MONDO:0005030 Review for gene: GPKOW was set to GREEN Added comment: GPKOW, a gene on the X-chromosome, encodes a nuclear RNA-binding protein important in mRNA processing as a spliceosome subunit. It has been shown in numerous model organisms and in human cells to be essential for survival. PMID: 40221893 2 unrelated families with 3 affected males (deceased) presenting with IUGR, microcephaly, congenital ichthyosis, eye anomalies (microphthalmia, coloboma, ON hypoplasia), brain anomalies (absent septum pellucidum, ventriculomegaly), and skeletal anomalies (platyspondyly, brachydactyly). Trio WES/WGS testing identified 2 hemizygous frameshift variants affecting the last exon of GPKOW [p.(Arg441SerfsTer30) and p.(Ser444GlufsTer28)]. Some heterozygote females presented with short stature, microcephaly, and vision problems. Sequencing of fibroblasts' mRNA showed that GPKOW mRNA escapes nonsense-mediated decay but protein expression is reduced, suggesting protein instability. Studies in Drosophila showed that Gpkow is broadly expressed and is enriched in neurons and glia in eyes and head of developing and adult flies. Knockdown and overexpression of Gpkow in the fly eye cause eyeless/headless phenotype suggesting that the gene is dosage sensitive. Overexpression of the p.(Ser444GlufsTer28) variant caused milder defects than the reference allele, indicating that the truncated protein behaves as a partial loss-of-function allele. PMID: 28612833 1 family with 5 affected males (stillbirth/TOP) with severe microcephaly and intrauterine growth restriction. X-exome sequencing in an obligate carrier identified a potential splice variant in the GPKOW gene (c.331+5G>A). The variant segregated in 9 additional family members, including one affected male fetus. GPKOW transcripts, in lymphoblastoid cell lines of 3 carrier females, showed that the variant disrupts normal splicing of its pre-mRNAs. A clonal culture expressing only the c.331+5G>A allele isolated from one carrier female LCL, showed an 80% reduction in wild type GPKOW mRNA, 70% reduction in the full length GPKOW protein and the presence of a truncated GPKOW protein with possible dominant negative effect. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.328 | GPKOW | Chirag Patel reviewed gene: GPKOW: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40221893, 28612833; Phenotypes: microcephaly MONDO:0001149, fetal growth restriction MONDO:0005030; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2557 | GPKOW | Chirag Patel reviewed gene: GPKOW: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40221893, 28612833; Phenotypes: microcephaly MONDO:0001149, fetal growth restriction MONDO:0005030; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v1.0 | Bryony Thompson promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.87 | Bryony Thompson Panel types changed to Melbourne Genomics; Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.86 | THBD | Bryony Thompson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.54 | THBD | Bryony Thompson Classified gene: THBD as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.54 | THBD | Bryony Thompson Added comment: Comment on list classification: Refuted gene-disease classification by ClinGen Complement-Mediated Kidney Diseases GCEP - https://search.clinicalgenome.org/CCID:008288 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.54 | THBD | Bryony Thompson Gene: thbd has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.53 | THBD | Bryony Thompson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.86 | CFHR5 | Bryony Thompson Mode of inheritance for gene: CFHR5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.85 | CFHR5 | Bryony Thompson Classified gene: CFHR5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.85 | CFHR5 | Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.85 | CFHR5 | Bryony Thompson Gene: cfhr5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.84 | CFHR3 | Bryony Thompson Publications for gene: CFHR3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.83 | CFHR3 | Bryony Thompson Classified gene: CFHR3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.83 | CFHR3 | Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.83 | CFHR3 | Bryony Thompson Gene: cfhr3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.82 | CFHR2 | Bryony Thompson Classified gene: CFHR2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.82 | CFHR2 | Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.82 | CFHR2 | Bryony Thompson Gene: cfhr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.81 | CFHR1 | Bryony Thompson Publications for gene: CFHR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.80 | CFHR1 | Bryony Thompson Mode of inheritance for gene: CFHR1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.79 | CFHR1 | Bryony Thompson Classified gene: CFHR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.79 | CFHR1 | Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.79 | CFHR1 | Bryony Thompson Gene: cfhr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.78 | CFB | Bryony Thompson Phenotypes for gene: CFB were changed from Complement factor B deficiency, MIM# 615561 to complement factor b deficiency MONDO:0014255; Atypical hemolytic-uremic syndrome with B factor anomaly MONDO:0013042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.77 | CFB | Bryony Thompson edited their review of gene: CFB: Changed phenotypes: complement factor b deficiency MONDO:0014255, Atypical hemolytic-uremic syndrome with B factor anomaly MONDO:0013042 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2557 | CFB | Bryony Thompson reviewed gene: CFB: Rating: AMBER; Mode of pathogenicity: None; Publications: 33165708, 24152280; Phenotypes: complement factor b deficiency MONDO:0014255; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.77 | CFB | Bryony Thompson Publications for gene: CFB were set to 24152280 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.76 | CFB | Bryony Thompson Mode of inheritance for gene: CFB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.75 | CFB | Bryony Thompson Classified gene: CFB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.75 | CFB | Bryony Thompson Gene: cfb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Complement Deficiencies v0.74 | CFB | Bryony Thompson reviewed gene: CFB: Rating: GREEN; Mode of pathogenicity: None; Publications: 33165708, 24152280, 17182750; Phenotypes: complement factor b deficiency MONDO:0014255; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2557 | SIRT1 | Zornitza Stark Phenotypes for gene: SIRT1 were changed from autoimmune disease, MONDO:0007179 to autoimmune disease, MONDO:0007179; monogenic diabetes MONDO:0015967 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2556 | SIRT1 | Zornitza Stark Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2556 | SIRT1 | Zornitza Stark reviewed gene: SIRT1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: monogenic diabetes MONDO:0015967; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.138 | SIRT1 | Zornitza Stark Marked gene: SIRT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.138 | SIRT1 | Zornitza Stark Gene: sirt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.138 | SIRT1 | Zornitza Stark Classified gene: SIRT1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.138 | SIRT1 | Zornitza Stark Gene: sirt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2556 | NARS | Zornitza Stark Phenotypes for gene: NARS were changed from Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091; Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092; Abnormal muscle tone; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Ataxia; Abnormality of the face; Demyelinating peripheral neuropathy to Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091; Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092; Hereditary peripheral neuropathy, MONDO:0020127, NARS-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2555 | NARS | Zornitza Stark Publications for gene: NARS were set to 32738225 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2554 | NARS | Zornitza Stark edited their review of gene: NARS: Added comment: Three families with isolated neuropathy and missense variants in this gene. Segregation and functional evidence. Likely phone expansion into the milder end of the spectrum for NARS-related disorders.; Changed publications: 32738225, 38495304, 38769024; Changed phenotypes: Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091, Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092, Hereditary peripheral neuropathy, MONDO:0020127, NARS-related, Abnormal muscle tone, Microcephaly, Global developmental delay, Intellectual disability, Seizures, Ataxia, Abnormality of the face, Demyelinating peripheral neuropathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.6 | NOS3 | Zornitza Stark Marked gene: NOS3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.6 | NOS3 | Zornitza Stark Gene: nos3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.6 | NOS3 | Zornitza Stark Classified gene: NOS3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.6 | NOS3 | Zornitza Stark Gene: nos3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.5 | NOS3 |
Zornitza Stark gene: NOS3 was added gene: NOS3 was added to Cerebral vascular malformations. Sources: Literature Mode of inheritance for gene: NOS3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NOS3 were set to 36941667; 37383439 Phenotypes for gene: NOS3 were set to Moyamoya disease, MONDO:0016820 Review for gene: NOS3 was set to AMBER Added comment: PMID:36941667 analysed six patients from a cohort of 126 consecutive unrelated probands with Moyamoya angiopathy (MMA) of unknown etiology. Two of these six patients were identified with homozygous NOS3 variants, of which one is missense (c.1942T> C, p.(Cys648Arg)) and the other is splice-site variant (c.1502 + 1G > C). Both probands with NOS3 variants suffered from an infant-onset and severe MMA associated with posterior cerebral artery steno-occlusive lesions. There is also some functional evidence available for both variants. PMID:37383439 reported six patients with Moyamoya disease, of which one patient was identified with monoallelic missense NOS3 variant (c.1684G>A; p.Glu562Lys. In summary, there are two unrelated cases and some functional evidence available for the association of biallelic variants with MMA. However, there is only one case with monoallelic NOS3 variant. The pathogenicity of this monoallelic variant was not explored in detail in the publication Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2554 | NOS3 | Zornitza Stark Phenotypes for gene: NOS3 were changed from {Hypertension, susceptibility to}, MIM#145500; {Ischemic stroke, susceptibility to}, MIM# 601367; {Hypertension, pregnancy-induced}, MIM# 189800 to Moyamoya disease, MONDO:0016820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2553 | NOS3 | Zornitza Stark Publications for gene: NOS3 were set to 24986538; 28084234; 33652340 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2552 | NOS3 | Zornitza Stark Mode of inheritance for gene: NOS3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2551 | NOS3 | Zornitza Stark Classified gene: NOS3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2551 | NOS3 | Zornitza Stark Gene: nos3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.4 | KEL | Zornitza Stark Marked gene: KEL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.4 | KEL | Zornitza Stark Gene: kel has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.4 | KEL |
Zornitza Stark gene: KEL was added gene: KEL was added to Cerebral vascular malformations. Sources: Literature Mode of inheritance for gene: KEL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KEL were set to 30578106; 37978175 Phenotypes for gene: KEL were set to vein of Galen aneurysm, MONDO:0015196 Review for gene: KEL was set to RED Added comment: PMID:37978175 reported a cohort of 114 probands with radiographically confirmed vein of Galen malformations (VOGMs), which is the most common and most severe of congenital brain arteriovenous malformations. This includes 55 cases already reported in PMID:30578106. Of these cases, only two were identified with variants in KEL gene (p.(Gln321Ter) & p.(Gly202Ser)).There is no functional evidence or segregation evidence available. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2550 | KEL | Zornitza Stark Phenotypes for gene: KEL were changed from [Blood group, Kell] 110900 to vein of Galen aneurysm, MONDO:0015196 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2549 | KEL | Zornitza Stark Publications for gene: KEL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2548 | KEL | Zornitza Stark Mode of inheritance for gene: KEL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2547 | KEL | Zornitza Stark reviewed gene: KEL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | GAP43 | Zornitza Stark Marked gene: GAP43 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | GAP43 | Zornitza Stark Gene: gap43 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.132 | GAP43 |
Zornitza Stark gene: GAP43 was added gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GAP43 were set to 39738362 Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related Review for gene: GAP43 was set to RED Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities. The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.328 | SIRT6 | Zornitza Stark Marked gene: SIRT6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.328 | SIRT6 | Zornitza Stark Gene: sirt6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.328 | SIRT6 | Zornitza Stark Classified gene: SIRT6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.328 | SIRT6 | Zornitza Stark Gene: sirt6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.327 | SIRT6 |
Zornitza Stark gene: SIRT6 was added gene: SIRT6 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: SIRT6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SIRT6 were set to 29555651; 30135584 Phenotypes for gene: SIRT6 were set to syndromic disease, MONDO:0002254, SIRT6-related Review for gene: SIRT6 was set to AMBER Added comment: PMID:29555651 reported a family with four consecutive cases of late fetal loss at gestational ages between 17 and 35 weeks. The fetuses showed prenatal abnormalities including intrauterine growth restriction (IUGR), microcephaly, craniofacial anomalies, sex reversal in male fetuses, and congenital heart defects. A homozygous inactivating variant in SIRT6 gene (c.187G > C; p.(Asp63His)) was identified by WES in the four fetuses. There is also functional data available from in vitro studies, SIRT6 D63H mouse embryonic stem cells and human induced pluripotent stem cells (iPSCs) derived from D63H homozygous foetuses. There is also functional evidence available from several other studies including PMID:30135584, where CRISPR-Cas9-based approach was used to generate a SIRT6-null cynomolgus monkey (Macaca fascicularis) model. SIRT6-deficient monkeys died hours after birth and exhibited severe prenatal developmental retardation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2547 | SIRT6 | Zornitza Stark Phenotypes for gene: SIRT6 were changed from perinatal disease MONDO:0100086 to syndromic disease, MONDO:0002254, SIRT6-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2546 | SIRT6 | Zornitza Stark reviewed gene: SIRT6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: syndromic disease, MONDO:0002254, SIRT6-related; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2546 | LSM1 | Zornitza Stark Phenotypes for gene: LSM1 were changed from neurodevelopmental disorder MONDO:0700092, LSM1-related to Neurodevelopmental disorder, MONDO:0700092, LSM1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2545 | LSM1 | Zornitza Stark Publications for gene: LSM1 were set to 31010896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2544 | LSM1 | Zornitza Stark Classified gene: LSM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2544 | LSM1 | Zornitza Stark Gene: lsm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2543 | LSM1 |
Zornitza Stark edited their review of gene: LSM1: Added comment: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals.; Changed rating: GREEN; Changed publications: 31010896, 36100156, 40204357; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.131 | LSM1 | Zornitza Stark Phenotypes for gene: LSM1 were changed from no OMIM number yet to Neurodevelopmental disorder, MONDO:0700092, LSM1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.130 | LSM1 | Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.129 | LSM1 | Zornitza Stark Classified gene: LSM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.129 | LSM1 | Zornitza Stark Gene: lsm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.148 | RNU2-2P | Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.147 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | RNU2-2P | Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2543 | RNU2-2P | Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2542 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2541 | RNU2-2P | Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.128 | RNU2-2P | Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.127 | RNU2-2P | Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P | Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P |
Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2 Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Previously referred to as RNU2-2P Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2 Previously referred to as RNU2-2P Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74 Encodes part of minor spliceosome (RNA) - non protein coding gene. Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo. Recurrent variants included n.4G>A and n.35A>G (should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | RNU2-2P | Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.568 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.568 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.568 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from Muscular dystrophy, congenital merosin-deficient, 607855 (3) to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.567 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.566 | L2HGDH | Zornitza Stark Marked gene: L2HGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.566 | L2HGDH | Zornitza Stark Gene: l2hgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.566 | L2HGDH | Zornitza Stark Phenotypes for gene: L2HGDH were changed from L-2-hydroxyglutaric aciduria, 236792 (3) to L-2-hydroxyglutaric aciduria, MIM#236792 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.565 | L2HGDH | Zornitza Stark Publications for gene: L2HGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.564 | L1CAM | Zornitza Stark Marked gene: L1CAM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.564 | L1CAM | Zornitza Stark Gene: l1cam has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.564 | L1CAM | Zornitza Stark Phenotypes for gene: L1CAM were changed from MASA syndrome, 303350 (3) to MASA syndrome, MIM#303350; Hydrocephalus, congenital, X-linked, MIM#307000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.563 | L1CAM | Zornitza Stark Publications for gene: L1CAM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.562 | KRT14 | Zornitza Stark Marked gene: KRT14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.562 | KRT14 | Zornitza Stark Gene: krt14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.562 | KRT14 | Zornitza Stark Phenotypes for gene: KRT14 were changed from Epidermolysis bullosa simplex, recessive 1, 601001 (3) to Epidermolysis bullosa simplex 1D, generalized, intermediate or severe, autosomal recessive MIM# 601001; MONDO:0010976 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.561 | KRT14 | Zornitza Stark Publications for gene: KRT14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.560 | KIF7 | Zornitza Stark Marked gene: KIF7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.560 | KIF7 | Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.560 | KIF7 | Zornitza Stark Phenotypes for gene: KIF7 were changed from Hydrolethalus syndrome 2, 614120 (3) to Al-Gazali-Bakalinova syndrome MIM#607131; Hydrolethalus syndrome 2 MIM#614120; Acrocallosal syndrome MIM#200990; Joubert syndrome 12 MIM#200990 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.559 | KIF7 | Zornitza Stark Publications for gene: KIF7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.558 | KIF1A | Zornitza Stark Marked gene: KIF1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.558 | KIF1A | Zornitza Stark Gene: kif1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.558 | KIF1A | Zornitza Stark Phenotypes for gene: KIF1A were changed from Spastic paraplegia 30, autosomal recessive, 610357 (3) to Spastic paraplegia 30, autosomal recessive, MIM#610357 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.557 | KIF1A | Zornitza Stark Publications for gene: KIF1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.29 | IFT140 | Zornitza Stark Publications for gene: IFT140 were set to 22503633; 23418020; 34890546 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.28 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; {Polycystic kidney disease 9, susceptibility to} MIM#621164 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Cranioectodermal dysplasia 5, MIM# 621180; {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.27 | IFT140 | Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum. All individuals had a recurrent tandem duplication spanning exons 27 to 30 in trans with other variants. Renal disease including renal failure was a prominent part of the phenotype.; Changed publications: 22503633, 23418020, 34890546, 37628605; Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, MONDO:0009964, Cranioectodermal dysplasia 5, MIM# 621180, {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.69 | IFT140 | Zornitza Stark changed review comment from: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; to: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum. All individuals had a recurrent tandem duplication spanning exons 27 to 30 in trans with other variants. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2541 | BRF2 | Zornitza Stark Marked gene: BRF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2541 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2541 | BRF2 | Zornitza Stark Classified gene: BRF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2541 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2540 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.326 | BRF2 | Zornitza Stark Marked gene: BRF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.326 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.326 | BRF2 | Zornitza Stark Classified gene: BRF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.326 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.325 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Fetal anomalies. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.307 | BRF2 | Zornitza Stark Marked gene: BRF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.307 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.307 | BRF2 | Zornitza Stark Classified gene: BRF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.307 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.306 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Marked gene: BRF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Classified gene: BRF2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.126 | BRF2 | Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.125 | BRF2 |
Zornitza Stark gene: BRF2 was added gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BRF2 were set to 40229899 Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related Review for gene: BRF2 was set to GREEN Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2539 | ATP2A2 | Zornitza Stark Phenotypes for gene: ATP2A2 were changed from Acrokeratosis verruciformis MIM#101900; Darier disease MIM#124200 to Acrokeratosis verruciformis MIM#101900; Darier disease MIM#124200; Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2538 | ATP2A2 | Zornitza Stark Publications for gene: ATP2A2 were set to PMID: 24336169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2537 | ATP2A2 | Zornitza Stark reviewed gene: ATP2A2: Rating: AMBER; Mode of pathogenicity: None; Publications: 39970126; Phenotypes: Congenital myopathy, MONDO:0019952, ATP2A2-related, rhabdomyolysis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2537 | MYO1A | Bryony Thompson Mode of inheritance for gene: MYO1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2536 | MYO1A | Bryony Thompson Classified gene: MYO1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2536 | MYO1A | Bryony Thompson Gene: myo1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.24 | ATP2A2 | Zornitza Stark Phenotypes for gene: ATP2A2 were changed from Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis to Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.23 | ATP2A2 | Zornitza Stark Marked gene: ATP2A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.23 | ATP2A2 | Zornitza Stark Gene: atp2a2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.23 | ATP2A2 | Zornitza Stark Phenotypes for gene: ATP2A2 were changed from Congenital myopathy, MONDO:0019952, ATP2A2-related to Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.19 | MYO1A | Bryony Thompson Marked gene: MYO1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.19 | MYO1A | Bryony Thompson Gene: myo1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.19 | MYO1A | Bryony Thompson Classified gene: MYO1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.19 | MYO1A | Bryony Thompson Gene: myo1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.22 | ATP2A2 | Zornitza Stark Classified gene: ATP2A2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.22 | ATP2A2 | Zornitza Stark Gene: atp2a2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v1.21 | ATP2A2 |
Zornitza Stark gene: ATP2A2 was added gene: ATP2A2 was added to Rhabdomyolysis and Metabolic Myopathy. Sources: Literature Mode of inheritance for gene: ATP2A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP2A2 were set to 39970126 Phenotypes for gene: ATP2A2 were set to Congenital myopathy, MONDO:0019952, ATP2A2-related Review for gene: ATP2A2 was set to AMBER Added comment: Recurrent missense variant, c.1583G>A, p.R528Q, identified in 14 individuals from 3 unrelated families. Supportive functional data, including a zebrafish model. Association established for this variant only. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.69 | FGF4 | Bryony Thompson Marked gene: FGF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.69 | FGF4 | Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.69 | FGF4 | Bryony Thompson Classified gene: FGF4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.69 | FGF4 | Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2535 | FGF4 | Bryony Thompson Marked gene: FGF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2535 | FGF4 | Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2535 | FGF4 | Bryony Thompson Classified gene: FGF4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2535 | FGF4 | Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2534 | EIF3K | Bryony Thompson Marked gene: EIF3K as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2534 | EIF3K | Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2534 | EIF3K | Bryony Thompson Classified gene: EIF3K as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2534 | EIF3K | Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Marked gene: EIF3K as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Classified gene: EIF3K as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.124 | EIF3K | Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.37 | PCNA | Bryony Thompson Marked gene: PCNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.37 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.37 | PCNA | Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.37 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2533 | PCNA | Bryony Thompson Marked gene: PCNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2533 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2533 | PCNA | Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2533 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Marked gene: PCNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.123 | PCNA | Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.36 | RAB3A | Bryony Thompson Marked gene: RAB3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.36 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.36 | RAB3A | Bryony Thompson Classified gene: RAB3A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.36 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Marked gene: RAB3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Classified gene: RAB3A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.122 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.92 | RAB3A | Bryony Thompson Marked gene: RAB3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.92 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.92 | RAB3A | Bryony Thompson Classified gene: RAB3A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.92 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2532 | RAB3A | Bryony Thompson Marked gene: RAB3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2532 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2532 | RAB3A | Bryony Thompson Classified gene: RAB3A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2532 | RAB3A | Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.121 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.35 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Ataxia - paediatric. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to autosomal dominant cerebellar ataxia MONDO:0020380 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.91 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2531 | RAB3A |
Bryony Thompson gene: RAB3A was added gene: RAB3A was added to Mendeliome. Sources: Literature Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAB3A were set to 40166812 Phenotypes for gene: RAB3A were set to autosomal dominant cerebellar ataxia MONDO:0020380; neurodevelopmental disorder MONDO:0700092 Review for gene: RAB3A was set to GREEN Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | LSM1 |
Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene. 3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes. The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments. RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | LSM1 | Sarah Milton edited their review of gene: LSM1: Changed publications: (PMID: 31010896, PMID: 36100156, PMID: 40204357) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | LSM1 | Sarah Milton reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 31010896, 36100156, 40204357); Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.324 | MYRF | Zornitza Stark Phenotypes for gene: MYRF were changed from Cardiac-urogenital syndrome, MIM# 618280 to Cardiac-urogenital syndrome, MIM# 618280; Nanophthalmos 1, MIM# 600165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.323 | MYRF | Zornitza Stark Publications for gene: MYRF were set to 30985895; 30070761; 31069960; 29446546; 30532227 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | MYRF | Zornitza Stark edited their review of gene: MYRF: Changed publications: 29446546, 29446546, 30532227, 31069960, 31266062 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | MYRF |
Zornitza Stark changed review comment from: Cardiac-urogenital syndrome is characterized by partial anomalous pulmonary venous return in association with tracheal anomalies, pulmonary hypoplasia, congenital diaphragmatic hernia, thyroid fibrosis, thymic involution, cleft spleen, penoscrotal hypospadias, and cryptorchidism. More than 10 unrelated individuals reported. Sources: Expert list; to: Cardiac-urogenital syndrome is characterized by partial anomalous pulmonary venous return in association with tracheal anomalies, pulmonary hypoplasia, congenital diaphragmatic hernia, thyroid fibrosis, thymic involution, cleft spleen, penoscrotal hypospadias, and cryptorchidism. More than 10 unrelated individuals reported. Also note association with nanophthalmos, which may also be detectable on US. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | MYRF | Zornitza Stark edited their review of gene: MYRF: Changed phenotypes: Cardiac-urogenital syndrome, MIM# 618280, Nanophthalmos 1, MIM# 600165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2530 | MYRF | Zornitza Stark Phenotypes for gene: MYRF were changed from Nanophthalmos and high hyperopia; Cardiac-urogenital syndrome, MIM# 618280; Encephalitis/encephalopathy, mild, with reversible myelin vacuolization, MIM# 618113 to Nanophthalmos 1, MIM# 600165; Cardiac-urogenital syndrome, MIM# 618280; Encephalitis/encephalopathy, mild, with reversible myelin vacuolization, MIM# 618113 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v1.46 | MYRF | Zornitza Stark Phenotypes for gene: MYRF were changed from Nanophthalmos; High hyperopia to Nanophthalmos 1, MIM# 600165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v1.45 | MYRF | Zornitza Stark edited their review of gene: MYRF: Changed phenotypes: Nanophthalmos 1, MIM# 600165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Ataxia - paediatric. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2529 | SIRT6 | Bryony Thompson Marked gene: SIRT6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2529 | SIRT6 | Bryony Thompson Gene: sirt6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2529 | SIRT6 | Bryony Thompson Phenotypes for gene: SIRT6 were changed from to perinatal disease MONDO:0100086 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2528 | SIRT6 | Bryony Thompson Classified gene: SIRT6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2528 | SIRT6 | Bryony Thompson Added comment: Comment on list classification: Single family and animal model | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2528 | SIRT6 | Bryony Thompson Gene: sirt6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2527 | MYO1A |
Sangavi Sivagnanasundram edited their review of gene: MYO1A: Added comment: A male infant presenting with congenital diarrhea from the age of 2. Compound heterozygous variants in MYO1A detected in trans were identified (I678F (FAF 0.5%); D240N (FAF - 0.004%) Supportive functional assay in patient fibroblasts was conducted along with a knockout mice model recapitulating human phenotype and findings consistent with the findings from the probands biopsy.; Changed rating: AMBER; Changed publications: 40174224; Changed phenotypes: Congenital diarrhea, MONDO:0000824; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.18 | MYO1A |
Sangavi Sivagnanasundram gene: MYO1A was added gene: MYO1A was added to Congenital Diarrhoea. Sources: Literature Mode of inheritance for gene: MYO1A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MYO1A were set to 40174224 Phenotypes for gene: MYO1A were set to Congenital diarrhea, MONDO:0000824 Review for gene: MYO1A was set to AMBER Added comment: A male infant presenting with congenital diarrhea from the age of 2. Compound heterozygous variants in MYO1A detected in trans were identified (I678F (FAF 0.5%); D240N (FAF - 0.004%) Supportive functional assay in patient fibroblasts was conducted along with a knockout mice model recapitulating human phenotype and findings consistent with the findings from the probands biopsy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2527 | MYO1A | Sangavi Sivagnanasundram reviewed gene: MYO1A: Rating: RED; Mode of pathogenicity: None; Publications: 24616153; Phenotypes: nonsyndromic genetic hearing loss MONDO:0019497; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.68 | FGF4 |
Sangavi Sivagnanasundram gene: FGF4 was added gene: FGF4 was added to Ciliopathies. Sources: Literature Mode of inheritance for gene: FGF4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FGF4 were set to 40259859 Phenotypes for gene: FGF4 were set to Jeune Syndrome, FGF4-related, MONDO:0018770 Review for gene: FGF4 was set to AMBER Added comment: Two families with three affected individuals reported with homozygous variants in FGF4. Family 1 - Consanguineous parents with five children. Three are unaffected and two are affected with Jeune syndrome - like phenotypes. One of the affected siblings is deceased. Proband was diagnosed with pulmonary hypoplasia at 6 months and later identified to have Jeune Syndrome due to other findings. Homozygous p.Leu86Phe missense variant was identified (variant absent from gnomAD v4.1) Family 2 - Non-consanguineous parents with affected son with Jeune syndrome like phenotype (pulmonary hypoplasia and thoracic dystrophy) Homozygous p.Pro204His missense variant was identified (variant absent from gnomAD v4.1) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2527 | FGF4 |
Sangavi Sivagnanasundram gene: FGF4 was added gene: FGF4 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: FGF4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FGF4 were set to 40259859 Phenotypes for gene: FGF4 were set to Jeune Syndrome, FGF4-related, MONDO:0018770 Review for gene: FGF4 was set to AMBER Added comment: Two families with three affected individuals reported with homozygous variants in FGF4. Family 1 - Consanguineous parents with five children. Three are unaffected and two are affected with Jeune syndrome - like phenotypes. One of the affected siblings is deceased. Proband was diagnosed with pulmonary hypoplasia at 6 months and later identified to have Jeune Syndrome due to other findings. Homozygous p.Leu86Phe missense variant was identified (variant absent from gnomAD v4.1) Family 2 - Non-consanguineous parents with affected son with Jeune syndrome like phenotype (pulmonary hypoplasia and thoracic dystrophy) Homozygous p.Pro204His missense variant was identified (variant absent from gnomAD v4.1) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2527 | EIF3K | Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | EIF3K | Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | ODC1 | Bryony Thompson Marked gene: ODC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | ODC1 | Bryony Thompson Gene: odc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | ODC1 | Bryony Thompson Classified gene: ODC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.322 | ODC1 | Bryony Thompson Gene: odc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Myasthenia v1.12 | UNC50 | Bryony Thompson Marked gene: UNC50 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Myasthenia v1.12 | UNC50 | Bryony Thompson Gene: unc50 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Myasthenia v1.12 | UNC50 | Bryony Thompson Classified gene: UNC50 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Myasthenia v1.12 | UNC50 | Bryony Thompson Gene: unc50 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Myasthenia v1.11 | UNC50 |
Bryony Thompson gene: UNC50 was added gene: UNC50 was added to Congenital Myasthenia. Sources: Literature Mode of inheritance for gene: UNC50 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UNC50 were set to 33820833; 29016857; 40219868 Phenotypes for gene: UNC50 were set to arthrogryposis multiplex congenita MONDO:0015168; congenital myasthenic syndrome MONDO:0018940 Review for gene: UNC50 was set to AMBER Added comment: 3 probands reported, 2 with AMC and 1 with CMS. PMID: 33820833 & PMID: 29016857 report the same French AMC proband with a homozygous frameshift variant (c.750_751del:p.Cys251Phefs*4). In the methods section PMID: 33820833 states that morphological analyses of skeletal muscle, neuromuscular junction or peripheral nerve in patient samples, and functional validation of newly identified genes were reported in separate reports, including PMID: 29016857. Supporting C. elegans model with loss of AChR expression. PMID: 40219868 - the same homozygous splice variant c.644-13_644-9del was reported in 2 unrelated Indian probands, one with AMC and one with a congenital myasthenic syndrome. Both families had affected siblings with consistent phenotypes, which were not tested for the variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.321 | UNC50 | Bryony Thompson reviewed gene: UNC50: Rating: AMBER; Mode of pathogenicity: None; Publications: 33820833, 29016857, 40219868; Phenotypes: arthrogryposis multiplex congenita MONDO:0015168, congenital myasthenic syndrome MONDO:0018940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2527 | UNC50 | Bryony Thompson Phenotypes for gene: UNC50 were changed from Arthrogryposis multiplex congenita to arthrogryposis multiplex congenita MONDO:0015168; congenital myasthenic syndrome MONDO:0018940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2526 | UNC50 | Bryony Thompson Publications for gene: UNC50 were set to 29016857; 33820833 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | UNC50 | Bryony Thompson reviewed gene: UNC50: Rating: AMBER; Mode of pathogenicity: None; Publications: 33820833, 29016857, 40219868; Phenotypes: arthrogryposis multiplex congenita MONDO:0015168, congenital myasthenic syndrome MONDO:0018940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.419 | UNC50 | Bryony Thompson edited their review of gene: UNC50: Changed phenotypes: arthrogryposis multiplex congenita MONDO:0015168, congenital myasthenic syndrome MONDO:0018940 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | EIF3K |
Sangavi Sivagnanasundram gene: EIF3K was added gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3K were set to 40219605 Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092 Review for gene: EIF3K was set to RED Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | EIF3K |
Sangavi Sivagnanasundram changed review comment from: More evidence will be needed to determine whether variants in EIF3K result in a neurodevelopmental disorder. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Literature; to: More evidence will be needed to determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | EIF3K |
Sangavi Sivagnanasundram gene: EIF3K was added gene: EIF3K was added to Mendeliome. Sources: Literature Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EIF3K were set to 40219605 Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092 Review for gene: EIF3K was set to RED Added comment: More evidence will be needed to determine whether variants in EIF3K result in a neurodevelopmental disorder. Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%). The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype. The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.419 | UNC50 | Bryony Thompson Phenotypes for gene: UNC50 were changed from Arthrogryposis multiplex congenita to Arthrogryposis multiplex congenita MONDO:0015168 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.418 | UNC50 | Bryony Thompson Publications for gene: UNC50 were set to 29016857; 33820833 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.417 | UNC50 | Bryony Thompson reviewed gene: UNC50: Rating: AMBER; Mode of pathogenicity: None; Publications: 33820833, 29016857, 40219868; Phenotypes: arthrogryposis multiplex congenita MONDO:0015168; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | MON1A | Bryony Thompson Marked gene: MON1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | MON1A | Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | MON1A | Bryony Thompson Classified gene: MON1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2525 | MON1A | Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.18 | MON1A | Bryony Thompson Marked gene: MON1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.18 | MON1A | Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.18 | MON1A | Bryony Thompson Classified gene: MON1A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.18 | MON1A | Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2524 | MON1A |
Bryony Thompson gene: MON1A was added gene: MON1A was added to Mendeliome. Sources: Literature Mode of inheritance for gene: MON1A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MON1A were set to 40174224 Phenotypes for gene: MON1A were set to Congenital diarrhea MONDO:0000824 Review for gene: MON1A was set to AMBER Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.17 | MON1A |
Bryony Thompson gene: MON1A was added gene: MON1A was added to Congenital Diarrhoea. Sources: Literature Mode of inheritance for gene: MON1A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MON1A were set to 40174224 Phenotypes for gene: MON1A were set to Congenital diarrhea MONDO:0000824 Review for gene: MON1A was set to AMBER Added comment: A single homozygous (R249C) case with congenital diarrhoea from a consanguineous family. Supporting in vitro assays and expression studies in the patient cells. Also, a knockout zebrafish model that had a phenotype consistent with enteropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TUBA1C |
Jasmine Chew gene: TUBA1C was added gene: TUBA1C was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TUBA1C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TUBA1C were set to 39209701 Phenotypes for gene: TUBA1C were set to Oocyte/zygote/embryo maturation arrest Review for gene: TUBA1C was set to GREEN Added comment: New paper (biallelic variants for OZEMA)- i) PMID: 39209701- patients 1 and 2 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carrying homozygous nonsense variant (p.Gln358Ter) and frameshift deletion variant (p.Tyr444Metfs*42), respectively. Transfection studies showed that both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TUBA4A | Jasmine Chew edited their review of gene: TUBA4A: Changed publications: 39209701, 37024973, 39872894 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TUBA4A |
Jasmine Chew changed review comment from: New papers reporting biallelic and monoallelic variants associated with OZEMA: i) PMID: 39209701- patients 3 and 4 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carried homozygous frameshift deletion variant c.1319_1320del (p.Tyr440Ter) and missense variant c.1015C>T (p.Arg339Cys) of TUBA4A, respectively. Transfection studies showed that caused both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Differentially abundant transcripts in arrested embryos carrying the missense TUBA4A variant exhibited a trend of upregulation and were highly enriched in the mRNA metabolic process, and some key genes involved in degradation, such as MOS and PABPN1L have been shown to be significantly downregulated. ii) PMID: 37024973 - reported three unrelated infertile females with similar phenotypes of embryonic arrest carrying different de novo heterozygous missense variants (pE77K, pL286P, p.C347K). Functional study showed that all the three mutant proteins caused severe microtubule destabilization. They also identified additional nine sporadic cases (seven were with phenotype of early embryonic arrest and two with phenotype of oocyte maturation arrest) with eight different heterozygous missense TUBA4A variants. Functional study showed that six out of the eight variants (R215H, R229C, A273V, E284K, A314V, and R373H) were incorporated in microtubules with a more severely abnormal appearance. Microinjection of TUBA4A mutant cRNAs (8 out of 11 variants) significantly reduced the rate of first polar body extrusion to 24.5–66.3% and microinjection of TUBA4A mutant cRNAs (6 out of 11 variants) also resulted in embryonic development arrest and reduced the rate of blastocyst formation to 51.0–65.0%. iii) PMID: 39872894- Three isolated infertile female with zygotic arrest carrying heterozygous missense variants (P1- de novo p.E284K, P2- p.E284G, P3- p.E284K). Injection of mRNA encoding E284G and E284K mutants into mouse GV oocytes showed highly disrupted spindle morphology and apparent chromosome misalignment, only about 30% E284G- and E284K-injected oocytes completed meiosis I. Sources: Literature; to: New papers reporting biallelic and monoallelic variants associated with OZEMA: i) PMID: 39209701- Patients 3 and 4 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carried homozygous frameshift deletion variant p.Tyr440Ter and missense variant p.Arg339Cys respectively. Transfection studies showed that caused both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Differentially abundant transcripts in arrested embryos carrying the missense TUBA4A variant exhibited a trend of upregulation and were highly enriched in the mRNA metabolic process, and some key genes involved in degradation, such as MOS and PABPN1L have been shown to be significantly downregulated. ii) PMID: 37024973 - Three unrelated infertile females with similar phenotypes of embryonic arrest carrying different de novo heterozygous missense variants (pE77K, pL286P, p.C347K). Functional study showed that all the three mutant proteins caused severe microtubule destabilization. They also identified additional nine sporadic cases (seven were with phenotype of early embryonic arrest and two with phenotype of oocyte maturation arrest) with eight different heterozygous missense TUBA4A variants. Functional study showed that six out of the eight variants (R215H, R229C, A273V, E284K, A314V, and R373H) were incorporated in microtubules with a more severely abnormal appearance. Microinjection of TUBA4A mutant cRNAs (8 out of 11 variants) significantly reduced the rate of first polar body extrusion to 24.5–66.3% and microinjection of TUBA4A mutant cRNAs (6 out of 11 variants) also resulted in embryonic development arrest and reduced the rate of blastocyst formation to 51.0–65.0%. iii) PMID: 39872894- Three isolated infertile female with zygotic arrest carrying heterozygous missense variants (P1- de novo p.E284K, P2- p.E284G, P3- p.E284K). Injection of mRNA encoding E284G and E284K mutants into mouse GV oocytes showed highly disrupted spindle morphology and apparent chromosome misalignment, only about 30% E284G- and E284K-injected oocytes completed meiosis I. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TUBA4A | Jasmine Chew edited their review of gene: TUBA4A: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TUBA4A |
Jasmine Chew gene: TUBA4A was added gene: TUBA4A was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TUBA4A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TUBA4A were set to 39209701; 37024973; 37024973 Phenotypes for gene: TUBA4A were set to Oocyte/zygote/embryo maturation arrest Added comment: New papers reporting biallelic and monoallelic variants associated with OZEMA: i) PMID: 39209701- patients 3 and 4 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carried homozygous frameshift deletion variant c.1319_1320del (p.Tyr440Ter) and missense variant c.1015C>T (p.Arg339Cys) of TUBA4A, respectively. Transfection studies showed that caused both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Differentially abundant transcripts in arrested embryos carrying the missense TUBA4A variant exhibited a trend of upregulation and were highly enriched in the mRNA metabolic process, and some key genes involved in degradation, such as MOS and PABPN1L have been shown to be significantly downregulated. ii) PMID: 37024973 - reported three unrelated infertile females with similar phenotypes of embryonic arrest carrying different de novo heterozygous missense variants (pE77K, pL286P, p.C347K). Functional study showed that all the three mutant proteins caused severe microtubule destabilization. They also identified additional nine sporadic cases (seven were with phenotype of early embryonic arrest and two with phenotype of oocyte maturation arrest) with eight different heterozygous missense TUBA4A variants. Functional study showed that six out of the eight variants (R215H, R229C, A273V, E284K, A314V, and R373H) were incorporated in microtubules with a more severely abnormal appearance. Microinjection of TUBA4A mutant cRNAs (8 out of 11 variants) significantly reduced the rate of first polar body extrusion to 24.5–66.3% and microinjection of TUBA4A mutant cRNAs (6 out of 11 variants) also resulted in embryonic development arrest and reduced the rate of blastocyst formation to 51.0–65.0%. iii) PMID: 39872894- Three isolated infertile female with zygotic arrest carrying heterozygous missense variants (P1- de novo p.E284K, P2- p.E284G, P3- p.E284K). Injection of mRNA encoding E284G and E284K mutants into mouse GV oocytes showed highly disrupted spindle morphology and apparent chromosome misalignment, only about 30% E284G- and E284K-injected oocytes completed meiosis I. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.3 | FOXM1 | Bryony Thompson Marked gene: FOXM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.3 | FOXM1 | Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.3 | FOXM1 | Bryony Thompson Classified gene: FOXM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.3 | FOXM1 | Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v1.19 | FOXM1 | Bryony Thompson Marked gene: FOXM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v1.19 | FOXM1 | Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v1.19 | FOXM1 | Bryony Thompson Classified gene: FOXM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v1.19 | FOXM1 | Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2523 | GAP43 | Bryony Thompson Marked gene: GAP43 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2523 | GAP43 | Bryony Thompson Gene: gap43 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2523 | GAP43 | Bryony Thompson Classified gene: GAP43 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2523 | GAP43 | Bryony Thompson Gene: gap43 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral vascular malformations v1.1 | FOXM1 |
Bryony Thompson gene: FOXM1 was added gene: FOXM1 was added to Cerebral vascular malformations. Sources: Literature Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXM1 were set to 38969938 Phenotypes for gene: FOXM1 were set to Moyamoya disease MONDO:0016820 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v1.17 | FOXM1 |
Bryony Thompson gene: FOXM1 was added gene: FOXM1 was added to Stroke. Sources: Literature Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FOXM1 were set to 38969938 Phenotypes for gene: FOXM1 were set to Moyamoya disease MONDO:0016820 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2522 | FOXM1 | Bryony Thompson Marked gene: FOXM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2522 | FOXM1 | Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2522 | FOXM1 | Bryony Thompson Classified gene: FOXM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2522 | FOXM1 | Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.16 | GRWD1 | Bryony Thompson Marked gene: GRWD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.16 | GRWD1 | Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2521 | GRWD1 | Bryony Thompson Marked gene: GRWD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2521 | GRWD1 | Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.16 | GRWD1 | Bryony Thompson Classified gene: GRWD1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.16 | GRWD1 | Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2521 | GRWD1 | Bryony Thompson Classified gene: GRWD1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2521 | GRWD1 | Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Diarrhoea v1.15 | GRWD1 |
Bryony Thompson gene: GRWD1 was added gene: GRWD1 was added to Congenital Diarrhoea. Sources: Literature Mode of inheritance for gene: GRWD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GRWD1 were set to 40174224 Phenotypes for gene: GRWD1 were set to Congenital diarrhoea MONDO:0000824 Review for gene: GRWD1 was set to AMBER Added comment: Single family (sib pair) with biallelic missense variants. Supporting zebrafish model and in vitro functional assays. Deficiency is the expected mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2520 | GRWD1 |
Bryony Thompson gene: GRWD1 was added gene: GRWD1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GRWD1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GRWD1 were set to 40174224 Phenotypes for gene: GRWD1 were set to Congenital diarrhoea MONDO:0000824 Review for gene: GRWD1 was set to AMBER Added comment: Single family (sib pair) with biallelic missense variants. Supporting zebrafish model and in vitro functional assays. Deficiency is the expected mechanism of disease. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.556 | KDM5C | Zornitza Stark Marked gene: KDM5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.556 | KDM5C | Zornitza Stark Gene: kdm5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.556 | KDM5C | Zornitza Stark Phenotypes for gene: KDM5C were changed from Mental retardation, X-linked, syndromic, Claes-Jensen type, 300534 (3) to Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type; MIM#300534 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.555 | KDM5C | Zornitza Stark Publications for gene: KDM5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.554 | KCNQ1 | Zornitza Stark Marked gene: KCNQ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.554 | KCNQ1 | Zornitza Stark Gene: kcnq1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.554 | KCNQ1 | Zornitza Stark Phenotypes for gene: KCNQ1 were changed from Jervell and Lange-Nielsen syndrome, 220400 (3) to Jervell and Lange-Nielsen syndrome MIM#220400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.553 | KCNQ1 | Zornitza Stark Publications for gene: KCNQ1 were set to 29033053; 28438721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.552 | KCNJ11 | Zornitza Stark Marked gene: KCNJ11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.552 | KCNJ11 | Zornitza Stark Gene: kcnj11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.552 | KCNJ11 | Zornitza Stark Phenotypes for gene: KCNJ11 were changed from Hyperinsulinemic hypoglycemia, familial, 2, 601820 (3) to Hyperinsulinemic hypoglycemia, familial, 2, MIM#601820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.551 | KCNJ11 | Zornitza Stark Publications for gene: KCNJ11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.550 | KCNJ1 | Zornitza Stark Marked gene: KCNJ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.550 | KCNJ1 | Zornitza Stark Gene: kcnj1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.550 | KCNJ1 | Zornitza Stark Phenotypes for gene: KCNJ1 were changed from Bartter syndrome, type 2, 241200 (3) to Bartter syndrome, type 2, MIM#241200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.549 | KATNB1 | Zornitza Stark Marked gene: KATNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.549 | KATNB1 | Zornitza Stark Gene: katnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.549 | KATNB1 | Zornitza Stark Phenotypes for gene: KATNB1 were changed from Lissencephaly 6, with microcephaly, 616212 (3) to Lissencephaly 6, with microcephaly, MIM#616212 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.548 | KATNB1 | Zornitza Stark Publications for gene: KATNB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.547 | JAK3 | Zornitza Stark Marked gene: JAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.547 | JAK3 | Zornitza Stark Gene: jak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.547 | JAK3 | Zornitza Stark Phenotypes for gene: JAK3 were changed from SCID, autosomal recessive, T-negative/B-positive type, 600802 (3) to Severe combined immunodeficiency, autosomal recessive, T-negative/B-positive type MIM#600802 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.546 | JAK3 | Zornitza Stark Publications for gene: JAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.545 | IVD | Zornitza Stark Marked gene: IVD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.545 | IVD | Zornitza Stark Gene: ivd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.545 | IVD | Zornitza Stark Phenotypes for gene: IVD were changed from Isovaleric acidemia, 243500 (3) to Isovaleric acidemia, MIM #243500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.544 | IVD | Zornitza Stark Publications for gene: IVD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.543 | ITPR1 | Zornitza Stark Marked gene: ITPR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.543 | ITPR1 | Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.543 | ITPR1 | Zornitza Stark Phenotypes for gene: ITPR1 were changed from Gillespie syndrome, 206700 (3), Autosomal recessive to Gillespie syndrome, MIM# 206700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.542 | ITPR1 | Zornitza Stark Publications for gene: ITPR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.541 | ITGB4 | Zornitza Stark Marked gene: ITGB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.541 | ITGB4 | Zornitza Stark Gene: itgb4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.541 | ITGB4 | Zornitza Stark Phenotypes for gene: ITGB4 were changed from Epidermolysis bullosa, junctional, with pyloric atresia, 226730 (3) to Epidermolysis bullosa, junctional 5B, with pyloric atresia, MIM#226730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.540 | ITGB4 | Zornitza Stark Publications for gene: ITGB4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.539 | ITGA6 | Zornitza Stark Marked gene: ITGA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.539 | ITGA6 | Zornitza Stark Gene: itga6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.539 | ITGA6 | Zornitza Stark Phenotypes for gene: ITGA6 were changed from Epidermolysis bullosa, junctional, with pyloric stenosis, 226730 (3) to Epidermolysis bullosa, junctional 6, with pyloric atresia (MIM#619817) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.538 | IQSEC2 | Zornitza Stark Marked gene: IQSEC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.538 | IQSEC2 | Zornitza Stark Gene: iqsec2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.538 | IQSEC2 | Zornitza Stark Publications for gene: IQSEC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.537 | INVS | Zornitza Stark Marked gene: INVS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.537 | INVS | Zornitza Stark Gene: invs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.537 | INVS | Zornitza Stark Phenotypes for gene: INVS were changed from Nephronophthisis 2, infantile, 602088 (3) to Nephronophthisis 2, infantile, (MIM#602088) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.536 | INPP5E | Zornitza Stark Marked gene: INPP5E as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.536 | INPP5E | Zornitza Stark Gene: inpp5e has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.536 | INPP5E | Zornitza Stark Phenotypes for gene: INPP5E were changed from Joubert syndrome 1, 213300 (3) to Joubert syndrome 1, MIM# 213300; MONDO:0008944 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.535 | INPP5E | Zornitza Stark Publications for gene: INPP5E were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.534 | IL7R | Zornitza Stark Marked gene: IL7R as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.534 | IL7R | Zornitza Stark Gene: il7r has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.534 | IL2RG | Zornitza Stark Marked gene: IL2RG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.534 | IL2RG | Zornitza Stark Gene: il2rg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.534 | IL2RG | Zornitza Stark Phenotypes for gene: IL2RG were changed from Severe combined immunodeficiency, X-linked, 300400 (3) to Severe combined immunodeficiency, X-linked, MIM#300400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.533 | IL1RAPL1 | Zornitza Stark Marked gene: IL1RAPL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.533 | IL1RAPL1 | Zornitza Stark Gene: il1rapl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.533 | IL1RAPL1 | Zornitza Stark Phenotypes for gene: IL1RAPL1 were changed from Mental retardation, X-linked 21/34, 300143 (3) to Intellectual developmental disorder, X-linked 21, MIM#300143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.532 | IL1RAPL1 | Zornitza Stark Publications for gene: IL1RAPL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.531 | IKBKB | Zornitza Stark Marked gene: IKBKB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.531 | IKBKB | Zornitza Stark Gene: ikbkb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.531 | IKBKB | Zornitza Stark Phenotypes for gene: IKBKB were changed from Immunodeficiency 15, 615592 (3) to Immunodeficiency 15, MIM#615592 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.530 | IKBKB | Zornitza Stark Publications for gene: IKBKB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.529 | IGHMBP2 | Zornitza Stark Marked gene: IGHMBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.529 | IGHMBP2 | Zornitza Stark Gene: ighmbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.529 | IGHMBP2 | Zornitza Stark Phenotypes for gene: IGHMBP2 were changed from Neuronopathy, distal hereditary motor, type VI, 604320 (3) to Neuronopathy, distal hereditary motor, autosomal recessive 1 MIM#604320; Charcot-Marie-Tooth disease, axonal, type 2S MIM#616155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.528 | IGHMBP2 | Zornitza Stark Publications for gene: IGHMBP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.527 | IDUA | Zornitza Stark Marked gene: IDUA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.527 | IDUA | Zornitza Stark Gene: idua has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.527 | IDUA | Zornitza Stark Phenotypes for gene: IDUA were changed from Mucopolysaccharidosis Ih, 607014 (3) to Mucopolysaccharidosis Ih, MIM#607014 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.526 | IDS | Zornitza Stark Marked gene: IDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.526 | IDS | Zornitza Stark Gene: ids has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.526 | IDS | Zornitza Stark Phenotypes for gene: IDS were changed from Mucopolysaccharidosis II, 309900 (3) to Mucopolysaccharidosis II, MIM# 309900; Hunter syndrome, MONDO:0010674 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.525 | IDS | Zornitza Stark Publications for gene: IDS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.524 | HYLS1 | Zornitza Stark Marked gene: HYLS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.524 | HYLS1 | Zornitza Stark Gene: hyls1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.524 | HYLS1 | Zornitza Stark Phenotypes for gene: HYLS1 were changed from Hydrolethalus syndrome, 236680 (3) to Hydrolethalus syndrome (MIM#236680); Ciliopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.523 | HYLS1 | Zornitza Stark Publications for gene: HYLS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.522 | HUWE1 | Zornitza Stark Marked gene: HUWE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.522 | HUWE1 | Zornitza Stark Gene: huwe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.522 | HUWE1 | Zornitza Stark Phenotypes for gene: HUWE1 were changed from Mental retardation, X-linked syndromic, Turner type, 300706 (3) to Intellectual developmental disorder, X-linked syndromic, Turner type, MIM#309590 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.521 | HUWE1 | Zornitza Stark Publications for gene: HUWE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.520 | HSD3B2 | Zornitza Stark Marked gene: HSD3B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.520 | HSD3B2 | Zornitza Stark Gene: hsd3b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.520 | HSD3B2 | Zornitza Stark Phenotypes for gene: HSD3B2 were changed from 3-beta-hydroxysteroid dehydrogenase, type II, deficiency, 201810 (3) to Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency, MIM#201810 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.519 | HSD3B2 | Zornitza Stark Publications for gene: HSD3B2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.518 | HSD17B4 | Zornitza Stark Marked gene: HSD17B4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.518 | HSD17B4 | Zornitza Stark Gene: hsd17b4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.518 | HSD17B4 | Zornitza Stark Phenotypes for gene: HSD17B4 were changed from D-bifunctional protein deficiency, 261515 (3) to D-bifunctional protein deficiency, MIM#261515 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.517 | HSD17B10 | Zornitza Stark Marked gene: HSD17B10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.517 | HSD17B10 | Zornitza Stark Gene: hsd17b10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.517 | HSD17B10 | Zornitza Stark Phenotypes for gene: HSD17B10 were changed from HSD10 mitochondrial disease to HSD10 mitochondrial disease, MIM#300438 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.516 | HSD17B10 | Zornitza Stark Publications for gene: HSD17B10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.515 | HPS6 | Zornitza Stark Marked gene: HPS6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.515 | HPS6 | Zornitza Stark Gene: hps6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.515 | HPS6 | Zornitza Stark Phenotypes for gene: HPS6 were changed from Hermansky-Pudlak syndrome 6, 614075 (3) to Hermansky-Pudlak syndrome 6, MIM# 614075 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.514 | HPS6 | Zornitza Stark Publications for gene: HPS6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.513 | HPS5 | Zornitza Stark Marked gene: HPS5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.513 | HPS5 | Zornitza Stark Gene: hps5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.513 | HPS5 | Zornitza Stark Phenotypes for gene: HPS5 were changed from Hermansky-Pudlak syndrome 5, 614074 (3) to Hermansky-Pudlak syndrome 5 MIM#614074 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.512 | HPS4 | Zornitza Stark Marked gene: HPS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.512 | HPS4 | Zornitza Stark Gene: hps4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.512 | HPS4 | Zornitza Stark Phenotypes for gene: HPS4 were changed from Hermansky-Pudlak syndrome 4, 614073 (3) to Hermansky-Pudlak syndrome 4, MIM #614073 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.511 | HPS4 | Zornitza Stark Publications for gene: HPS4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.510 | HPS3 | Zornitza Stark Marked gene: HPS3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.510 | HPS3 | Zornitza Stark Gene: hps3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.510 | HPS3 | Zornitza Stark Phenotypes for gene: HPS3 were changed from Hermansky-Pudlak syndrome 3, 614072 (3) to Hermansky-Pudlak syndrome 3 MIM#614072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.509 | HPS3 | Zornitza Stark Publications for gene: HPS3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.508 | HPS1 | Zornitza Stark Marked gene: HPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.508 | HPS1 | Zornitza Stark Gene: hps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.508 | HPS1 | Zornitza Stark Phenotypes for gene: HPS1 were changed from Hermansky-Pudlak syndrome 1, 203300 (3) to Hermansky-Pudlak syndrome 1, MIM#203300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.507 | HPS1 | Zornitza Stark Publications for gene: HPS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.506 | HPRT1 | Zornitza Stark Marked gene: HPRT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.506 | HPRT1 | Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.506 | HPRT1 | Zornitza Stark Phenotypes for gene: HPRT1 were changed from Lesch-Nyhan syndrome, 300322 (3) to Lesch-Nyhan syndrome (MIM#300322) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.505 | HPRT1 | Zornitza Stark Publications for gene: HPRT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.504 | HPD | Zornitza Stark Marked gene: HPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.504 | HPD | Zornitza Stark Gene: hpd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.504 | HPD | Zornitza Stark Phenotypes for gene: HPD were changed from Tyrosinemia, type III, 276710 (3) to Tyrosinaemia, type III, MIM#276710 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.503 | HPD | Zornitza Stark Publications for gene: HPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.502 | HMGCS2 | Zornitza Stark Marked gene: HMGCS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.502 | HMGCS2 | Zornitza Stark Gene: hmgcs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.502 | HMGCS2 | Zornitza Stark Phenotypes for gene: HMGCS2 were changed from HMG-CoA synthase-2 deficiency, 605911 (3) to HMG-CoA synthase-2 deficiency, MIM#605911 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.501 | HMGCS2 | Zornitza Stark Publications for gene: HMGCS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.500 | HMGCL | Zornitza Stark Marked gene: HMGCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.500 | HMGCL | Zornitza Stark Gene: hmgcl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.500 | HMGCL | Zornitza Stark Phenotypes for gene: HMGCL were changed from HMG-CoA lyase deficiency, 246450 (3) to HMG-CoA lyase deficiency, MIM# 246450 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.499 | HLCS | Zornitza Stark Marked gene: HLCS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.499 | HLCS | Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.499 | HLCS | Zornitza Stark Phenotypes for gene: HLCS were changed from Holocarboxylase synthetase deficiency, 253270 (3) to Holocarboxylase synthetase deficiency MIM#253270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.498 | HIBCH | Zornitza Stark Marked gene: HIBCH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.498 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.498 | HIBCH | Zornitza Stark Phenotypes for gene: HIBCH were changed from 3-hydroxyisobutryl-CoA hydrolase deficiency, 250620 (3) to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM#250620 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.497 | HIBCH | Zornitza Stark Publications for gene: HIBCH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.496 | HGSNAT | Zornitza Stark Marked gene: HGSNAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.496 | HGSNAT | Zornitza Stark Gene: hgsnat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.496 | HGSNAT | Zornitza Stark Phenotypes for gene: HGSNAT were changed from Mucopolysaccharidosis type IIIC (Sanfilippo C), 252930 (3) to Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM#252930; Retinitis pigmentosa 73, MIM#616544 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.495 | HGSNAT | Zornitza Stark Publications for gene: HGSNAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.494 | HFE2 | Zornitza Stark Marked gene: HFE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.494 | HFE2 | Zornitza Stark Gene: hfe2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.494 | HFE2 | Zornitza Stark Phenotypes for gene: HFE2 were changed from Hemochromatosis, type 2A, 602390 (3) to Haemochromatosis, type 2A, MIM#602390 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.493 | HEXB | Zornitza Stark Marked gene: HEXB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.493 | HEXB | Zornitza Stark Gene: hexb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.493 | HEXB | Zornitza Stark Phenotypes for gene: HEXB were changed from Sandhoff disease, infantile, juvenile, and adult forms, 268800 (3) to Sandhoff disease, infantile, juvenile, and adult forms, MIM#268800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.492 | HEXB | Zornitza Stark Publications for gene: HEXB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.491 | HEXA | Zornitza Stark Marked gene: HEXA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.491 | HEXA | Zornitza Stark Gene: hexa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.491 | HEXA | Zornitza Stark Phenotypes for gene: HEXA were changed from Tay-Sachs disease, 272800 (3) to Tay-Sachs disease, MIM#272800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.490 | HEXA | Zornitza Stark Publications for gene: HEXA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.489 | HCFC1 | Zornitza Stark Marked gene: HCFC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.489 | HCFC1 | Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.489 | HCFC1 | Zornitza Stark Phenotypes for gene: HCFC1 were changed from Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ), 309541 (3) to Methylmalonic aciduria and homocysteinemia, cblX type, MIM#309541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.488 | HCFC1 | Zornitza Stark Publications for gene: HCFC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.487 | HBB | Zornitza Stark Marked gene: HBB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.487 | HBB | Zornitza Stark Gene: hbb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.487 | HBB | Zornitza Stark Phenotypes for gene: HBB were changed from Thalassemias, beta-, 613985 (3) to Sickle cell anaemia, MIM# 603903 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.486 | HAX1 | Zornitza Stark Marked gene: HAX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.486 | HAX1 | Zornitza Stark Gene: hax1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.486 | HAX1 | Zornitza Stark Phenotypes for gene: HAX1 were changed from Neutropenia, severe congenital 3, autosomal recessive, 610738 (3) to Neutropenia, severe congenital 3, autosomal recessive, MIM#610738 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.485 | HAX1 | Zornitza Stark Publications for gene: HAX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.484 | HAMP | Zornitza Stark Marked gene: HAMP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.484 | HAMP | Zornitza Stark Gene: hamp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.484 | HAMP | Zornitza Stark Phenotypes for gene: HAMP were changed from Hemochromatosis, type 2B, 613313 (3) to Haemochromatosis, type 2B MIM#613313 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.483 | HAMP | Zornitza Stark Publications for gene: HAMP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.482 | HADHB | Zornitza Stark Marked gene: HADHB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.482 | HADHB | Zornitza Stark Gene: hadhb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.482 | HADHB | Zornitza Stark Phenotypes for gene: HADHB were changed from Trifunctional protein deficiency, 609015 (3) to Mitochondrial trifunctional protein deficiency 2 MIM#620300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.481 | HADHA | Zornitza Stark Marked gene: HADHA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.481 | HADHA | Zornitza Stark Gene: hadha has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.481 | HADHA | Zornitza Stark Phenotypes for gene: HADHA were changed from Fatty liver, acute, of pregnancy, 609016 (3) to LCHAD deficiency MIM#609016; Mitochondrial trifunctional protein deficiency 1 MIM#609015 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.480 | HADH | Zornitza Stark Marked gene: HADH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.480 | HADH | Zornitza Stark Gene: hadh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.480 | HADH | Zornitza Stark Phenotypes for gene: HADH were changed from 3-hydroxyacyl-CoA dehydrogenase deficiency, 231530 (3) to 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.479 | HADH | Zornitza Stark Publications for gene: HADH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.478 | GUSB | Zornitza Stark Marked gene: GUSB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.478 | GUSB | Zornitza Stark Gene: gusb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.478 | GUSB | Zornitza Stark Phenotypes for gene: GUSB were changed from Mucopolysaccharidosis VII, 253220 (3) to Mucopolysaccharidosis VII, MIM# 253220 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.477 | GUSB | Zornitza Stark Publications for gene: GUSB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.476 | GUCY2D | Zornitza Stark Marked gene: GUCY2D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.476 | GUCY2D | Zornitza Stark Gene: gucy2d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.476 | GUCY2D | Zornitza Stark Phenotypes for gene: GUCY2D were changed from Leber congenital amaurosis 1, 204000 (3) to Leber congenital amaurosis 1, MIM #204000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.475 | GUCY2D | Zornitza Stark Publications for gene: GUCY2D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.474 | GSS | Zornitza Stark Marked gene: GSS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.474 | GSS | Zornitza Stark Gene: gss has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.474 | GSS | Zornitza Stark Phenotypes for gene: GSS were changed from Glutathione synthetase deficiency, 266130 (3) to Glutathione synthetase deficiency MIM#266130 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.473 | GPSM2 | Zornitza Stark Marked gene: GPSM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.473 | GPSM2 | Zornitza Stark Gene: gpsm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.473 | GPSM2 | Zornitza Stark Phenotypes for gene: GPSM2 were changed from Chudley-McCullough syndrome, 604213 (3) to Chudley-McCullough syndrome MIM#604213 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.472 | GPSM2 | Zornitza Stark Publications for gene: GPSM2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.471 | GPR143 | Zornitza Stark Marked gene: GPR143 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.471 | GPR143 | Zornitza Stark Gene: gpr143 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.471 | GPR143 | Zornitza Stark Phenotypes for gene: GPR143 were changed from Ocular albinism, type I, Nettleship-Falls type, 300500 (3) to Nystagmus 6, congenital, X-linked, MIM#300814; Ocular albinism, type I, Nettleship-Falls type, MIM#300500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.470 | GPR143 | Zornitza Stark Publications for gene: GPR143 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.469 | GPC3 | Zornitza Stark Marked gene: GPC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.469 | GPC3 | Zornitza Stark Gene: gpc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.469 | GPC3 | Zornitza Stark Phenotypes for gene: GPC3 were changed from Simpson-Golabi-Behmel syndrome, type 1, 312870 (3) to Simpson-Golabi-Behmel syndrome, type 1, MIM #312870 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.468 | GPC3 | Zornitza Stark Publications for gene: GPC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.467 | GORAB | Zornitza Stark Marked gene: GORAB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.467 | GORAB | Zornitza Stark Gene: gorab has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.467 | GORAB | Zornitza Stark Phenotypes for gene: GORAB were changed from Geroderma osteodysplasticum, 231070 (3) to Geroderma osteodysplasticum, MIM#231070; MONDO:0009271 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.466 | GORAB | Zornitza Stark Publications for gene: GORAB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.465 | GNS | Zornitza Stark Marked gene: GNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.465 | GNS | Zornitza Stark Gene: gns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.465 | GNS | Zornitza Stark Phenotypes for gene: GNS were changed from Mucopolysaccharidosis type IIID, 252940 (3) to Mucopolysaccharidosis type IIID, MIM# 252940; Sanfilippo syndrome type D, MONDO:0009658 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.464 | GNS | Zornitza Stark Publications for gene: GNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.463 | GNPTG | Zornitza Stark Marked gene: GNPTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.463 | GNPTG | Zornitza Stark Gene: gnptg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.463 | GNPTG | Zornitza Stark Phenotypes for gene: GNPTG were changed from Mucolipidosis III gamma, 252605 (3) to Mucolipidosis III gamma, MIM# 252605 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.462 | GNPTG | Zornitza Stark Publications for gene: GNPTG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.461 | GNPTAB | Zornitza Stark Marked gene: GNPTAB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.461 | GNPTAB | Zornitza Stark Gene: gnptab has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.461 | GNPTAB | Zornitza Stark Phenotypes for gene: GNPTAB were changed from Mucolipidosis III alpha/beta, 252600 (3) to Mucolipidosis III alpha/beta MIM#252600; Mucolipidosis II alpha/beta MIM#252500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.460 | GNPAT | Zornitza Stark Marked gene: GNPAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.460 | GNPAT | Zornitza Stark Gene: gnpat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.460 | GNPAT | Zornitza Stark Phenotypes for gene: GNPAT were changed from Chondrodysplasia punctata, rhizomelic, type 2, 222765 (3) to Rhizomelic chondrodysplasia punctata, type 2 (MIM# 222765) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.459 | GNPAT | Zornitza Stark Publications for gene: GNPAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.458 | GNB5 | Zornitza Stark Marked gene: GNB5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.458 | GNB5 | Zornitza Stark Gene: gnb5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.458 | GNB5 | Zornitza Stark Phenotypes for gene: GNB5 were changed from Intellectual developmental disorder with cardiac arrhythmia, 617173 (3), Autosomal recessive to Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173); Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.457 | GNB5 | Zornitza Stark Publications for gene: GNB5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.456 | GLE1 | Zornitza Stark Marked gene: GLE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.456 | GLE1 | Zornitza Stark Gene: gle1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.456 | GLE1 | Zornitza Stark Phenotypes for gene: GLE1 were changed from Arthrogryposis, lethal, with anterior horn cell disease, 611890 (3) to Congenital arthrogryposis with anterior horn cell disease, MIM #611890; Lethal congenital contracture syndrome 1, MIM #253310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.455 | GLE1 | Zornitza Stark Publications for gene: GLE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.454 | GLDC | Zornitza Stark Marked gene: GLDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.454 | GLDC | Zornitza Stark Gene: gldc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.454 | GLDC | Zornitza Stark Phenotypes for gene: GLDC were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy1 (MIM#605899) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.453 | GLDC | Zornitza Stark Publications for gene: GLDC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.452 | GLB1 | Zornitza Stark Marked gene: GLB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.452 | GLB1 | Zornitza Stark Gene: glb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.452 | GLB1 | Zornitza Stark Phenotypes for gene: GLB1 were changed from Mucopolysaccharidosis type IVB (Morquio), 253010 (3) to GM1-gangliosidosis, type I MIM#230500; GM1-gangliosidosis, type II MIM#230600; GM1-gangliosidosis, type III MIM#230650; Mucopolysaccharidosis type IVB (Morquio) MIM#253010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.451 | GLB1 | Zornitza Stark Publications for gene: GLB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.450 | GLA | Zornitza Stark Marked gene: GLA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.450 | GLA | Zornitza Stark Gene: gla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.450 | GLA | Zornitza Stark Publications for gene: GLA were set to 29649853; 20301469 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.449 | GJB1 | Zornitza Stark Marked gene: GJB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.449 | GJB1 | Zornitza Stark Gene: gjb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.449 | GJB1 | Zornitza Stark Phenotypes for gene: GJB1 were changed from Charcot-Marie-Tooth neuropathy, X-linked dominant, 1 (MIM#302800) to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM#302800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.448 | GJB1 | Zornitza Stark Publications for gene: GJB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.447 | GHR | Zornitza Stark Marked gene: GHR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.447 | GHR | Zornitza Stark Gene: ghr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.447 | GHR | Zornitza Stark Phenotypes for gene: GHR were changed from Laron dwarfism, 262500 (3) to Laron dwarfism, MIM#262500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.446 | GHR | Zornitza Stark Publications for gene: GHR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.445 | GFM1 | Zornitza Stark Marked gene: GFM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.445 | GFM1 | Zornitza Stark Gene: gfm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.445 | GFM1 | Zornitza Stark Phenotypes for gene: GFM1 were changed from Combined oxidative phosphorylation deficiency 1, 609060 (3) to Combined oxidative phosphorylation deficiency 1, MIM#609060 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.444 | GDF5 | Zornitza Stark Marked gene: GDF5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.444 | GDF5 | Zornitza Stark Gene: gdf5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.444 | GDF5 | Zornitza Stark Phenotypes for gene: GDF5 were changed from Chondrodysplasia, Grebe type, 200700 (3) to Acromesomelic dysplasia 2A MIM#200700; Acromesomelic dysplasia 2B MIM#228900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.443 | GDF5 | Zornitza Stark Publications for gene: GDF5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.442 | GDF1 | Zornitza Stark Marked gene: GDF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.442 | GDF1 | Zornitza Stark Gene: gdf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.442 | GDF1 | Zornitza Stark Phenotypes for gene: GDF1 were changed from Right atrial isomerism, 208530 (3) to Right atrial isomerism (Ivemark), MIM #208530 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.441 | GDF1 | Zornitza Stark Publications for gene: GDF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.440 | GDAP1 | Zornitza Stark Marked gene: GDAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.440 | GDAP1 | Zornitza Stark Gene: gdap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.440 | GDAP1 | Zornitza Stark Phenotypes for gene: GDAP1 were changed from Charcot-Marie-Tooth disease, recessive intermediate, A, 608340 (3) to Charcot-Marie-Tooth disease, axonal, type 2K, MIM #607831; Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM #607706; Charcot-Marie-Tooth disease, recessive intermediate, A, MIM #608340; Charcot-Marie-Tooth disease, type 4A, MIM#214400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.439 | GDAP1 | Zornitza Stark Publications for gene: GDAP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.438 | GCH1 | Zornitza Stark Marked gene: GCH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.438 | GCH1 | Zornitza Stark Gene: gch1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.438 | GCH1 | Zornitza Stark Phenotypes for gene: GCH1 were changed from Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, 128230 (3) to Dystonia, DOPA-responsive, with or without hyperphenylalaninaemia, MIM#128230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.437 | GCH1 | Zornitza Stark Publications for gene: GCH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.436 | GCDH | Zornitza Stark Marked gene: GCDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.436 | GCDH | Zornitza Stark Gene: gcdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.436 | GCDH | Zornitza Stark Phenotypes for gene: GCDH were changed from Glutaricaciduria, type I, 231670 (3) to Glutaric aciduria, type I, MIM#231670 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.435 | GCDH | Zornitza Stark Publications for gene: GCDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.434 | GBE1 | Zornitza Stark Marked gene: GBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.434 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.434 | GBE1 | Zornitza Stark Phenotypes for gene: GBE1 were changed from Glycogen storage disease IV, 232500 (3) to Glycogen storage disease IV, MIM#232500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.433 | GATM | Zornitza Stark Marked gene: GATM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.433 | GATM | Zornitza Stark Gene: gatm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.433 | GATM | Zornitza Stark Phenotypes for gene: GATM were changed from Cerebral creatine deficiency syndrome 3, 612718 (3) to Cerebral creatine deficiency syndrome 3 MIM#612718; AGAT deficiency MONDO:0012996 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.432 | GATM | Zornitza Stark Publications for gene: GATM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.431 | GAMT | Zornitza Stark Marked gene: GAMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.431 | GAMT | Zornitza Stark Gene: gamt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.431 | GAMT | Zornitza Stark Phenotypes for gene: GAMT were changed from Cerebral creatine deficiency syndrome 2, 612736 (3) to Cerebral creatine deficiency syndrome 2 (MIM#612736) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.430 | GAMT | Zornitza Stark Publications for gene: GAMT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.429 | GALT | Zornitza Stark Marked gene: GALT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.429 | GALT | Zornitza Stark Gene: galt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.429 | GALT | Zornitza Stark Phenotypes for gene: GALT were changed from Galactosemia, 230400 (3) to Galactosaemia MIM# 230400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.428 | GALNS | Zornitza Stark Marked gene: GALNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.428 | GALNS | Zornitza Stark Gene: galns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.428 | GALNS | Zornitza Stark Phenotypes for gene: GALNS were changed from Mucopolysaccharidosis IVA, 253000 (3) to Mucopolysaccharidosis IVA, MIM#253000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.427 | GALNS | Zornitza Stark Publications for gene: GALNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.426 | GALC | Zornitza Stark Marked gene: GALC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.426 | GALC | Zornitza Stark Gene: galc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.426 | GALC | Zornitza Stark Phenotypes for gene: GALC were changed from Krabbe disease, 245200 (3) to Krabbe disease, MIM# 245200; MONDO:0009499 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.425 | GALC | Zornitza Stark Publications for gene: GALC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.424 | GAA | Zornitza Stark Marked gene: GAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.424 | GAA | Zornitza Stark Gene: gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.424 | GAA | Zornitza Stark Phenotypes for gene: GAA were changed from Glycogen storage disease II, 232300 (3) to Glycogen storage disease II, MIM#232300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.423 | GAA | Zornitza Stark Publications for gene: GAA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.422 | G6PC3 | Zornitza Stark Marked gene: G6PC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.422 | G6PC3 | Zornitza Stark Gene: g6pc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.422 | G6PC3 | Zornitza Stark Phenotypes for gene: G6PC3 were changed from Dursun syndrome, 612541 (3) to Dursun syndrome, MIM# 612541; Neutropenia, severe congenital 4, autosomal recessive, MIM# 612541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.421 | G6PC | Zornitza Stark Marked gene: G6PC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.421 | G6PC | Zornitza Stark Gene: g6pc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.421 | G6PC | Zornitza Stark Phenotypes for gene: G6PC were changed from Glycogen storage disease Ia, 232200 (3) to Glycogen storage disease Ia (MIM# 232200) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.420 | FUCA1 | Zornitza Stark Marked gene: FUCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.420 | FUCA1 | Zornitza Stark Gene: fuca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.420 | FUCA1 | Zornitza Stark Phenotypes for gene: FUCA1 were changed from Fucosidosis, 230000 (3) to Fucosidosis, MIM# 230000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.419 | FTSJ1 | Zornitza Stark Marked gene: FTSJ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.419 | FTSJ1 | Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.419 | FTSJ1 | Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Mental retardation, X-linked 9, 309549 (3) to Intellectual developmental disorder, X-linked 9 MIM#309549 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.418 | FTSJ1 | Zornitza Stark Publications for gene: FTSJ1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.417 | FREM2 | Zornitza Stark Marked gene: FREM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.417 | FREM2 | Zornitza Stark Gene: frem2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.417 | FREM2 | Zornitza Stark Phenotypes for gene: FREM2 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome, MIM#219000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.416 | FREM2 | Zornitza Stark Publications for gene: FREM2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.415 | FRAS1 | Zornitza Stark Marked gene: FRAS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.415 | FRAS1 | Zornitza Stark Gene: fras1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.415 | FRAS1 | Zornitza Stark Phenotypes for gene: FRAS1 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome 1 MIM#219000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.414 | FRAS1 | Zornitza Stark Publications for gene: FRAS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.413 | FOXRED1 | Zornitza Stark Marked gene: FOXRED1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.413 | FOXRED1 | Zornitza Stark Gene: foxred1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.413 | FOXRED1 | Zornitza Stark Phenotypes for gene: FOXRED1 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 19, MIM# 618241 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.412 | FOXRED1 | Zornitza Stark Publications for gene: FOXRED1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.411 | FOXN1 | Zornitza Stark Marked gene: FOXN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.411 | FOXN1 | Zornitza Stark Gene: foxn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.411 | FOXN1 | Zornitza Stark Phenotypes for gene: FOXN1 were changed from T-cell immunodeficiency, congenital alopecia, and nail dystrophy, 601705 (3) to T-cell immunodeficiency, congenital alopecia, and nail dystrophy MIM#601705 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.410 | FOXN1 | Zornitza Stark Publications for gene: FOXN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.409 | FMR1 | Zornitza Stark Marked gene: FMR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.409 | FMR1 | Zornitza Stark Gene: fmr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.409 | FMR1 | Zornitza Stark Phenotypes for gene: FMR1 were changed from Fragile X syndrome to Fragile X syndrome, MIM #300624 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.408 | FMR1 | Zornitza Stark Publications for gene: FMR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.407 | FLNA | Zornitza Stark Marked gene: FLNA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.407 | FLNA | Zornitza Stark Gene: flna has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.407 | FLNA | Zornitza Stark Phenotypes for gene: FLNA were changed from FG syndrome 2, 300321 (3) to Frontometaphyseal dysplasia 1, MIM#305620; Heterotopia, periventricular, 1, MIM#300049; Intestinal pseudoobstruction, neuronal, MIM#300048; Melnick-Needles syndrome, MIM#309350; Otopalatodigital syndrome, type I, MIM#311300; Otopalatodigital syndrome, type II, MIM#304120; Terminal osseous dysplasia, MIM#300244 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.406 | FLNA | Zornitza Stark Publications for gene: FLNA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.405 | FKTN | Zornitza Stark Marked gene: FKTN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.405 | FKTN | Zornitza Stark Gene: fktn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.405 | FKTN | Zornitza Stark Phenotypes for gene: FKTN were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4, 253800 (3) to Muscular dystrophy-dystroglycanopathy MONDO:0018276 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.404 | FKTN | Zornitza Stark Publications for gene: FKTN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.403 | FKRP | Zornitza Stark Marked gene: FKRP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.403 | FKRP | Zornitza Stark Gene: fkrp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.403 | FKRP | Zornitza Stark Phenotypes for gene: FKRP were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5, 613153 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5 (MIM#613153); Muscular dystrophy-dystroglycanopathy (congenital with or without intellectual development), type B, 5 (MIM#606612); Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 (MIM#607155) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.402 | FKRP | Zornitza Stark Publications for gene: FKRP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.401 | FKBP10 | Zornitza Stark Marked gene: FKBP10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.401 | FKBP10 | Zornitza Stark Gene: fkbp10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.401 | FKBP10 | Zornitza Stark Phenotypes for gene: FKBP10 were changed from Bruck syndrome 1, 259450 (3) to Bruck syndrome 1, MIM#259450; osteogenesis imperfecta, type XI, MIM#610968 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.400 | FKBP10 | Zornitza Stark Publications for gene: FKBP10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.399 | FHL1 | Zornitza Stark Marked gene: FHL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.399 | FHL1 | Zornitza Stark Gene: fhl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.399 | FHL1 | Zornitza Stark Phenotypes for gene: FHL1 were changed from Emery-Dreifuss muscular dystrophy 6, X-linked, 300696 (3) to Reducing body myopathy MONDO:0019948; X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.398 | FHL1 | Zornitza Stark Publications for gene: FHL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.397 | FH | Zornitza Stark Marked gene: FH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.397 | FH | Zornitza Stark Gene: fh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.397 | FH | Zornitza Stark Phenotypes for gene: FH were changed from Fumarase deficiency, 606812 (3) to Fumarase deficiency, MIM# 606812 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.396 | FH | Zornitza Stark Publications for gene: FH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.395 | FBXO7 | Zornitza Stark Marked gene: FBXO7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.395 | FBXO7 | Zornitza Stark Gene: fbxo7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.395 | FBXO7 | Zornitza Stark Phenotypes for gene: FBXO7 were changed from Parkinson disease 15, autosomal recessive, 260300 (3) to Parkinson disease 15, autosomal recessive, MIM#260300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.394 | FBXO7 | Zornitza Stark Publications for gene: FBXO7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.393 | FBP1 | Zornitza Stark Marked gene: FBP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.393 | FBP1 | Zornitza Stark Gene: fbp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.393 | FBP1 | Zornitza Stark Phenotypes for gene: FBP1 were changed from Fructose-1,6-bisphosphatase deficiency, 229700 (3) to Fructose-1,6-bisphosphatase deficiency, MIM#229700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.392 | FAT4 | Zornitza Stark Marked gene: FAT4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.392 | FAT4 | Zornitza Stark Gene: fat4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.392 | FAT4 | Zornitza Stark Phenotypes for gene: FAT4 were changed from Hennekam lymphangiectasia-lymphedema syndrome 2, 616006 (3) to Hennekam lymphangiectasia-lymphedema syndrome 2 MIM#616006; Van Maldergem syndrome 2 MIM#615546 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.391 | FAT4 | Zornitza Stark Publications for gene: FAT4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.390 | FANCL | Zornitza Stark Marked gene: FANCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.390 | FANCL | Zornitza Stark Gene: fancl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.390 | FANCL | Zornitza Stark Phenotypes for gene: FANCL were changed from Fanconi anemia, complementation group L, 614083 (3) to Fanconi anaemia, complementation group L MIM#614083 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.389 | FANCL | Zornitza Stark Publications for gene: FANCL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.388 | FANCI | Zornitza Stark Marked gene: FANCI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.388 | FANCI | Zornitza Stark Gene: fanci has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.388 | FANCI | Zornitza Stark Phenotypes for gene: FANCI were changed from Fanconi anemia, complementation group I, 609053 (3) to Fanconi anaemia, complementation group I, MIM#609053 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.387 | FANCI | Zornitza Stark Publications for gene: FANCI were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.386 | FANCG | Zornitza Stark Marked gene: FANCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.386 | FANCG | Zornitza Stark Gene: fancg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.386 | FANCG | Zornitza Stark Phenotypes for gene: FANCG were changed from Fanconi anemia, complementation group G, 614082 (3) to Fanconi anaemia, complementation group G, MIM#614082 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.385 | FANCG | Zornitza Stark Publications for gene: FANCG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.384 | FANCF | Zornitza Stark Marked gene: FANCF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.384 | FANCF | Zornitza Stark Gene: fancf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.384 | FANCF | Zornitza Stark Phenotypes for gene: FANCF were changed from Fanconi anemia, complementation group F, 603467 (3) to Fanconi anaemia, complementation group F, MIM#603467 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.383 | FANCF | Zornitza Stark Publications for gene: FANCF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.382 | FANCE | Zornitza Stark Marked gene: FANCE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.382 | FANCE | Zornitza Stark Gene: fance has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.382 | FANCE | Zornitza Stark Phenotypes for gene: FANCE were changed from Fanconi anemia, complementation group E, 600901 (3) to Fanconi anaemia, complementation group E, MIM#600901 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.381 | FANCE | Zornitza Stark Publications for gene: FANCE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.380 | FANCD2 | Zornitza Stark Marked gene: FANCD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.380 | FANCD2 | Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.380 | FANCD2 | Zornitza Stark Phenotypes for gene: FANCD2 were changed from Fanconi anemia, complementation group D2, 227646 (3) to Fanconi anaemia, complementation group D2, MIM#227646 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.379 | FANCD2 | Zornitza Stark Publications for gene: FANCD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.378 | FANCC | Zornitza Stark Marked gene: FANCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.378 | FANCC | Zornitza Stark Gene: fancc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.378 | FANCC | Zornitza Stark Phenotypes for gene: FANCC were changed from Fanconi anemia, complementation group C, 227645 (3) to Fanconi anaemia, complementation group C, MIM#227645 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.377 | FANCC | Zornitza Stark Publications for gene: FANCC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.376 | FANCB | Zornitza Stark Marked gene: FANCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.376 | FANCB | Zornitza Stark Gene: fancb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.376 | FANCB | Zornitza Stark Phenotypes for gene: FANCB were changed from Fanconi anemia, complementation group B, 300514 (3) to Fanconi anaemia, complementation group B, MIM#300514 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.375 | FANCA | Zornitza Stark Marked gene: FANCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.375 | FANCA | Zornitza Stark Gene: fanca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.375 | FANCA | Zornitza Stark Phenotypes for gene: FANCA were changed from Fanconi anemia, complementation group A, 227650 (3) to Fanconi anaemia, complementation group A, MIM# 227650; MONDO:0009215 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.374 | FAM126A | Zornitza Stark Marked gene: FAM126A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.374 | FAM126A | Zornitza Stark Gene: fam126a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.374 | FAM126A | Zornitza Stark Phenotypes for gene: FAM126A were changed from Leukodystrophy, hypomyelinating, 5, 610532 (3) to Leukodystrophy, hypomyelinating, 5 MIM#610532 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.373 | FAM126A | Zornitza Stark Publications for gene: FAM126A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.372 | FAH | Zornitza Stark Marked gene: FAH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.372 | FAH | Zornitza Stark Gene: fah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.372 | FAH | Zornitza Stark Phenotypes for gene: FAH were changed from Tyrosinemia, type I, 276700 (3) to Tyrosinaemia, type I, MIM# 276700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.371 | FAH | Zornitza Stark Publications for gene: FAH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.370 | F2 | Zornitza Stark Marked gene: F2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.370 | F2 | Zornitza Stark Gene: f2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.370 | F2 | Zornitza Stark Phenotypes for gene: F2 were changed from Hypoprothrombinaemia (MIM#613679); Dysprothrombinaemia, 613679 to Hypoprothrombinaemia (MIM#613679) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.369 | F2 | Zornitza Stark Publications for gene: F2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.368 | EXOSC8 | Zornitza Stark Marked gene: EXOSC8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.368 | EXOSC8 | Zornitza Stark Gene: exosc8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.368 | EXOSC8 | Zornitza Stark Phenotypes for gene: EXOSC8 were changed from Pontocerebellar hypoplasia, type 1C, 616081 (3) to Pontocerebellar hypoplasia, type 1C, MIM#616081 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.367 | EXOSC8 | Zornitza Stark Publications for gene: EXOSC8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.366 | EXOSC3 | Zornitza Stark Marked gene: EXOSC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.366 | EXOSC3 | Zornitza Stark Gene: exosc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.366 | EXOSC3 | Zornitza Stark Phenotypes for gene: EXOSC3 were changed from Pontocerebellar hypoplasia, type 1B, 614678 (3) to Pontocerebellar hypoplasia, type 1B, MIM# 614678 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.365 | EXOSC3 | Zornitza Stark Publications for gene: EXOSC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.364 | EVC2 | Zornitza Stark Marked gene: EVC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.364 | EVC2 | Zornitza Stark Gene: evc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.364 | EVC2 | Zornitza Stark Phenotypes for gene: EVC2 were changed from Ellis-van Creveld syndrome, 225500 (3) to Ellis-van Creveld syndrome MIM#225500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.363 | EVC2 | Zornitza Stark Publications for gene: EVC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.362 | EVC | Zornitza Stark Marked gene: EVC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.362 | EVC | Zornitza Stark Gene: evc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.362 | EVC | Zornitza Stark Phenotypes for gene: EVC were changed from Ellis-van Creveld syndrome, 225500 (3) to Ellis-van Creveld syndrome, MIM# 225500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.361 | EVC | Zornitza Stark Publications for gene: EVC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.360 | ETHE1 | Zornitza Stark Marked gene: ETHE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.360 | ETHE1 | Zornitza Stark Gene: ethe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.360 | ETHE1 | Zornitza Stark Phenotypes for gene: ETHE1 were changed from Ethylmalonic encephalopathy, 602473 (3) to Ethylmalonic encephalopathy, MIM#602473 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.359 | ETHE1 | Zornitza Stark Publications for gene: ETHE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.358 | ETFDH | Zornitza Stark Marked gene: ETFDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.358 | ETFDH | Zornitza Stark Gene: etfdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.358 | ETFDH | Zornitza Stark Phenotypes for gene: ETFDH were changed from Glutaric acidemia IIC, 231680 (3) to Glutaric acidemia IIC, MIM# 231680 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.357 | ETFDH | Zornitza Stark Publications for gene: ETFDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.356 | ETFB | Zornitza Stark Marked gene: ETFB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.356 | ETFB | Zornitza Stark Gene: etfb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.356 | ETFB | Zornitza Stark Phenotypes for gene: ETFB were changed from Glutaric acidemia IIB, 231680 (3) to Glutaric acidemia IIB, MIM# 231680 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.355 | ETFB | Zornitza Stark Publications for gene: ETFB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.354 | ETFA | Zornitza Stark Marked gene: ETFA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.354 | ETFA | Zornitza Stark Gene: etfa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.354 | ETFA | Zornitza Stark Phenotypes for gene: ETFA were changed from Glutaric acidemia IIA, 231680 (3) to Glutaric acidemia IIA, MIM# 231680 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.353 | ETFA | Zornitza Stark Publications for gene: ETFA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.352 | ESCO2 | Zornitza Stark Marked gene: ESCO2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.352 | ESCO2 | Zornitza Stark Gene: esco2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.352 | ESCO2 | Zornitza Stark Phenotypes for gene: ESCO2 were changed from SC phocomelia syndrome, 269000 (3) to Roberts-SC phocomelia syndrome (MIM#268300) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.351 | ESCO2 | Zornitza Stark Publications for gene: ESCO2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.350 | ERCC8 | Zornitza Stark Marked gene: ERCC8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.350 | ERCC8 | Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.350 | ERCC8 | Zornitza Stark Phenotypes for gene: ERCC8 were changed from Cockayne syndrome, type A, 216400 (3) to Cockayne syndrome, type A, MIM#216400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.349 | ERCC6 | Zornitza Stark Marked gene: ERCC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.349 | ERCC6 | Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.349 | ERCC6 | Zornitza Stark Phenotypes for gene: ERCC6 were changed from Cockayne syndrome, type B, 133540 (3) to Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.348 | ERCC6 | Zornitza Stark Publications for gene: ERCC6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.347 | ERCC5 | Zornitza Stark Marked gene: ERCC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.347 | ERCC5 | Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.347 | ERCC5 | Zornitza Stark Phenotypes for gene: ERCC5 were changed from Xeroderma pigmentosum, group G, 278780 (3) to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.346 | ERCC5 | Zornitza Stark Publications for gene: ERCC5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.345 | ERCC4 | Zornitza Stark Marked gene: ERCC4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.345 | ERCC4 | Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.345 | ERCC4 | Zornitza Stark Phenotypes for gene: ERCC4 were changed from Fanconi anemia, complementation group Q, 615272 (3) to Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108; Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215; XFE progeroid syndrome, MIM# 610965 MONDO:0012590 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.344 | ERCC2 | Zornitza Stark Marked gene: ERCC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.344 | ERCC2 | Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.344 | ERCC2 | Zornitza Stark Phenotypes for gene: ERCC2 were changed from Cerebrooculofacioskeletal syndrome 2, 610756 (3) to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675; Xeroderma pigmentosum, group D, MIM# 278730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.343 | ERCC2 | Zornitza Stark Publications for gene: ERCC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.342 | EPG5 | Zornitza Stark Marked gene: EPG5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.342 | EPG5 | Zornitza Stark Gene: epg5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.342 | EPG5 | Zornitza Stark Phenotypes for gene: EPG5 were changed from Vici syndrome, 242840 (3) to Vici syndrome MIM# 242840 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.341 | EPG5 | Zornitza Stark Publications for gene: EPG5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.340 | ENPP1 | Zornitza Stark Marked gene: ENPP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.340 | ENPP1 | Zornitza Stark Gene: enpp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.340 | ENPP1 | Zornitza Stark Phenotypes for gene: ENPP1 were changed from Hypophosphatemic rickets, autosomal recessive, 2, 613312 (3) to Arterial calcification, generalized, of infancy, 1 MIM#208000; Hypophosphatemic rickets, autosomal recessive, 2 MIM#613312 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.339 | ENPP1 | Zornitza Stark Publications for gene: ENPP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.338 | EMD | Zornitza Stark Marked gene: EMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.338 | EMD | Zornitza Stark Gene: emd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.338 | EMD | Zornitza Stark Phenotypes for gene: EMD were changed from Emery-Dreifuss muscular dystrophy 1, X-linked, 310300 (3) to Emery-Dreifuss muscular dystrophy 1, X-linked, MIM# 310300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.337 | EMD | Zornitza Stark Publications for gene: EMD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.336 | ELP1 | Zornitza Stark Marked gene: ELP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.336 | ELP1 | Zornitza Stark Gene: elp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.336 | ELP1 | Zornitza Stark Phenotypes for gene: ELP1 were changed from Dysautonomia, familial, 223900 (3) to Dysautonomia, familial MIM#223900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.335 | ELP1 | Zornitza Stark Publications for gene: ELP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.334 | EIF2B5 | Zornitza Stark Marked gene: EIF2B5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.334 | EIF2B5 | Zornitza Stark Gene: eif2b5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.334 | EIF2B5 | Zornitza Stark Phenotypes for gene: EIF2B5 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 5, with or without ovarian failure (MIM#620315) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.333 | EIF2B5 | Zornitza Stark Publications for gene: EIF2B5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.332 | EIF2B4 | Zornitza Stark Marked gene: EIF2B4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.332 | EIF2B4 | Zornitza Stark Gene: eif2b4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.332 | EIF2B4 | Zornitza Stark Phenotypes for gene: EIF2B4 were changed from Leukoencephaly with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 4, with or without ovarian failure MIM#620314 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.331 | EIF2B4 | Zornitza Stark Publications for gene: EIF2B4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.330 | EIF2B3 | Zornitza Stark Marked gene: EIF2B3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.330 | EIF2B3 | Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.330 | EIF2B3 | Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.329 | EIF2B3 | Zornitza Stark Publications for gene: EIF2B3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.328 | EIF2B2 | Zornitza Stark Marked gene: EIF2B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.328 | EIF2B2 | Zornitza Stark Gene: eif2b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.328 | EIF2B2 | Zornitza Stark Phenotypes for gene: EIF2B2 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 2, with or without ovarian failure, MIM #620312 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.327 | EIF2B2 | Zornitza Stark Publications for gene: EIF2B2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.326 | EIF2B1 | Zornitza Stark Marked gene: EIF2B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.326 | EIF2B1 | Zornitza Stark Gene: eif2b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.326 | EIF2B1 | Zornitza Stark Phenotypes for gene: EIF2B1 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 1, with or without ovarian failure MIM#603896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.325 | EIF2B1 | Zornitza Stark Publications for gene: EIF2B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.324 | EIF2AK3 | Zornitza Stark Marked gene: EIF2AK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.324 | EIF2AK3 | Zornitza Stark Gene: eif2ak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.324 | EIF2AK3 | Zornitza Stark Phenotypes for gene: EIF2AK3 were changed from Wolcott-Rallison syndrome, 226980 (3) to Wolcott-Rallison syndrome MIM#226980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.323 | EIF2AK3 | Zornitza Stark Publications for gene: EIF2AK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.322 | EDA | Zornitza Stark Marked gene: EDA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.322 | EDA | Zornitza Stark Gene: eda has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.322 | EDA | Zornitza Stark Phenotypes for gene: EDA were changed from Ectodermal dysplasia 1, hypohidrotic, X-linked, 305100 (3) to Ectodermal dysplasia 1, hypohidrotic, X-linked MIM#305100; Tooth agenesis, selective, X-linked 1 MIM#313500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.321 | EDA | Zornitza Stark Publications for gene: EDA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.320 | ECHS1 | Zornitza Stark Marked gene: ECHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.320 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.320 | ECHS1 | Zornitza Stark Phenotypes for gene: ECHS1 were changed from Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, 616277 (3) to Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.319 | ECHS1 | Zornitza Stark Publications for gene: ECHS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.318 | DYSF | Zornitza Stark Marked gene: DYSF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.318 | DYSF | Zornitza Stark Gene: dysf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.318 | DYSF | Zornitza Stark Phenotypes for gene: DYSF were changed from Muscular dystrophy, limb-girdle, type 2B, 253601 (3) to Miyoshi muscular dystrophy 1 MIM#254130; MONDO:0024545; Muscular dystrophy, limb-girdle, autosomal recessive 2 MIM#253601; MONDO:0009676; Myopathy, distal, with anterior tibial onset MIM#606768; MONDO:0011721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.317 | DYSF | Zornitza Stark Publications for gene: DYSF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.316 | DYNC2H1 | Zornitza Stark Marked gene: DYNC2H1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.316 | DYNC2H1 | Zornitza Stark Gene: dync2h1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.316 | DYNC2H1 | Zornitza Stark Phenotypes for gene: DYNC2H1 were changed from Short-rib thoracic dysplasia 3 with or without polydactyly, 613091 (3) to Short-rib thoracic dysplasia 3 with or without polydactyly, MIM#613091 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.315 | DYNC2H1 | Zornitza Stark Publications for gene: DYNC2H1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.314 | DYM | Zornitza Stark Marked gene: DYM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.314 | DYM | Zornitza Stark Gene: dym has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.314 | DYM | Zornitza Stark Phenotypes for gene: DYM were changed from Dyggve-Melchior-Clausen disease, 223800 (3) to Dyggve-Melchior-Clausen disease MIM#223800; Smith-McCort dysplasia MIM#607326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.313 | DYM | Zornitza Stark Publications for gene: DYM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.312 | DOK7 | Zornitza Stark Marked gene: DOK7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.312 | DOK7 | Zornitza Stark Gene: dok7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.312 | DOK7 | Zornitza Stark Phenotypes for gene: DOK7 were changed from Myasthenic syndrome, congenital, 10, 254300 (3) to Myasthenic syndrome, congenital, 10, MIM# 254300; Fetal akinesia deformation sequence 3, MIM# 618389 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.311 | DOK7 | Zornitza Stark Publications for gene: DOK7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.310 | DOCK6 | Zornitza Stark Marked gene: DOCK6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.310 | DOCK6 | Zornitza Stark Gene: dock6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.310 | DOCK6 | Zornitza Stark Phenotypes for gene: DOCK6 were changed from Adams-Oliver syndrome 2, 614219 (3) to Adams-Oliver syndrome 2, MIM# 614219 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.309 | DOCK6 | Zornitza Stark Publications for gene: DOCK6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.308 | DNMT3B | Zornitza Stark Marked gene: DNMT3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.308 | DNMT3B | Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.308 | DNMT3B | Zornitza Stark Phenotypes for gene: DNMT3B were changed from Immunodeficiency-centromeric instability-facial anomalies syndrome 1, 242860 (3) to Immunodeficiency-centromeric instability-facial anomalies syndrome 1 (MIM#242860) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.307 | DNAI2 | Zornitza Stark Marked gene: DNAI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.307 | DNAI2 | Zornitza Stark Gene: dnai2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.307 | DNAI2 | Zornitza Stark Phenotypes for gene: DNAI2 were changed from Ciliary dyskinesia, primary, 9, with or without situs inversus, 612444 (3) to Ciliary dyskinesia, primary, 9, with or without situs inversus, MIM# 612444 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.306 | DNAI2 | Zornitza Stark Publications for gene: DNAI2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.305 | DNAI1 | Zornitza Stark Marked gene: DNAI1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.305 | DNAI1 | Zornitza Stark Gene: dnai1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.305 | DNAI1 | Zornitza Stark Phenotypes for gene: DNAI1 were changed from Ciliary dyskinesia, primary, 1, with or without situs inversus, 244400 (3) to Ciliary dyskinesia, primary, 1, with or without situs inversus, MIM# 244400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.304 | DNAI1 | Zornitza Stark Publications for gene: DNAI1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.303 | DNAH5 | Zornitza Stark Marked gene: DNAH5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.303 | DNAH5 | Zornitza Stark Gene: dnah5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.303 | DNAH5 | Zornitza Stark Phenotypes for gene: DNAH5 were changed from Ciliary dyskinesia, primary, 3, with or without situs inversus, 608644 (3) to Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.302 | DNAH5 | Zornitza Stark Publications for gene: DNAH5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.301 | DNAH11 | Zornitza Stark Marked gene: DNAH11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.301 | DNAH11 | Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.301 | DNAH11 | Zornitza Stark Phenotypes for gene: DNAH11 were changed from Ciliary dyskinesia, primary, 7, with or without situs inversus, 611884 (3) to Ciliary dyskinesia, primary, 7, with or without situs inversus, MIM#611884 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.300 | DNAH11 | Zornitza Stark Publications for gene: DNAH11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.299 | DMD | Zornitza Stark Marked gene: DMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.299 | DMD | Zornitza Stark Gene: dmd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.299 | DMD | Zornitza Stark Phenotypes for gene: DMD were changed from Duchenne muscular dystrophy, 310200 (3) to Duchenne muscular dystrophy MIM#310200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.298 | DMD | Zornitza Stark Publications for gene: DMD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.297 | DLL3 | Zornitza Stark Marked gene: DLL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.297 | DLL3 | Zornitza Stark Gene: dll3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.297 | DLL3 | Zornitza Stark Phenotypes for gene: DLL3 were changed from Spondylocostal dysostosis 1, autosomal recessive, 277300 (3) to Spondylocostal dysostosis 1, autosomal recessive, MIM# 277300; MONDO:0020692 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.296 | DLL3 | Zornitza Stark Publications for gene: DLL3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.295 | DLG3 | Zornitza Stark Marked gene: DLG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.295 | DLG3 | Zornitza Stark Gene: dlg3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.295 | DLG3 | Zornitza Stark Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, 300850 (3) to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.294 | DLG3 | Zornitza Stark Publications for gene: DLG3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.293 | DLD | Zornitza Stark Marked gene: DLD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.293 | DLD | Zornitza Stark Gene: dld has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.293 | DLD | Zornitza Stark Phenotypes for gene: DLD were changed from Dihydrolipoamide dehydrogenase deficiency, 246900 (3) to Dihydrolipoamide dehydrogenase deficiency (MIM#246900) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.292 | DLD | Zornitza Stark Publications for gene: DLD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.291 | DKC1 | Zornitza Stark Marked gene: DKC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.291 | DKC1 | Zornitza Stark Gene: dkc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.291 | DKC1 | Zornitza Stark Phenotypes for gene: DKC1 were changed from Dyskeratosis congenita, X-linked, 305000 (3) to Dyskeratosis congenita, X-linked MIM#305000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.290 | DKC1 | Zornitza Stark Publications for gene: DKC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.289 | DIS3L2 | Zornitza Stark Marked gene: DIS3L2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.289 | DIS3L2 | Zornitza Stark Gene: dis3l2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.289 | DIS3L2 | Zornitza Stark Phenotypes for gene: DIS3L2 were changed from Perlman syndrome, 267000 (3) to Perlman syndrome MIM# 267000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.288 | DIS3L2 | Zornitza Stark Publications for gene: DIS3L2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.287 | DHDDS | Zornitza Stark Marked gene: DHDDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.287 | DHDDS | Zornitza Stark Gene: dhdds has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.287 | DHDDS | Zornitza Stark Phenotypes for gene: DHDDS were changed from Retinitis pigmentosa 59, 613861 (3) to Retinitis pigmentosa 59, MIM#613861; Congenital disorder of glycosylation, type 1bb, MIM# 613861 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.286 | DHDDS | Zornitza Stark Publications for gene: DHDDS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.285 | DHCR7 | Zornitza Stark Marked gene: DHCR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.285 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.285 | DHCR7 | Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith-Lemli-Opitz syndrome, 270400 (3) to Smith-Lemli-Opitz syndrome (MIM#270400) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.284 | DHCR7 | Zornitza Stark Publications for gene: DHCR7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.283 | DHCR24 | Zornitza Stark Marked gene: DHCR24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.283 | DHCR24 | Zornitza Stark Gene: dhcr24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.283 | DHCR24 | Zornitza Stark Phenotypes for gene: DHCR24 were changed from Desmosterolosis, 602398 (3) to Desmosterolosis, MIM#602398 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.282 | DHCR24 | Zornitza Stark Publications for gene: DHCR24 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.281 | DGUOK | Zornitza Stark Marked gene: DGUOK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.281 | DGUOK | Zornitza Stark Gene: dguok has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.281 | DGUOK | Zornitza Stark Phenotypes for gene: DGUOK were changed from Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), 251880 (3) to Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880; Portal hypertension, noncirrhotic, 1, MIM# 617068; Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.280 | DGUOK | Zornitza Stark Publications for gene: DGUOK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.279 | DGAT1 | Zornitza Stark Marked gene: DGAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.279 | DGAT1 | Zornitza Stark Gene: dgat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.279 | DGAT1 | Zornitza Stark Phenotypes for gene: DGAT1 were changed from ?Diarrhea 7, protein-losing enteropathy type to Diarrhoea 7, protein-losing enteropathy type, MIM# 615863; congenital diarrhea 7 with exudative enteropathy MONDO:0014375 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.278 | DGAT1 | Zornitza Stark Publications for gene: DGAT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.277 | DDX11 | Zornitza Stark Marked gene: DDX11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.277 | DDX11 | Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.277 | DDX11 | Zornitza Stark Phenotypes for gene: DDX11 were changed from Warsaw breakage syndrome, 613398 (3) to Warsaw breakage syndrome MIM#613398 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.276 | DDX11 | Zornitza Stark Publications for gene: DDX11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.275 | DDC | Zornitza Stark Marked gene: DDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.275 | DDC | Zornitza Stark Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.275 | DDC | Zornitza Stark Phenotypes for gene: DDC were changed from Aromatic L-amino acid decarboxylase deficiency, 608643 (3) to Aromatic L-amino acid decarboxylase deficiency MIM#608643; Aromatic L-amino acid decarboxylase deficiency (MIM#608643) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.274 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.274 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.274 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from Lissencephaly, X-linked, 300067 (3) to Lissencephaly, X-linked MIM#300067; Subcortical laminal heterotopia, X-linked MIM#300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.273 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.272 | DCLRE1C | Zornitza Stark Marked gene: DCLRE1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.272 | DCLRE1C | Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.272 | DCLRE1C | Zornitza Stark Phenotypes for gene: DCLRE1C were changed from Severe combined immunodeficiency, Athabascan type, 602450 (3) to Severe combined immunodeficiency, Athabascan type, MIM# 602450; Omenn syndrome, MIM# 603554 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.271 | DCLRE1C | Zornitza Stark Publications for gene: DCLRE1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.270 | DCAF17 | Zornitza Stark Marked gene: DCAF17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.270 | DCAF17 | Zornitza Stark Gene: dcaf17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.270 | DCAF17 | Zornitza Stark Phenotypes for gene: DCAF17 were changed from Woodhouse-Sakati syndrome, 241080 (3) to Woodhouse-Sakati syndrome MIM#241080 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.269 | DCAF17 | Zornitza Stark Publications for gene: DCAF17 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.268 | DBT | Zornitza Stark Marked gene: DBT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.268 | DBT | Zornitza Stark Gene: dbt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.268 | DBT | Zornitza Stark Phenotypes for gene: DBT were changed from Maple syrup urine disease, type II, 248600 (3) to Maple syrup urine disease, type II, MIM#248600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.267 | D2HGDH | Zornitza Stark Marked gene: D2HGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.267 | D2HGDH | Zornitza Stark Gene: d2hgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.267 | D2HGDH | Zornitza Stark Phenotypes for gene: D2HGDH were changed from D-2-hydroxyglutaric aciduria, 600721 (3) to D-2-hydroxyglutaric aciduria, MIM#600721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.266 | D2HGDH | Zornitza Stark Publications for gene: D2HGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.265 | CYP7B1 | Zornitza Stark Marked gene: CYP7B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.265 | CYP7B1 | Zornitza Stark Gene: cyp7b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.265 | CYP7B1 | Zornitza Stark Phenotypes for gene: CYP7B1 were changed from Bile acid synthesis defect, congenital, 3, 613812 (3) to Bile acid synthesis defect, congenital, 3, MIM#613812; Spastic paraplegia 5A, MIM#270800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.264 | CYP7B1 | Zornitza Stark Publications for gene: CYP7B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.263 | CYP27A1 | Zornitza Stark Marked gene: CYP27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.263 | CYP27A1 | Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.263 | CYP27A1 | Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cerebrotendinous xanthomatosis, 213700 (3) to Cerebrotendinous xanthomatosis, MIM#213700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.262 | CYP1B1 | Zornitza Stark Marked gene: CYP1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.262 | CYP1B1 | Zornitza Stark Gene: cyp1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.262 | CYP1B1 | Zornitza Stark Phenotypes for gene: CYP1B1 were changed from Glaucoma 3A, primary open angle, congenital, juvenile, or adult onset, 231300 (3) to Anterior segment dysgenesis 6, multiple subtypes, MIM#617315 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.261 | CYP1B1 | Zornitza Stark Publications for gene: CYP1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.260 | CYP17A1 | Zornitza Stark Marked gene: CYP17A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.260 | CYP17A1 | Zornitza Stark Gene: cyp17a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.260 | CYP17A1 | Zornitza Stark Phenotypes for gene: CYP17A1 were changed from 17,20-lyase deficiency, isolated, 202110 (3) to 17-alpha-hydroxylase/17,20-lyase deficiency MIM#202110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.259 | CYP17A1 | Zornitza Stark Publications for gene: CYP17A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.258 | CYP11B2 | Zornitza Stark Marked gene: CYP11B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.258 | CYP11B2 | Zornitza Stark Gene: cyp11b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.258 | CYP11B2 | Zornitza Stark Phenotypes for gene: CYP11B2 were changed from Hypoaldosteronism, congenital, due to CMO I deficiency, 203400 (3) to Hypoaldosteronism, congenital, due to CMO I deficiency MIM#203400; Hypoaldosteronism, congenital, due to CMO II deficiency MIM#610600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.257 | CYP11B2 | Zornitza Stark Publications for gene: CYP11B2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.256 | CYP11A1 | Zornitza Stark Marked gene: CYP11A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.256 | CYP11A1 | Zornitza Stark Gene: cyp11a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.256 | CYP11A1 | Zornitza Stark Phenotypes for gene: CYP11A1 were changed from Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete, 613743 (3) to Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete MIM#613743 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.255 | CYP11A1 | Zornitza Stark Publications for gene: CYP11A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark reviewed gene: CYBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chronic granulomatous disease, X-linked, MIM#306400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark Marked gene: CYBB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark Gene: cybb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark Phenotypes for gene: CYBB were changed from Chronic granulomatous disease, X-linked, 306400 (3) to Chronic granulomatous disease, X-linked, MIM#306400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.253 | CYBB | Zornitza Stark Publications for gene: CYBB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.252 | CYBA | Zornitza Stark Marked gene: CYBA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.252 | CYBA | Zornitza Stark Gene: cyba has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.252 | CYBA | Zornitza Stark Phenotypes for gene: CYBA were changed from Chronic granulomatous disease, autosomal, due to deficiency of CYBA, 233690 (3) to Chronic granulomatous disease 4 MIM#233690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.251 | CYBA | Zornitza Stark Publications for gene: CYBA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.250 | CUL4B | Zornitza Stark Marked gene: CUL4B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.250 | CUL4B | Zornitza Stark Gene: cul4b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.250 | CUL4B | Zornitza Stark Phenotypes for gene: CUL4B were changed from Mental retardation, X-linked, syndromic 15 (Cabezas type), 300354 (3) to Intellectual developmental disorder, X-linked syndromic, Cabezas type, MIM#300354 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.249 | CUL4B | Zornitza Stark Publications for gene: CUL4B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.248 | CTSK | Zornitza Stark Marked gene: CTSK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.248 | CTSK | Zornitza Stark Gene: ctsk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.248 | CTSK | Zornitza Stark Phenotypes for gene: CTSK were changed from Pycnodysostosis, 265800 (3) to Pycnodysostosis MIM#265800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.247 | CTSK | Zornitza Stark Publications for gene: CTSK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.246 | CTSD | Zornitza Stark Marked gene: CTSD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.246 | CTSD | Zornitza Stark Gene: ctsd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.246 | CTSD | Zornitza Stark Phenotypes for gene: CTSD were changed from Ceroid lipofuscinosis, neuronal, 10, 610127 (3) to Ceroid lipofuscinosis, neuronal, 10, MIM# 610127 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.245 | CTSC | Zornitza Stark Marked gene: CTSC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.245 | CTSC | Zornitza Stark Gene: ctsc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.245 | CTSC | Zornitza Stark Phenotypes for gene: CTSC were changed from Papillon-Lefevre syndrome, 245000 (3) to Haim-Munk syndrome MIM#245010; Papillon-Lefevre syndrome MIM#245000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.244 | CTSA | Zornitza Stark Marked gene: CTSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.244 | CTSA | Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.244 | CTSA | Zornitza Stark Phenotypes for gene: CTSA were changed from Galactosialidosis, 256540 (3) to Galactosialidosis MIM#256540 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.243 | CTSA | Zornitza Stark Publications for gene: CTSA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.242 | CTNS | Zornitza Stark Marked gene: CTNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.242 | CTNS | Zornitza Stark Gene: ctns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.242 | CTNS | Zornitza Stark Phenotypes for gene: CTNS were changed from Cystinosis, nephropathic, 219800 (3) to Cystinosis, nephropathic MIM#219800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.241 | CTNS | Zornitza Stark Publications for gene: CTNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.240 | CSPP1 | Zornitza Stark Marked gene: CSPP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.240 | CSPP1 | Zornitza Stark Gene: cspp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.240 | CSPP1 | Zornitza Stark Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.239 | CSPP1 | Zornitza Stark Publications for gene: CSPP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.238 | CRTAP | Zornitza Stark Marked gene: CRTAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.238 | CRTAP | Zornitza Stark Gene: crtap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.238 | CRTAP | Zornitza Stark Phenotypes for gene: CRTAP were changed from Osteogenesis imperfecta, type VII, 610682 (3) to Osteogenesis imperfecta, type VII MIM#610682 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.237 | CRTAP | Zornitza Stark Publications for gene: CRTAP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.236 | CRB1 | Zornitza Stark Marked gene: CRB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.236 | CRB1 | Zornitza Stark Gene: crb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.236 | CRB1 | Zornitza Stark Phenotypes for gene: CRB1 were changed from Leber congenital amaurosis 8, 613835 (3) to Leber congenital amaurosis 8, MIM#613835 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.235 | CRB1 | Zornitza Stark Publications for gene: CRB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.234 | CPT2 | Zornitza Stark Marked gene: CPT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.234 | CPT2 | Zornitza Stark Gene: cpt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.234 | CPT2 | Zornitza Stark Phenotypes for gene: CPT2 were changed from CPT II deficiency, lethal neonatal, 608836 (3) to CPT II deficiency, infantile MIM#600649; CPT II deficiency, lethal neonatal MIM#608836 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.233 | CPT2 | Zornitza Stark Publications for gene: CPT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.232 | CPT1A | Zornitza Stark Marked gene: CPT1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.232 | CPT1A | Zornitza Stark Gene: cpt1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.232 | CPT1A | Zornitza Stark Phenotypes for gene: CPT1A were changed from CPT deficiency, hepatic, type IA, 255120 (3) to CPT deficiency, hepatic, type IA, MIM#255120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.231 | CPT1A | Zornitza Stark Publications for gene: CPT1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.230 | CPS1 | Zornitza Stark Marked gene: CPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.230 | CPS1 | Zornitza Stark Gene: cps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.230 | CPS1 | Zornitza Stark Phenotypes for gene: CPS1 were changed from Carbamoylphosphate synthetase I deficiency, 237300 (3) to Carbamoylphosphate synthetase I deficiency MIM#237300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.229 | CPS1 | Zornitza Stark Publications for gene: CPS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.228 | COX15 | Zornitza Stark Marked gene: COX15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.228 | COX15 | Zornitza Stark Gene: cox15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.228 | COX15 | Zornitza Stark Phenotypes for gene: COX15 were changed from Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 2, 615119 (3) to Mitochondrial complex IV deficiency, nuclear type 6, MIM #615119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.227 | COX15 | Zornitza Stark Publications for gene: COX15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.226 | COLQ | Zornitza Stark Marked gene: COLQ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.226 | COLQ | Zornitza Stark Gene: colq has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.226 | COLQ | Zornitza Stark Phenotypes for gene: COLQ were changed from Myasthenic syndrome, congenital, 5, 603034 (3) to Myasthenic syndrome, congenital, 5 MIM#603034; MONDO:0011281 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.225 | COLQ | Zornitza Stark Publications for gene: COLQ were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.224 | COLEC11 | Zornitza Stark Marked gene: COLEC11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.224 | COLEC11 | Zornitza Stark Gene: colec11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.224 | COLEC11 | Zornitza Stark Phenotypes for gene: COLEC11 were changed from 3MC syndrome 2, 265050 (3) to 3MC syndrome 2, MIM# 265050; MONDO:0009927 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.223 | COLEC11 | Zornitza Stark Publications for gene: COLEC11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.222 | COL7A1 | Zornitza Stark Marked gene: COL7A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.222 | COL7A1 | Zornitza Stark Gene: col7a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.222 | COL7A1 | Zornitza Stark Phenotypes for gene: COL7A1 were changed from Epidermolysis bullosa dystrophica, AR, 226600 (3) to Epidermolysis bullosa dystrophica inversa MIM#226600; Epidermolysis bullosa dystrophica, autosomal recessive MIM#226600; Epidermolysis bullosa dystrophica, localisata variant MIM#226600; Epidermolysis bullosa pruriginosa MIM#604129 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.221 | COL7A1 | Zornitza Stark Publications for gene: COL7A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.220 | COL6A1 | Zornitza Stark Marked gene: COL6A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.220 | COL6A1 | Zornitza Stark Gene: col6a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.220 | COL6A1 | Zornitza Stark Phenotypes for gene: COL6A1 were changed from Ullrich congenital muscular dystrophy 1, 254090 (3) to Ullrich congenital muscular dystrophy 1A MIM#254090 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.219 | COL6A1 | Zornitza Stark Publications for gene: COL6A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.218 | COL4A5 | Zornitza Stark Marked gene: COL4A5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.218 | COL4A5 | Zornitza Stark Gene: col4a5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.218 | COL4A5 | Zornitza Stark Phenotypes for gene: COL4A5 were changed from Alport syndrome 1, X-linked to Alport syndrome 1, X-linked, MIM#301050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.217 | COL4A5 | Zornitza Stark Publications for gene: COL4A5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.216 | COL4A4 | Zornitza Stark Marked gene: COL4A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.216 | COL4A4 | Zornitza Stark Gene: col4a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.216 | COL4A4 | Zornitza Stark Phenotypes for gene: COL4A4 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 2, autosomal recessive MIM# 203780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.215 | COL4A4 | Zornitza Stark Publications for gene: COL4A4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.214 | COL4A3 | Zornitza Stark Marked gene: COL4A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.214 | COL4A3 | Zornitza Stark Gene: col4a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.214 | COL4A3 | Zornitza Stark Phenotypes for gene: COL4A3 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 3b, autosomal recessive MIM#620536; MONDO:0957811 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.213 | COL4A3 | Zornitza Stark Publications for gene: COL4A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.212 | COL27A1 | Zornitza Stark Marked gene: COL27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.212 | COL27A1 | Zornitza Stark Gene: col27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.212 | COL27A1 | Zornitza Stark Phenotypes for gene: COL27A1 were changed from Steel Syndrome to Steel syndrome (MIM#615155) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.211 | COL27A1 | Zornitza Stark Publications for gene: COL27A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.210 | COL18A1 | Zornitza Stark Marked gene: COL18A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.210 | COL18A1 | Zornitza Stark Gene: col18a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.210 | COL18A1 | Zornitza Stark Phenotypes for gene: COL18A1 were changed from Knobloch syndrome, type 1, 267750 (3) to Knobloch syndrome, type 1 MIM#267750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.209 | COL18A1 | Zornitza Stark Publications for gene: COL18A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.208 | COL17A1 | Zornitza Stark Marked gene: COL17A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.208 | COL17A1 | Zornitza Stark Gene: col17a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.208 | COL17A1 | Zornitza Stark Phenotypes for gene: COL17A1 were changed from Epidermolysis bullosa, junctional, non-Herlitz type, 226650 (3) to Epidermolysis bullosa, junctional 4, intermediate, MIM# 619787 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.207 | COL17A1 | Zornitza Stark Publications for gene: COL17A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.206 | COL11A2 | Zornitza Stark Marked gene: COL11A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.206 | COL11A2 | Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.206 | COL11A2 | Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Deafness, autosomal recessive 53 MIM#609706; Fibrochondrogenesis 2 MIM#614524; Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.205 | COL11A2 | Zornitza Stark Publications for gene: COL11A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.204 | CNGB3 | Zornitza Stark Marked gene: CNGB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.204 | CNGB3 | Zornitza Stark Gene: cngb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.204 | CNGB3 | Zornitza Stark Phenotypes for gene: CNGB3 were changed from Macular degeneration, juvenile, 248200 (3) to Achromatopsia 3 MIM#262300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.203 | CNGB3 | Zornitza Stark Publications for gene: CNGB3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.202 | CLRN1 | Zornitza Stark Marked gene: CLRN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.202 | CLRN1 | Zornitza Stark Gene: clrn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.202 | CLRN1 | Zornitza Stark Phenotypes for gene: CLRN1 were changed from Usher syndrome, type 3A, 276902 (3) to Usher syndrome, type 3A, MIM#276902 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.201 | CLRN1 | Zornitza Stark Publications for gene: CLRN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.200 | CLPB | Zornitza Stark Marked gene: CLPB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.200 | CLPB | Zornitza Stark Gene: clpb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.200 | CLPB | Zornitza Stark Phenotypes for gene: CLPB were changed from 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropenia, 616271 (3) to 3-methylglutaconic aciduria, type VIIB, autosomal recessive (MIM#616271) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.199 | CLPB | Zornitza Stark Publications for gene: CLPB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.198 | CLP1 | Zornitza Stark Marked gene: CLP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.198 | CLP1 | Zornitza Stark Gene: clp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.198 | CLP1 | Zornitza Stark Phenotypes for gene: CLP1 were changed from Pontocerebellar hypoplasia, type 10, 615803 (3) to Pontocerebellar hypoplasia, type 10 MIM#615803 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.197 | CLP1 | Zornitza Stark Publications for gene: CLP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.196 | CLN8 | Zornitza Stark Marked gene: CLN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.196 | CLN8 | Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.196 | CLN8 | Zornitza Stark Phenotypes for gene: CLN8 were changed from Ceroid lipofuscinosis, neuronal, 8, 600143 (3) to Ceroid lipofuscinosis, neuronal, 8, MIM# 600143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.195 | CLN6 | Zornitza Stark Marked gene: CLN6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.195 | CLN6 | Zornitza Stark Gene: cln6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.195 | CLN6 | Zornitza Stark Phenotypes for gene: CLN6 were changed from Ceroid lipofuscinosis, neuronal 6, 601780 (3) to Ceroid lipofuscinosis, neuronal 6, MIM#601780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.194 | CLN6 | Zornitza Stark Publications for gene: CLN6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.193 | CLN5 | Zornitza Stark Marked gene: CLN5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.193 | CLN5 | Zornitza Stark Gene: cln5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.193 | CLN5 | Zornitza Stark Phenotypes for gene: CLN5 were changed from Ceroid lipofuscinosis, neuronal, 5, 256731 (3) to Ceroid lipofuscinosis, neuronal, 5, MIM# 256731; MONDO:0009745 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.192 | CLCN7 | Zornitza Stark Marked gene: CLCN7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.192 | CLCN7 | Zornitza Stark Gene: clcn7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.192 | CLCN7 | Zornitza Stark Phenotypes for gene: CLCN7 were changed from Osteopetrosis, autosomal recessive 4, 611490 (3) to Osteopetrosis, autosomal recessive 4, MIM#611490 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.191 | CLCN7 | Zornitza Stark Publications for gene: CLCN7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.190 | CLCN5 | Zornitza Stark Marked gene: CLCN5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.190 | CLCN5 | Zornitza Stark Gene: clcn5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.190 | CLCN5 | Zornitza Stark Phenotypes for gene: CLCN5 were changed from Dent disease, 300009 (3) to Dent disease, MIM#300009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.189 | CKAP2L | Zornitza Stark Marked gene: CKAP2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.189 | CKAP2L | Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.189 | CKAP2L | Zornitza Stark Phenotypes for gene: CKAP2L were changed from Filippi syndrome, 272440 (3) to Filippi syndrome MIM#272440 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.188 | CKAP2L | Zornitza Stark Publications for gene: CKAP2L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.187 | CIITA | Zornitza Stark Marked gene: CIITA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.187 | CIITA | Zornitza Stark Gene: ciita has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.187 | CIITA | Zornitza Stark Phenotypes for gene: CIITA were changed from Bare lymphocyte syndrome, type II, complementation group A, 209920 (3) to MHC class II deficiency 1 MIM#209920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.186 | CIITA | Zornitza Stark Publications for gene: CIITA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.185 | CHRNG | Zornitza Stark Marked gene: CHRNG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.185 | CHRNG | Zornitza Stark Gene: chrng has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.185 | CHRNG | Zornitza Stark Phenotypes for gene: CHRNG were changed from Escobar syndrome, 265000 (3) to Escobar syndrome (MIM# 265000); Multiple pterygium syndrome, lethal type, (MIM# 253290) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.184 | CHRNG | Zornitza Stark Publications for gene: CHRNG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.183 | CHRNE | Zornitza Stark Marked gene: CHRNE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.183 | CHRNE | Zornitza Stark Gene: chrne has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.183 | CHRNE | Zornitza Stark Phenotypes for gene: CHRNE were changed from Myasthenic syndrome, congenital, 4A, slow-channel, 605809 (3) to Myasthenic syndrome, congenital, 4A, slow-channel MIM#605809; Myasthenic syndrome, congenital, 4B, fast-channel MIM#616324; Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency MIM#608931 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.182 | CHRNE | Zornitza Stark Publications for gene: CHRNE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.181 | CHAT | Zornitza Stark Marked gene: CHAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.181 | CHAT | Zornitza Stark Gene: chat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.181 | CHAT | Zornitza Stark Phenotypes for gene: CHAT were changed from Myasthenic syndrome, congenital, 6, presynaptic, 254210 (3) to Myasthenic syndrome, congenital, 6, presynaptic MIM#254210 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.180 | CHAT | Zornitza Stark Publications for gene: CHAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.179 | CFTR | Zornitza Stark Marked gene: CFTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.179 | CFTR | Zornitza Stark Gene: cftr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.179 | CFTR | Zornitza Stark Phenotypes for gene: CFTR were changed from Cystic fibrosis, 219700 (3) to Cystic fibrosis, MIM#219700; MONDO:0009061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.178 | CFTR | Zornitza Stark Publications for gene: CFTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.177 | CEP41 | Zornitza Stark Marked gene: CEP41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.177 | CEP41 | Zornitza Stark Gene: cep41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.177 | CEP41 | Zornitza Stark Phenotypes for gene: CEP41 were changed from Joubert syndrome 15, 614464 (3) to Joubert syndrome 15, MIM# 614464 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.176 | CEP41 | Zornitza Stark Publications for gene: CEP41 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.175 | CEP290 | Zornitza Stark Marked gene: CEP290 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.175 | CEP290 | Zornitza Stark Gene: cep290 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.175 | CEP290 | Zornitza Stark Phenotypes for gene: CEP290 were changed from Joubert syndrome 5, 610188 (3) to CEP290-related ciliopathy MONDO:0100451; Bardet-Biedl syndrome 14, MIM# 615991; Joubert syndrome 5 610188; Leber congenital amaurosis 10, MIM# 611755; Meckel syndrome 4, MIM# 611134; Senior-Loken syndrome 6, MIM# 610189 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.174 | CEP290 | Zornitza Stark Publications for gene: CEP290 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.173 | CEP152 | Zornitza Stark Marked gene: CEP152 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.173 | CEP152 | Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.173 | CEP152 | Zornitza Stark Phenotypes for gene: CEP152 were changed from Seckel syndrome 5, 613823 (3) to Microcephaly 9, primary, autosomal recessive, MIM# 614852; MONDO:0013923; Seckel syndrome 5, MIM# 613823; MONDO:0013443 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.172 | CEP152 | Zornitza Stark Publications for gene: CEP152 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.171 | CENPJ | Zornitza Stark Marked gene: CENPJ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.171 | CENPJ | Zornitza Stark Gene: cenpj has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.171 | CENPJ | Zornitza Stark Phenotypes for gene: CENPJ were changed from Microcephaly 6, primary, autosomal recessive, 608393 (3) to Microcephaly 6, primary MIM#608393; Seckel syndrome 4 MIM#613676 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.170 | CENPJ | Zornitza Stark Publications for gene: CENPJ were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.169 | CDH23 | Zornitza Stark Marked gene: CDH23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.169 | CDH23 | Zornitza Stark Gene: cdh23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.169 | CDH23 | Zornitza Stark Phenotypes for gene: CDH23 were changed from Usher syndrome, type 1D, 601067 (3) to Usher syndrome, type 1D (MIM#601067) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.168 | CDH23 | Zornitza Stark Publications for gene: CDH23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.167 | CD40LG | Zornitza Stark Marked gene: CD40LG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.167 | CD40LG | Zornitza Stark Gene: cd40lg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.167 | CD40LG | Zornitza Stark Phenotypes for gene: CD40LG were changed from Immunodeficiency, X-linked, with hyper-IgM, 308230 (3) to Immunodeficiency, X-linked, with hyper-IgM MIM# 308230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.166 | CD40LG | Zornitza Stark Publications for gene: CD40LG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.283 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.283 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.68 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.68 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.67 | IFT57 | Krithika Murali Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.67 | IFT57 | Krithika Murali Gene: ift57 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2519 | IFT57 | Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2518 | IFT57 | Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2517 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2517 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | UGGT1 | Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.305 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.305 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.304 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.304 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2516 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2516 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2516 | UGGT1 | Krithika Murali Phenotypes for gene: UGGT1 were changed from to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2515 | UGGT1 | Krithika Murali Publications for gene: UGGT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2514 | UGGT1 | Krithika Murali Mode of inheritance for gene: UGGT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2513 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2513 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.207 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.207 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.442 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.442 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.441 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.441 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.440 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.440 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.11 | UGGT1 | Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.11 | UGGT1 | Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.9 | UGGT1 |
Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.9 | UGGT1 |
Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.9 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Differences of Sex Development. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.440 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.84 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Renal Macrocystic Disease. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to AMBER Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants and CDG/multisystem disorder with clinical features including GDD/ID, microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).Supportive functional evidence also provided. Of note, two individuals reported with cystic renal dysplasia and hepatobiliary anomalies that were similar in apperaance to ARPKD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.206 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Autism. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.304 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.65 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Congenital Disorders of Glycosylation. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2512 | UGGT1 | Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2512 | IFT57 | Krithika Murali reviewed gene: IFT57: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:40273360; Phenotypes: Bardet-Bield syndrome, ciliopathy - MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.67 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Ciliopathies. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Learning difficulties - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.282 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Polydactyly. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Learning difficulties - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.55 | IFT57 |
Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Learning difficulties - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.11 | IFT57 |
Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Learning difficulties - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.55 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Cone-rod Dystrophy. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.11 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Bardet Biedl syndrome. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v1.0 | APOB | Zornitza Stark Marked gene: APOB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v1.0 | APOB | Zornitza Stark Gene: apob has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.118 | DLG3 | Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2512 | DLG3 | Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.165 | CD40 | Zornitza Stark Marked gene: CD40 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.165 | CD40 | Zornitza Stark Gene: cd40 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.165 | CD40 | Zornitza Stark Phenotypes for gene: CD40 were changed from Immunodeficiency with hyper-IgM, type 3, 606843 (3) to Immunodeficiency with hyper-IgM, type 3, MIM# 606843 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.164 | CD3D | Zornitza Stark Marked gene: CD3D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.164 | CD3D | Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.164 | CD3D | Zornitza Stark Phenotypes for gene: CD3D were changed from Immunodeficiency 19, 615617 (3) to Immunodeficiency 19, severe combined MIM# 615617 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.163 | CCDC88C | Zornitza Stark Marked gene: CCDC88C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.163 | CCDC88C | Zornitza Stark Gene: ccdc88c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.163 | CCDC88C | Zornitza Stark Phenotypes for gene: CCDC88C were changed from Hydrocephalus, nonsyndromic, autosomal recessive, 236600 (3) to Hydrocephalus, congenital, 1 MIM#236600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.162 | CCDC88C | Zornitza Stark Publications for gene: CCDC88C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.161 | CCDC39 | Zornitza Stark Marked gene: CCDC39 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.161 | CCDC39 | Zornitza Stark Gene: ccdc39 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.161 | CCDC39 | Zornitza Stark Phenotypes for gene: CCDC39 were changed from Ciliary dyskinesia, primary, 14, 613807 (3) to Ciliary dyskinesia, primary, 14 MIM#613807 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.160 | CCDC39 | Zornitza Stark Publications for gene: CCDC39 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.159 | CCDC103 | Zornitza Stark Marked gene: CCDC103 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.159 | CCDC103 | Zornitza Stark Gene: ccdc103 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.159 | CCDC103 | Zornitza Stark Phenotypes for gene: CCDC103 were changed from Ciliary dyskinesia, primary, 17, 614679 (3) to Primary ciliary dyskinesia-17, MIM # 614679 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.158 | CCDC103 | Zornitza Stark Publications for gene: CCDC103 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.157 | CCBE1 | Zornitza Stark Marked gene: CCBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.157 | CCBE1 | Zornitza Stark Gene: ccbe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.157 | CCBE1 | Zornitza Stark Phenotypes for gene: CCBE1 were changed from Hennekam lymphangiectasia-lymphedema syndrome 1, 235510 (3) to Hennekam lymphangiectasia-lymphoedema syndrome 1 MIM#235510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.156 | CCBE1 | Zornitza Stark Publications for gene: CCBE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.155 | CC2D2A | Zornitza Stark Marked gene: CC2D2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.155 | CC2D2A | Zornitza Stark Gene: cc2d2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.155 | CC2D2A | Zornitza Stark Phenotypes for gene: CC2D2A were changed from Joubert syndrome 9, 612285 (3) to COACH syndrome, MIM#216360; Joubert syndrome 9, MIM#612285; Meckel syndrome 6, MIM#612284; Retinitis pigmentosa 93, MIM# 619845 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.154 | CC2D2A | Zornitza Stark Publications for gene: CC2D2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.153 | CC2D1A | Zornitza Stark Marked gene: CC2D1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.153 | CC2D1A | Zornitza Stark Gene: cc2d1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.153 | CC2D1A | Zornitza Stark Phenotypes for gene: CC2D1A were changed from Mental retardation, autosomal recessive 3, 608443 (3) to Intellectual developmental disorder, autosomal recessive 3, MIM# 608443 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.152 | CC2D1A | Zornitza Stark Publications for gene: CC2D1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.151 | CASQ2 | Zornitza Stark Marked gene: CASQ2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.151 | CASQ2 | Zornitza Stark Gene: casq2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.151 | CASQ2 | Zornitza Stark Phenotypes for gene: CASQ2 were changed from Ventricular tachycardia, catecholaminergic polymorphic, 2, 611938 (3) to Ventricular tachycardia, catecholaminergic polymorphic, 2 (MIM#611938) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.150 | CASK | Zornitza Stark Marked gene: CASK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.150 | CASK | Zornitza Stark Gene: cask has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.150 | CASK | Zornitza Stark Phenotypes for gene: CASK were changed from Mental retardation, with or without nystagmus to X-linked syndromic intellectual disability MONDO:0020119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.149 | CASK | Zornitza Stark Publications for gene: CASK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.148 | GNE | Zornitza Stark Marked gene: GNE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.148 | GNE | Zornitza Stark Gene: gne has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.148 | GNE | Zornitza Stark Phenotypes for gene: GNE were changed from Inclusion body myopathy, autosomal recessive, 600737 (3) to Nonaka myopathy MIM#605820; Thrombocytopenia 12 with or without myopathy MIM#620757 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.147 | GNE | Zornitza Stark Publications for gene: GNE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.146 | GNE | Zornitza Stark Classified gene: GNE as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.146 | GNE | Zornitza Stark Gene: gne has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.145 | CLN3 | Zornitza Stark Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.145 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.145 | CLN3 | Zornitza Stark Phenotypes for gene: CLN3 were changed from Ceroid lipofuscinosis, neuronal, 3, 204200 (3) to Ceroid lipofuscinosis, neuronal, 3, MIM# 204200; MONDO:0008767 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.144 | CLN3 | Zornitza Stark Publications for gene: CLN3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.143 | CLN3 | Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.143 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | GPR143 | Zornitza Stark Tag for review tag was added to gene: GPR143. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NUDT2 | Sangavi Sivagnanasundram reviewed gene: NUDT2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder with or without peripheral neuropathy, MONDO:0859240; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NLRP2 | Sangavi Sivagnanasundram reviewed gene: NLRP2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte/zygote/embryo maturation arrest 18, MONDO:0957230; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NKAP | Sangavi Sivagnanasundram reviewed gene: NKAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NDUFAF8 | Sangavi Sivagnanasundram reviewed gene: NDUFAF8: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Leigh Syndrome MONDO:0009723; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NDUFAF7 | Sangavi Sivagnanasundram reviewed gene: NDUFAF7: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Pathological Myopia MONDO:0001383; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.256 | THAP11_SCA51_CAG | Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Marked STR: RAPGEF2_FAME7_TTTCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Classified STR: RAPGEF2_FAME7_TTTCA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.144 | RAPGEF2_FAME7_TTTCA |
Bryony Thompson STR: RAPGEF2_FAME7_TTTCA was added STR: RAPGEF2_FAME7_TTTCA was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for STR: RAPGEF2_FAME7_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: RAPGEF2_FAME7_TTTCA were set to 29507423; 30351492; 33791773 Phenotypes for STR: RAPGEF2_FAME7_TTTCA were set to Epilepsy, familial adult myoclonic, 7 MIM#618075 Review for STR: RAPGEF2_FAME7_TTTCA was set to AMBER Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported. The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.117 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.27 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2510 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.63 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Congenital Disorders of Glycosylation. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.115 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.308 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Skeletal dysplasia. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.12 | TCF4_FECD3_CTG | Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Marked STR: TBP_SCA17_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Classified STR: TBP_SCA17_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.34 | TBP_SCA17_CAG |
Bryony Thompson STR: TBP_SCA17_CAG was added STR: TBP_SCA17_CAG was added to Early-onset Parkinson disease. Sources: Expert list Mode of inheritance for STR: TBP_SCA17_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: TBP_SCA17_CAG were set to 10484774; 20301611; 29325606; 27172828; 14638975; 11313753; 11914409 Phenotypes for STR: TBP_SCA17_CAG were set to Spinocerebellar ataxia 17 MIM#607136 Review for STR: TBP_SCA17_CAG was set to GREEN STR: TBP_SCA17_CAG was marked as clinically relevant STR: TBP_SCA17_CAG was marked as current diagnostic Added comment: NM_003194.4:c.172_174[X] Mechanism of disease expected to be gain of function Normal: ≤ 40 CAG/CAA repeats Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms. Full-penetrance: ≥49 CAG/CAA repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.577 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2509 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.39 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.33 | TAF1_XDP_CCCTCT | Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.143 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2508 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.142 | SAMD12_FAME1_TTTCA | Bryony Thompson Classified STR: SAMD12_FAME1_TTTCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.142 | SAMD12_FAME1_TTTCA | Bryony Thompson Str: samd12_fame1_tttca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2507 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.141 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2506 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.58 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4_RILPL1_CGG was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Classified STR: ATXN8OS_SCA8_CTG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.31 | ATXN8OS_SCA8_CTG |
Bryony Thompson STR: ATXN8OS_SCA8_CTG was added STR: ATXN8OS_SCA8_CTG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: ATXN8OS_SCA8_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATXN8OS_SCA8_CTG were set to 24285970; 20301445; 10192387 Phenotypes for STR: ATXN8OS_SCA8_CTG were set to Spinocerebellar ataxia 8 MIM#608768 Review for STR: ATXN8OS_SCA8_CTG was set to GREEN STR: ATXN8OS_SCA8_CTG was marked as clinically relevant STR: ATXN8OS_SCA8_CTG was marked as current diagnostic Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X] ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats Alleles of questionable significance: 50-70 repeats. Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Marked STR: PPP2R2B_SCA12_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Classified STR: PPP2R2B_SCA12_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.29 | PPP2R2B_SCA12_CAG |
Bryony Thompson STR: PPP2R2B_SCA12_CAG was added STR: PPP2R2B_SCA12_CAG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: PPP2R2B_SCA12_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PPP2R2B_SCA12_CAG were set to 31286011; 27864267; 33811808; 10581021 Phenotypes for STR: PPP2R2B_SCA12_CAG were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: PPP2R2B_SCA12_CAG was set to GREEN STR: PPP2R2B_SCA12_CAG was marked as clinically relevant STR: PPP2R2B_SCA12_CAG was marked as current diagnostic Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead affects the expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12 Established pathogenic (used as diagnostic cut-off): ≥51 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2505 | PPP2R2B_SCA12_CAG | Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2504 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV_PLIN4 was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.57 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Classified STR: PABPN1_OPMD_GCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.55 | PABPN1_OPMD_GCN |
Bryony Thompson STR: PABPN1_OPMD_GCN was added STR: PABPN1_OPMD_GCN was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list Mode of inheritance for STR: PABPN1_OPMD_GCN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for STR: PABPN1_OPMD_GCN were set to 9462747; 20301305 Phenotypes for STR: PABPN1_OPMD_GCN were set to Oculopharyngeal muscular dystrophy MIM#164300 Review for STR: PABPN1_OPMD_GCN was set to GREEN STR: PABPN1_OPMD_GCN was marked as clinically relevant STR: PABPN1_OPMD_GCN was marked as current diagnostic Added comment: NM_004643.3:c.4_6[X] Expected gain of function mechanism of disease Normal allele: (GCN)10 / Ala10 Autosomal recessive: (GCN)11/Ala11 Autosomal dominant: (GCN)12-17 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | PABPN1_OPMD_GCN | Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Marked STR: NUTM2B-AS1_OPDM_CCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Classified STR: NUTM2B-AS1_OPDM_CCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.53 | NUTM2B-AS1_OPDM_CCG |
Bryony Thompson STR: NUTM2B-AS1_OPDM_CCG was added STR: NUTM2B-AS1_OPDM_CCG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Literature Mode of inheritance for STR: NUTM2B-AS1_OPDM_CCG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NUTM2B-AS1_OPDM_CCG were set to 31332380; 37923380; 39308795; 38159879 Phenotypes for STR: NUTM2B-AS1_OPDM_CCG were set to Oculopharyngodistal myopathy MONDO:0025193 Review for STR: NUTM2B-AS1_OPDM_CCG was set to GREEN STR: NUTM2B-AS1_OPDM_CCG was marked as clinically relevant Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes. NR_120611.1:n.192CCG[X] 4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.28 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2503 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.576 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.26 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.52 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.575 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2502 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Marked STR: MARCH6_FAME3_TTTCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Classified STR: MARCH6_FAME3_TTTCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.139 | MARCH6_FAME3_TTTCA |
Bryony Thompson STR: MARCH6_FAME3_TTTCA was added STR: MARCH6_FAME3_TTTCA was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for STR: MARCH6_FAME3_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MARCH6_FAME3_TTTCA were set to 31664039 Phenotypes for STR: MARCH6_FAME3_TTTCA were set to Epilepsy, familial adult myoclonic, 3 MIM#613608 Review for STR: MARCH6_FAME3_TTTCA was set to GREEN STR: MARCH6_FAME3_TTTCA was marked as clinically relevant STR: MARCH6_FAME3_TTTCA was marked as current diagnostic Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.51 | LRP12_OPDM1_CGG | Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.33 | LRP12_ALS_CGG | Bryony Thompson LRP12-ALS_CGG was changed to LRP12_ALS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Marked STR: JPH3_HDL2_CTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Classified STR: JPH3_HDL2_CTG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.26 | JPH3_HDL2_CTG |
Bryony Thompson changed review comment from: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29 Sources: Literature; to: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included Full penetrance: ≥40 repeats |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.26 | JPH3_HDL2_CTG |
Bryony Thompson STR: JPH3_HDL2_CTG was added STR: JPH3_HDL2_CTG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: JPH3_HDL2_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: JPH3_HDL2_CTG were set to 11558794; 20301701 Phenotypes for STR: JPH3_HDL2_CTG were set to Huntington disease-like 2 MIM#606438 Review for STR: JPH3_HDL2_CTG was set to GREEN STR: JPH3_HDL2_CTG was marked as clinically relevant STR: JPH3_HDL2_CTG was marked as current diagnostic Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.37 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2501 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.25 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.137 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.113 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.134 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Aminoacidopathy. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.49 | GLS_GDPAG_GCA | Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2500 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.50 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Marked STR: FXN_FRDA_GAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Marked STR: FXN_FRDA_GAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.24 | FXN_FRDA_GAA |
Bryony Thompson STR: FXN_FRDA_GAA was added STR: FXN_FRDA_GAA was added to Hereditary Neuropathy - complex. Sources: Expert list Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916 Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300 Review for STR: FXN_FRDA_GAA was set to GREEN STR: FXN_FRDA_GAA was marked as clinically relevant STR: FXN_FRDA_GAA was marked as current diagnostic Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.972 | FXN_FRDA_GAA |
Bryony Thompson STR: FXN_FRDA_GAA was added STR: FXN_FRDA_GAA was added to Mitochondrial disease. Sources: Expert list Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916 Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300 Review for STR: FXN_FRDA_GAA was set to GREEN STR: FXN_FRDA_GAA was marked as clinically relevant STR: FXN_FRDA_GAA was marked as current diagnostic Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.2 | FOXL2_BPES_GCN |
Bryony Thompson STR: FOXL2_BPES_GCN was added STR: FOXL2_BPES_GCN was added to Blepharophimosis. Sources: Literature Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808 Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996 Review for STR: FOXL2_BPES_GCN was set to GREEN STR: FOXL2_BPES_GCN was marked as clinically relevant STR: FOXL2_BPES_GCN was marked as current diagnostic Added comment: NM_023067.2:c.661_702[X] Mechanism of disease is polyAlanine tract leading to a loss of function of the protein Normal repeat number: 14 Pathogenic repeat number: 19-24 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.346 | FOXL2_BPES_GCN |
Bryony Thompson STR: FOXL2_BPES_GCN was added STR: FOXL2_BPES_GCN was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808 Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996 Review for STR: FOXL2_BPES_GCN was set to GREEN STR: FOXL2_BPES_GCN was marked as clinically relevant STR: FOXL2_BPES_GCN was marked as current diagnostic Added comment: NM_023067.2:c.661_702[X] Mechanism of disease is polyAlanine tract leading to a loss of function of the protein Normal repeat number: 14 Pathogenic repeat number: 19-24 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Marked STR: FMR1_FXS_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.24 | FMR1_FXTAS_CGG | Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.111 | FMR1_FXS_CGG |
Bryony Thompson STR: FMR1_FXS_CGG was added STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184 Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624 Review for STR: FMR1_FXS_CGG was set to GREEN STR: FMR1_FXS_CGG was marked as clinically relevant STR: FMR1_FXS_CGG was marked as current diagnostic Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 | FMR1_FXPOI_CGG | Bryony Thompson Marked STR: FMR1_FXPOI_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 | FMR1_FXPOI_CGG | Bryony Thompson Str: fmr1_fxpoi_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 | FMR1_FXPOI_CGG | Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.48 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.263 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.13 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.142 | CAPN3 | Zornitza Stark Marked gene: CAPN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.142 | CAPN3 | Zornitza Stark Gene: capn3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.142 | CAPN3 | Zornitza Stark Phenotypes for gene: CAPN3 were changed from Muscular dystrophy, limb-girdle, type 2A, 253600 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM#253600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.141 | CAPN3 | Zornitza Stark Publications for gene: CAPN3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.140 | CANT1 | Zornitza Stark Marked gene: CANT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.140 | CANT1 | Zornitza Stark Gene: cant1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.140 | CANT1 | Zornitza Stark Phenotypes for gene: CANT1 were changed from Desbuquois dysplasia, 251450 (3) to Desbuquois dysplasia 1, MIM# 251450; Epiphyseal dysplasia, multiple, 7, MIM# 617719 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.139 | CANT1 | Zornitza Stark Publications for gene: CANT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.138 | C5orf42 | Zornitza Stark Marked gene: C5orf42 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.138 | C5orf42 | Zornitza Stark Gene: c5orf42 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.138 | C5orf42 | Zornitza Stark Phenotypes for gene: C5orf42 were changed from Joubert syndrome 17, 614615 (3) to Joubert syndrome 17, MIM# 614615; Orofaciodigital syndrome VI, MIM# 277170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.137 | C5orf42 | Zornitza Stark Publications for gene: C5orf42 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEIOB |
Jasmine Chew gene: MEIOB was added gene: MEIOB was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MEIOB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MEIOB were set to 28206990; 34392356; 35991565; 37715646; 31000419; 39545410; 30838384 Phenotypes for gene: MEIOB were set to Premature ovarian failure 23, MIM# 620686; Spermatogenic failure 22, MIM# 617706 Review for gene: MEIOB was set to GREEN Added comment: Literature in OMIM- PMID: 28206990; 34392356; 35991565; 37715646; 31000419- multiple unrelated infertile males due to spermatogenic failure and females due to premature ovarian failure carrying biallelic variants, supported by functional evidence. New papers: i) PMID: 39545410- previously reported homozygous nonsense p.(Arg272*) in proband 2136 (Egyptian), with a history of 6 early miscarriages, 3 failed intracytoplasmic sperm injection cycles, 1 HM, and low anti-Müllerian hormone (AMH) (2 times ≤0.2 ng/mL). ii) PMID: 30838384- A novel homozygous frameshift variant in two brothers of Arab ethnicity. This frame-shift is predicted to result in a truncated MEIOB protein, which lacks the conserved C-terminal DNA binding domain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | SYCP2 |
Jasmine Chew changed review comment from: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants. New papers (monoallelic and biallelic variants for male infertility): i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11). iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. New paper (biallelic variant for Hydatidiform mole): i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. Sources: Literature; to: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants. New papers (monoallelic and biallelic variants for male infertility): i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11). iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. New paper (biallelic variant for hydatidiform mole): i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | SYCP2 |
Jasmine Chew gene: SYCP2 was added gene: SYCP2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SYCP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYCP2 were set to 31866047; 39202451; 38511217; 37337432; 39545410 Phenotypes for gene: SYCP2 were set to Spermatogenic failure 1, MIM# 258150; Hydatidiform mole Review for gene: SYCP2 was set to GREEN Added comment: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants. New papers (monoallelic and biallelic variants for male infertility): i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11). iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. New paper (biallelic variant for Hydatidiform mole): i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | CCDC155 |
Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125) Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125) Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410- Compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | CCDC155 |
Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125) Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | CCDC155 |
Jasmine Chew gene: CCDC155 was added gene: CCDC155 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CCDC155 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC155 were set to 29790874; 35674372; 36864840; 35708642; 39545410 Phenotypes for gene: CCDC155 were set to Premature ovarian failure 22, MIM# 620548; Spermatogenic failure 88, MIM# 620547 Review for gene: CCDC155 was set to GREEN Added comment: Note- HGNC Approved Gene Symbol: KASH5 Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | C11orf80 | Jasmine Chew edited their review of gene: C11orf80: Changed publications: 30388401, 36732965 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MAJIN |
Jasmine Chew gene: MAJIN was added gene: MAJIN was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MAJIN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAJIN were set to 39545410; 33211200 Phenotypes for gene: MAJIN were set to Recurrent hydatidiform mole, non-obstructive azoospermia Review for gene: MAJIN was set to AMBER Added comment: New papers (biallelic variant for HM/male infertility): i) PMID: 39545410- Novel homozygous splice donor site variant c.349+1G>T in patient 1824 (Italian) with 2 HMs followed by secondary infertility and substantially reduced bilateral ovarian volumes. MAJIN codes for a junction protein that forms a complex with TERB1 and TERB2, which together bind to telomeres and anchor them to the inner nuclear membrane components KASH5 and SUN1. This attachment of chromosomes to the nuclear envelope is essential for homologous chromosome movement and synapsis. In mice, both male and female null mutants Majin are infertile (PMID: 26548954). In humans, biallelic mutations in MAJIN have been reported in infertile males. ii) PMID: 33211200- A homozygous p.Arg53His in NOA-affected male (Individual 4- M1646) with high CADD scores and low gnomad freq. Mice disrupted for either Majin or Terb2 display impaired synapsis, zygotene arrest, a lack of postmeiotic cells and infertility (Shibuya et al. 2015; Zhang et al. 2017). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | C11orf80 |
Jasmine Chew gene: C11orf80 was added gene: C11orf80 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: C11orf80 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C11orf80 were set to Recurrent hydatidiform mole 4, MIM # 618432 Review for gene: C11orf80 was set to AMBER Added comment: Note: HGNC Approved Gene Symbol- TOP6BL Literature in OMIM- PubMed: 30388401- Two unrelated females with RHMs carrying a homozygous p.Glu262∗ and p.Ser501Pro, respectively. New paper (biallelic variants for OZEMA/NOA) i) PMID: 36732965- A homozygous LOF p.E162* in four infertile siblings born to a consanguineous marriage, with three brothers suffering from non-obstructive azoospermia and one sister suffering from unexplained infertility. Mouse models carrying similar mutations to that in patients recapitulated the spermatogenic abnormalities of the patient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | DNAAF4 |
Jasmine Chew gene: DNAAF4 was added gene: DNAAF4 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DNAAF4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAAF4 were set to 23872636; 37674365; 37147940; 36583018; 35903363 Phenotypes for gene: DNAAF4 were set to Primary ciliary dyskinesia 25, MIM# 615482 Review for gene: DNAAF4 was set to GREEN Added comment: Literature in OMIM- PMID: 23872636- biallelic variants reported for PCD, and reduced fertility was observed. New papers (biallelic variants reported for PCD/ infertility): i) PMID: 37674365- A novel homozygous splice acceptor site variant in DNAAF4 in two brother with asthenozoospermia. Functional assay revealed the absence of any exon 7-containing DNAAF4 transcripts in the sperm from P1, unlike in a normal control sample, consistent with the dysfunction or loss of DNAAF4 protein expression that may explain the abnormal sperm phenotypes in this patient. ii) PMID: 37147940- Novel compound heterozygous splice site c.784-1G>A and 20.1 Kb deletion in a male with PCD and asthenoteratozoospermia, resulting in a truncated and functionless DNAAF4 protein. mmunofluorescence analysis indicated that the inner dynein arm was not present in the sperm flagellum, and sperm morphological analysis revealed small sperm with twisted and curved flagella or lacking flagella. iii) PMID: 36583018- A novel homozygous p. G373E variant in a female patient with PCD who was born in a consanguineous family. Functional assays showed that the variant lead to PCD by reducing the stability of DNAAF4 protein. iv) PMID: 35903363- Two homozygous variants, Arg330Trp and p.Arg245*, identified in two unrelated male and female with PCD. The affected male had asthenoteratozoospermia while female with primary infertility. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TBPL2 |
Jasmine Chew gene: TBPL2 was added gene: TBPL2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TBPL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBPL2 were set to 37804378; 33966269; 33893736; 33541821 Phenotypes for gene: TBPL2 were set to Oocyte maturation arrest Review for gene: TBPL2 was set to GREEN Added comment: New papers reporting biallelic variants in infertile women: i) PMID: 37804378- Compound heterozygous novel p.Arg268Ter and recurrent p.Arg233Ter in a female with impaired ovarian folliculogenesis. Structure prediction by molecular modeling demonstrated that three-dimensional structure of TBPL2 was destabilized in mutant proteins. ii) PMID: 33966269- Homozygous missense mutation p.C299R in two infertile sisters with oocyte maturation arrest and degeneration from a consanguineous family. Functional assays showed that the transcriptional level of ZP3 was not completely blocked but severely reduced by the regulation of the mutant TBPL2, while the transcriptional level of H2Bc was significantly reduced but to a less severe extent compared with that of ZP3, suggesting that the missense had a damage to the transcription initiation function of TBPL2 and its downstream targeted genes got involved in different degrees. The mutant protein also has less stability, which contributes to the lower activity of transcription initiation in the mutant form. iii) PMID: 33893736- Homozygous splicing variant (c.788 + 3A>G) in two unrelated families characterized by oocyte maturation defects. Functional assays showed that the variant disrupted the integrity of TBPL2 mRNA and affected oocytes showed that vital genes for oocyte maturation and fertilization were widely and markedly downregulated, suggesting that a mutation in TBPL2, led to global gene alterations in oocytes; the same variant reported before in PMID: 33541821 in three affected females with diminished ovarian reserve from 3 independent families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEI1 |
Jasmine Chew changed review comment from: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA) New papers (biallelic variants for OZEMA): i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1. New papers (biallelic variants for NOA): i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro. - others- PMID: 32741963, PMID: 36017582 Note: Moderate evidence for OZEMA and HM in FeRGI database Sources: Literature; to: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA) New papers (biallelic variants for OZEMA): i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1. New papers (biallelic variants for NOA): i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro. - others: PMID: 32741963;36017582 Note: Moderate evidence for OZEMA and HM in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEI1 | Jasmine Chew edited their review of gene: MEI1: Changed publications: 30388401, 38416203, 34037756, 36759719, 32741963, 36017582 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEI1 |
Jasmine Chew gene: MEI1 was added gene: MEI1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MEI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MEI1 were set to 30388401 Phenotypes for gene: MEI1 were set to Recurrent hydatidiform mole 3, MIM# 618431; Non-obstructive azoospermia Review for gene: MEI1 was set to GREEN Added comment: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA) New papers (biallelic variants for OZEMA): i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1. New papers (biallelic variants for NOA): i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro. - others- PMID: 32741963, PMID: 36017582 Note: Moderate evidence for OZEMA and HM in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | FOXL2 |
Jasmine Chew gene: FOXL2 was added gene: FOXL2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FOXL2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: FOXL2 were set to 12149404; 19429596; 38558253; 36793102; 39545410 Phenotypes for gene: FOXL2 were set to Premature ovarian failure 3, #MIM 608996 Added comment: Literature in OMIM- PubMed: 12149404; 19429596- multiple patients with isolated POF carrying monoallelic variants New papers (monoallelic variants for POI): i) PMID: 38558253- One in-frame deletion and 13 missense variants, including two recurrent ones (p.(Pro212Ala) and p.(Arg349Gly) in 14 patients with POI/DOR. Two variants, (p.(Gly187Asp) and p.(Arg349Gly) have been previously identified in patients with non-syndromic POI (PMID: 19429596 and PMID: 36793102). ii) PMID: 36793102- Sixteen POI patients carrying four different heterozygous variants, including the recurrent p.(Arg349Gly). Functional assay on the recurrent variant showed that the mutant FOXL2 did not present with the transcriptional repressive effect on CYP17A1 expression as shown by wild-type protein. New paper (biallelic variants for HM): i) PMID: 39545410- A novel homozygous missense p.(Phe167Ser) in patient 1690 (South Asian) with 5 CHMs, 3 miscarriages, 1 stillbirth, and 1 live birth. FOXL2 is essential for granulosa cell differentiation and proliferation, as well as ovarian maintenance and function.Therefore, its impairment may affect indirectly the meiotic maturation of oocytes, and may consequently lead to molar pregnancies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2499 | KEL | Achchuthan Shanmugasundram reviewed gene: KEL: Rating: AMBER; Mode of pathogenicity: None; Publications: 30578106, 37978175; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2499 | NOS3 | Achchuthan Shanmugasundram reviewed gene: NOS3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36941667, 37383439; Phenotypes: Moyamoya disease, MONDO:0016820; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Marked gene: NLRP7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Classified gene: NLRP7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Marked gene: MOS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Gene: mos has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Classified gene: MOS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Gene: mos has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Marked gene: MUSK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Added comment: Comment when marking as ready: Severe fetal anomalies can lead to pregnancy loss; however, this is more in scope for the Fetal Anomalies panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Classified gene: MUSK as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Marked gene: DNAH11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Classified gene: DNAH11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Marked gene: LHCGR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Classified gene: LHCGR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Marked gene: FRAS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Added comment: Comment when marking as ready: Severe fetal abnormalities can cause pregnancy loss. However, this is more in scope for Fetal anomalies panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Classified gene: FRAS1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Marked gene: GBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Added comment: Comment when marking as ready: Mechanism of pregnancy loss unclear, could be chance observation. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Marked gene: GBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Classified gene: GBE1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.136 | BTK | Zornitza Stark Marked gene: BTK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.136 | BTK | Zornitza Stark Gene: btk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.136 | BTK | Zornitza Stark Phenotypes for gene: BTK were changed from Agammaglobulinemia and isolated hormone deficiency, 307200 (3) to Agammaglobulinemia, X-linked 1 MIM#300755; Bruton-type agammaglobulinemia MONDO:0010421; Isolated growth hormone deficiency, type III, with agammaglobulinemia MIM#307200 MONDO:0010615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.135 | BTK | Zornitza Stark Publications for gene: BTK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.134 | BSND | Zornitza Stark Marked gene: BSND as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.134 | BSND | Zornitza Stark Gene: bsnd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.134 | BSND | Zornitza Stark Phenotypes for gene: BSND were changed from Bartter syndrome, type 4a, 602522 (3) to Bartter syndrome, type 4a MIM#602522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.133 | BSND | Zornitza Stark Publications for gene: BSND were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.132 | BRWD3 | Zornitza Stark Marked gene: BRWD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.132 | BRWD3 | Zornitza Stark Gene: brwd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.132 | BRWD3 | Zornitza Stark Phenotypes for gene: BRWD3 were changed from Mental retardation, X-linked 93, 300659 (3) to Intellectual developmental disorder, X-linked 93 MIM#300659 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.131 | BRWD3 | Zornitza Stark Publications for gene: BRWD3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.130 | BRAT1 | Zornitza Stark Marked gene: BRAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.130 | BRAT1 | Zornitza Stark Gene: brat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.130 | BRAT1 | Zornitza Stark Phenotypes for gene: BRAT1 were changed from Rigidity and multifocal seizure syndrome, lethal neonatal, 614498 (3) to Rigidity and multifocal seizure syndrome, lethal neonatal, MIM#614498; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.129 | BRAT1 | Zornitza Stark Publications for gene: BRAT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.128 | BLM | Zornitza Stark Marked gene: BLM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.128 | BLM | Zornitza Stark Gene: blm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.128 | BLM | Zornitza Stark Phenotypes for gene: BLM were changed from Bloom syndrome, 210900 (3) to Bloom Syndrome MIM# 210900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.127 | BLM | Zornitza Stark Publications for gene: BLM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.126 | BCS1L | Zornitza Stark Marked gene: BCS1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.126 | BCS1L | Zornitza Stark Gene: bcs1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.126 | BCS1L | Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, 603358 (3) to GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type 1, MIM#124000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.125 | BCS1L | Zornitza Stark Publications for gene: BCS1L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.124 | BCKDHB | Zornitza Stark Marked gene: BCKDHB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.124 | BCKDHB | Zornitza Stark Gene: bckdhb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.124 | BCKDHB | Zornitza Stark Phenotypes for gene: BCKDHB were changed from Maple syrup urine disease, type Ib, 248600 (3) to Maple syrup urine disease, type Ib 620698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.123 | BCKDHB | Zornitza Stark Publications for gene: BCKDHB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.122 | BCKDHA | Zornitza Stark Marked gene: BCKDHA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.122 | BCKDHA | Zornitza Stark Gene: bckdha has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.122 | BCKDHA | Zornitza Stark Phenotypes for gene: BCKDHA were changed from Maple syrup urine disease, type Ia, 248600 (3) to Maple syrup urine disease, type Ia, MIM# 248600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.121 | BCKDHA | Zornitza Stark Publications for gene: BCKDHA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.120 | BBS9 | Zornitza Stark Marked gene: BBS9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.120 | BBS9 | Zornitza Stark Gene: bbs9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.120 | BBS9 | Zornitza Stark Phenotypes for gene: BBS9 were changed from Bardet-Biedl syndrome 9, 615986 (3) to Bardet-Biedl syndrome 9 MIM#615986 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.119 | BBS9 | Zornitza Stark Publications for gene: BBS9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.118 | BBS7 | Zornitza Stark Marked gene: BBS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.118 | BBS7 | Zornitza Stark Gene: bbs7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.118 | BBS7 | Zornitza Stark Phenotypes for gene: BBS7 were changed from Bardet-Biedl syndrome 7, 615984 (3) to Bardet-Biedl syndrome 7, MIM# 615984; MONDO:0014435 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.117 | BBS7 | Zornitza Stark Publications for gene: BBS7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.116 | BBS5 | Zornitza Stark Marked gene: BBS5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.116 | BBS5 | Zornitza Stark Gene: bbs5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.116 | BBS5 | Zornitza Stark Phenotypes for gene: BBS5 were changed from Bardet-Biedl syndrome 5, 615983 (3) to Bardet-Biedl syndrome 5, MIM#615983; MONDO:0014434 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.115 | BBS5 | Zornitza Stark Publications for gene: BBS5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.114 | BBS4 | Zornitza Stark Marked gene: BBS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.114 | BBS4 | Zornitza Stark Gene: bbs4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.114 | BBS4 | Zornitza Stark Phenotypes for gene: BBS4 were changed from Bardet-Biedl syndrome 4, 615982 (3) to Bardet-Biedl syndrome 4, MIM#615982 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.113 | BBS2 | Zornitza Stark Marked gene: BBS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.113 | BBS2 | Zornitza Stark Gene: bbs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.113 | BBS2 | Zornitza Stark Phenotypes for gene: BBS2 were changed from Bardet-Biedl syndrome 2, 615981 (3) to Bardet-Biedl syndrome 2, MIM#615981 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.112 | BBS12 | Zornitza Stark Marked gene: BBS12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.112 | BBS12 | Zornitza Stark Gene: bbs12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.112 | BBS12 | Zornitza Stark Phenotypes for gene: BBS12 were changed from Bardet-Biedl syndrome 12, 615989 (3) to Bardet-Biedl syndrome 12, MIM#615989 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.111 | BBS10 | Zornitza Stark Marked gene: BBS10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.111 | BBS10 | Zornitza Stark Gene: bbs10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.111 | BBS10 | Zornitza Stark Phenotypes for gene: BBS10 were changed from Bardet-Biedl syndrome 10, 615987 (3) to Bardet-Biedl syndrome 10 (MIM#615987) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.110 | BBS10 | Zornitza Stark Publications for gene: BBS10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.109 | BBS1 | Zornitza Stark Marked gene: BBS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.109 | BBS1 | Zornitza Stark Gene: bbs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.109 | BBS1 | Zornitza Stark Phenotypes for gene: BBS1 were changed from Bardet-Biedl syndrome 1, 209900 (3) to Bardet-Biedl syndrome 1, MIM# 209900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.108 | BBS1 | Zornitza Stark Publications for gene: BBS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.107 | B3GLCT | Zornitza Stark Marked gene: B3GLCT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.107 | B3GLCT | Zornitza Stark Gene: b3glct has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.107 | B3GLCT | Zornitza Stark Phenotypes for gene: B3GLCT were changed from Peters-plus syndrome, 261540 (3) to Peters-plus syndrome (MIM#261540) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.106 | B3GLCT | Zornitza Stark Publications for gene: B3GLCT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.49 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.108 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2499 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2498 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.542 | DAB1_SCA37_ATTTC | Bryony Thompson Marked STR: DAB1_SCA37_ATTTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.542 | DAB1_SCA37_ATTTC | Bryony Thompson Str: dab1_sca37_atttc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.542 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.20 | CSTB_EPM1_CCCCGCCCCGCG |
Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added STR: CSTB_EPM1_CCCCGCCCCGCG was added to Progressive Myoclonic Epilepsy. Sources: Expert list Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745 Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.135 | CSTB_EPM1_CCCCGCCCCGCG |
Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added STR: CSTB_EPM1_CCCCGCCCCGCG was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745 Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Marked STR: CNBP_DM2_CCTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Classified STR: CNBP_DM2_CCTG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.47 | CNBP_DM2_CCTG |
Bryony Thompson STR: CNBP_DM2_CCTG was added STR: CNBP_DM2_CCTG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list Mode of inheritance for STR: CNBP_DM2_CCTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CNBP_DM2_CCTG were set to 20301639; 11486088 Phenotypes for STR: CNBP_DM2_CCTG were set to Myotonic dystrophy 2 MIM#602668 Review for STR: CNBP_DM2_CCTG was set to GREEN STR: CNBP_DM2_CCTG was marked as clinically relevant STR: CNBP_DM2_CCTG was marked as current diagnostic Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X] Toxic gain of function RNA expected mechanism of disease Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions Unknown significance (normal vs. mutable): 27-29 CCTG repeats Mutable normal (premutation) alleles. ~30-~54 CCTG repeats Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats Pathogenic: ~75-11,000 CCTG repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2497 | CNBP_DM2_CCTG | Bryony Thompson DM2 was changed to CNBP_DM2_CCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.280 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.315 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.23 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.32 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.36 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2496 | BEAN1_SCA31_TGGAA | Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2495 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.223 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Classified STR: ATXN3_SCA3_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.21 | ATXN3_SCA3_CAG |
Bryony Thompson STR: ATXN3_SCA3_CAG was added STR: ATXN3_SCA3_CAG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: ATXN3_SCA3_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATXN3_SCA3_CAG were set to 11176969; 7574470; 7874163; 20301375; 29325606 Phenotypes for STR: ATXN3_SCA3_CAG were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3 Review for STR: ATXN3_SCA3_CAG was set to GREEN STR: ATXN3_SCA3_CAG was marked as clinically relevant STR: ATXN3_SCA3_CAG was marked as current diagnostic Added comment: NM_004993.5:c.886_888CAG[X] Toxic aggregation and mislocalization in neurons is mechanism of disease Normal: ≤44 repeats, mostly <31 repeats Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3 Pathogenic (full penetrance): ≥60 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2494 | ATXN3_SCA3_CAG | Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Classified STR: ATXN2_SCA2_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.19 | ATXN2_SCA2_CAG |
Bryony Thompson STR: ATXN2_SCA2_CAG was added STR: ATXN2_SCA2_CAG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: ATXN2_SCA2_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATXN2_SCA2_CAG were set to 11761482; 17923635; 8896555; 29325606; 20301452 Phenotypes for STR: ATXN2_SCA2_CAG were set to Spinocerebellar ataxia 2 MIM#183090 Review for STR: ATXN2_SCA2_CAG was set to GREEN STR: ATXN2_SCA2_CAG was marked as clinically relevant STR: ATXN2_SCA2_CAG was marked as current diagnostic Added comment: NM_002973.3:c.496_498CAG[X] Toxic protein aggregation is mechanism of disease Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2) Uncertain: 32 repeats ALS risk allele: 30-32 repeats Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life Full penetrance: ≥35 repeats Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.31 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2493 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2492 | ATXN1_SCA1_CAG | Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.18 | ATXN1_SCA1_CAG | Bryony Thompson ATXN1_CAG was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2491 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.541 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.17 | ATXN10 | Bryony Thompson Classified gene: ATXN10 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.17 | ATXN10 | Bryony Thompson Added comment: Comment on list classification: Only a single family reported | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.17 | ATXN10 | Bryony Thompson Gene: atxn10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Marked STR: ATN1_DRPLA_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Classified STR: ATN1_DRPLA_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.133 | ATN1_DRPLA_CAG |
Bryony Thompson STR: ATN1_DRPLA_CAG was added STR: ATN1_DRPLA_CAG was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: ATN1_DRPLA_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATN1_DRPLA_CAG were set to 8136840; 8136826; 29325606; 20301664 Phenotypes for STR: ATN1_DRPLA_CAG were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Review for STR: ATN1_DRPLA_CAG was set to GREEN STR: ATN1_DRPLA_CAG was marked as clinically relevant STR: ATN1_DRPLA_CAG was marked as current diagnostic Added comment: NM_001007026.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.35 | ATN1_DRPLA_CAG | Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Marked gene: NACC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Classified gene: NACC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Marked gene: NAA15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Classified gene: NAA15 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Marked gene: PAH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Classified gene: PAH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.106 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.131 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.275 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.130 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.130 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.129 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.129 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.128 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.128 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.104 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.128 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.273 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Dystonia - complex. Sources: Expert Review Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.272 | ARX | Bryony Thompson Tag STR tag was added to gene: ARX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.30 | AR_SBMA_CAG | Bryony Thompson SBMA was changed to AR_SBMA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Marked STR: AFF2_FRAXE_GCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Classified STR: AFF2_FRAXE_GCC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2489 | AFF2_FRAXE_GCC |
Bryony Thompson STR: AFF2_FRAXE_GCC was added STR: AFF2_FRAXE_GCC was added to Mendeliome. Sources: Expert list Mode of inheritance for STR: AFF2_FRAXE_GCC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: AFF2_FRAXE_GCC were set to 8334699; 8673085; 11388762 Phenotypes for STR: AFF2_FRAXE_GCC were set to Intellectual developmental disorder, X-linked 109 MIM#309548 Review for STR: AFF2_FRAXE_GCC was set to GREEN STR: AFF2_FRAXE_GCC was marked as clinically relevant STR: AFF2_FRAXE_GCC was marked as current diagnostic Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25) Loss of function through methylation silencing is the mechanism of disease Normal - 5-44 repeats Inconclusive - 45-54 repeats Premutation - 55-200 repeats Abnormal - >200 or >230 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.103 | AFF2_FRAXE_GCC | Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2488 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.46 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.15 | PRNP_CJD_octapeptide |
Bryony Thompson STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.33 | PRNP_CJD_octapeptide | Bryony Thompson CJD was changed to PRNP_CJD_octapeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | ZIC3_VACTERLX_GCC | Bryony Thompson VACTERLX was changed to ZIC3_VACTERLX_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.254 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.253 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.253 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.252 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.252 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson OPML1 was changed to NUTM2B-AS1_OPML1_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.251 | NIPA1_ALS_GCG | Bryony Thompson NIPA1 was changed to NIPA1_ALS_GCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.250 | TMEM185A_FRAXF_GCC | Bryony Thompson FRAXF was changed to TMEM185A_FRAXF_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.249 | CBL_FRA11B_CCG | Bryony Thompson FRA11B was changed to CBL_FRA11B_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.248 | C11orf80_FRA11A_CGG | Bryony Thompson FRA11A was changed to C11orf80_FRA11A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.247 | TNRC6A_FAME6_TTTCA | Bryony Thompson FAME6 was changed to TNRC6A_FAME6_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.246 | YEATS2_FAME4_TTTCA | Bryony Thompson FAME4 was changed to YEATS2_FAME4_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.245 | SAMD12_FAME1_TTTGA | Bryony Thompson FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.244 | THAP11_SCA_CAG | Bryony Thompson SCA_THAP11_CAG was changed to THAP11_SCA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.243 | ZNF713_FRA7A_CGG | Bryony Thompson FRA7A was changed to ZNF713_FRA7A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.242 | AFF3_FRA2A_CGG | Bryony Thompson FRA2A was changed to AFF3_FRA2A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.241 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.240 | RAPGEF2_FAME7_TTTCA | Bryony Thompson FAME7 was changed to RAPGEF2_FAME7_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.239 | DMD_DMD_GAA | Bryony Thompson DMD was changed to DMD_DMD_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.238 | RUNX2_CCD_GCN | Bryony Thompson CCD was changed to RUNX2_CCD_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.13 | RFC1_CANVAS_ANNGN |
Bryony Thompson STR: RFC1_CANVAS_ANNGN was added STR: RFC1_CANVAS_ANNGN was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: RFC1_CANVAS_ANNGN were set to 39833204; 39152783; 38789445; 36705320; 35013364 Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Parkinson disease MONDO:0005180 Review for STR: RFC1_CANVAS_ANNGN was set to GREEN STR: RFC1_CANVAS_ANNGN was marked as clinically relevant STR: RFC1_CANVAS_ANNGN was marked as current diagnostic Added comment: Biallelic RFC1 expansions have been identified as a rare cause of Parkinson's disease, without ataxia or neuropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2487 | Bryony Thompson removed STR:CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2486 | CANVAS_ACAGG | Bryony Thompson Classified STR: CANVAS_ACAGG as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2486 | CANVAS_ACAGG | Bryony Thompson Str: canvas_acagg has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.22 | Bryony Thompson removed STR:CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.21 | RFC1_CANVAS_ANNGN | Bryony Thompson Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.20 | RFC1_CANVAS_ANNGN | Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.20 | RFC1_CANVAS_ANNGN | Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.20 | RFC1_CANVAS_ANNGN | Bryony Thompson CANVAS was changed to RFC1_CANVAS_ANNGN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.237 | Bryony Thompson removed STR:RFC1_CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.236 | RFC1_CANVAS_ANNGN | Bryony Thompson edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.236 | RFC1_CANVAS_ANNGN | Bryony Thompson Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.235 | RFC1_CANVAS_ANNGN | Bryony Thompson commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.235 | RFC1_CANVAS_ANNGN |
Bryony Thompson RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.234 | RFC1_CANVAS_AAGGG | Bryony Thompson Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2485 | RFC1_CANVAS_ANNGN |
Bryony Thompson RFC1_CANVAS_ANNGG was changed to RFC1_CANVAS_ANNGN Repeated Sequence for RFC1_CANVAS_ANNGN was changed from ANNGG to ANNGN. Publications for STR: RFC1_CANVAS_ANNGN were changed from 33237689; 32694621; 33103729; 35355059 to 33237689; 32694621; 33103729; 35355059; 37450567 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2484 | RFC1_CANVAS_ANNGG | Bryony Thompson RFC1_CANVAS_AMRGG was changed to RFC1_CANVAS_ANNGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2483 | RFC1_CANVAS_AMRGG |
Bryony Thompson CANVAS was changed to RFC1_CANVAS_AMRGG Repeated Sequence for RFC1_CANVAS_AMRGG was changed from AAGGG to ANNGG. Publications for STR: RFC1_CANVAS_AMRGG were changed from 30926972; 32851396 to 33237689; 32694621; 33103729; 35355059 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.233 | RFC1_CANVAS_ACAGG | Bryony Thompson Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.232 | RFC1_CANVAS_ACAGG | Bryony Thompson Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.232 | RFC1_CANVAS_ACAGG | Bryony Thompson Str: rfc1_canvas_acagg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.231 | RFC1_CANVAS_ACAGG | Bryony Thompson edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.231 | RFC1_CANVAS_ACAGG | Bryony Thompson CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.230 | TAF1_XDP_CCCTCT | Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.229 | TBX1_TOF_GCN | Bryony Thompson TOF was changed to TBX1_TOF_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.228 | HOXD13_SPD1_GCG | Bryony Thompson SPD1 was changed to HOXD13_SPD1_GCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.227 | ATXN8OS_SCA8_CTG | Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.226 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.225 | CACNA1A_SCA6_CAG | Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.224 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.223 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.222 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.221 | BEAN1_SCA31_TGGAA | Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.220 | ATXN3_SCA3_CAG | Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.219 | FGF14_SCA27B_GAA | Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.218 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.217 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.216 | PPP2R2B_SCA12_CAG | Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.215 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.214 | ATXN1_SCA1_CAG | Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.213 | AR_SBMA_CAG | Bryony Thompson SBMA was changed to AR_SBMA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.212 | EIF4A3_RCPS_complex | Bryony Thompson RCPS was changed to EIF4A3_RCPS_complex | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.211 | SOX3_PHPX_GCN | Bryony Thompson PHPX was changed to SOX3_PHPX_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.210 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.209 | PABPN1_OPMD_GCN | Bryony Thompson OPMD was changed to PABPN1_OPMD_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.208 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.207 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.206 | LRP12_OPDM1_CGG | Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.205 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.204 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.203 | RFC1_CANVAS_AAGGG | Bryony Thompson RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.202 | COMP_MEDPSACH_GAC | Bryony Thompson MEDPSACH was changed to COMP_MEDPSACH_GAC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.201 | PRDM12_HSAN8_GCC | Bryony Thompson HSAN8 was changed to PRDM12_HSAN8_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.200 | ZIC2_HPE5_GCN | Bryony Thompson HPE5 was changed to ZIC2_HPE5_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.199 | VWA1_HMNMYO_GCGCGGAGCG | Bryony Thompson HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.198 | HOXA13_HFGS_GCN3 | Bryony Thompson HFGS_tract3 was changed to HOXA13_HFGS_GCN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.197 | HOXA13_HFGS_GCN2 | Bryony Thompson HFGS_tract2 was changed to HOXA13_HFGS_GCN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.196 | HOXA13_HFGS_GCN1 | Bryony Thompson HFGS_tract1 was changed to HOXA13_HFGS_GCN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.195 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.194 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.193 | GLS_GDPAG_GCA | Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.192 | FMR1_FXTAS_CGG | Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.191 | FMR1_FXS_CGG | Bryony Thompson FXS was changed to FMR1_FXS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.190 | FMR1_FXPOI_CGG | Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.189 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.188 | FXN_FRDA_GAA | Bryony Thompson FRDA was changed to FXN_FRDA_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.187 | AFF2_FRAXE_GCC | Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.186 | TCF4_FECD3_CTG | Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.185 | MARCH6_FAME3_TTTCA | Bryony Thompson FAME3 was changed to MARCH6_FAME3_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.184 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.183 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.182 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson CSTB_EPM1_dodecamer was changed to CSTB_EPM1_CCCCGCCCCGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.181 | CSTB_EPM1_dodecamer | Bryony Thompson CSTB_EPM1_CCCCGCCCCGCG was changed to CSTB_EPM1_dodecamer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.180 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.179 | ARX_EIEE1_GCN2 | Bryony Thompson EIEE1_tract2 was changed to ARX_EIEE1_GCN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.178 | ARX_EIEE1_GCN1 | Bryony Thompson EIEE1_tract1 was changed to ARX_EIEE1_GCN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.177 | ATN1_DRPLA_CAG | Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.176 | CNBP_DM2_CCTG | Bryony Thompson DM2 was changed to CNBP_DM2_CCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.175 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.174 | XYLT1_DBQD2_GGC | Bryony Thompson DBQD2 was changed to XYLT1_DBQD2_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.173 | PRNP_CJD_octapeptide | Bryony Thompson PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT was changed to PRNP_CJD_octapeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.172 | PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT | Bryony Thompson CJD was changed to PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.171 | PHOX2B_CCHS_GCN | Bryony Thompson CCHS was changed to PHOX2B_CCHS_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.105 | AUH | Zornitza Stark Marked gene: AUH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.105 | AUH | Zornitza Stark Gene: auh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.105 | AUH | Zornitza Stark Phenotypes for gene: AUH were changed from 3-methylglutaconic aciduria, type I, 250950 (3) to 3-methylglutaconic aciduria, type I, MIM# 250950; MONDO:0009610 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.104 | AUH | Zornitza Stark Publications for gene: AUH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.103 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.103 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.103 | ATRX | Zornitza Stark Phenotypes for gene: ATRX were changed from Mental retardation-hypotonic facies syndrome, X-linked, 309580 (3) to Alpha thalassemia X-linked intellectual disability syndrome MONDO:0010519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.102 | ATRX | Zornitza Stark Publications for gene: ATRX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.101 | ATR | Zornitza Stark Marked gene: ATR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.101 | ATR | Zornitza Stark Gene: atr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.101 | ATR | Zornitza Stark Phenotypes for gene: ATR were changed from Seckel syndrome 1, 210600 (3) to Seckel syndrome 1(MIM#210600) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.100 | ATR | Zornitza Stark Publications for gene: ATR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.99 | ATP8B1 | Zornitza Stark Marked gene: ATP8B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.99 | ATP8B1 | Zornitza Stark Gene: atp8b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.99 | ATP8B1 | Zornitza Stark Phenotypes for gene: ATP8B1 were changed from Cholestasis, progressive familial intrahepatic 1, 211600 (3) to Cholestasis, progressive familial intrahepatic 1, MIM#211600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.98 | ATP7B | Zornitza Stark Marked gene: ATP7B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.98 | ATP7B | Zornitza Stark Gene: atp7b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.98 | ATP7B | Zornitza Stark Phenotypes for gene: ATP7B were changed from Wilson disease, 277900 (3) to Wilson disease (MIM#277900) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.97 | ATP7B | Zornitza Stark Publications for gene: ATP7B were set to 28433102 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.96 | ATP7A | Zornitza Stark Marked gene: ATP7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.96 | ATP7A | Zornitza Stark Gene: atp7a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.96 | ATP7A | Zornitza Stark Phenotypes for gene: ATP7A were changed from Menkes disease, 309400 (3) to Menkes disease(MIM#309400); Occipital horn syndrome(MIM#304150) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.95 | ATP7A | Zornitza Stark Publications for gene: ATP7A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.94 | ATP6V1B1 | Zornitza Stark Marked gene: ATP6V1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.94 | ATP6V1B1 | Zornitza Stark Gene: atp6v1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.94 | ATP6V1B1 | Zornitza Stark Phenotypes for gene: ATP6V1B1 were changed from Renal tubular acidosis with deafness, 267300 (3) to Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM# 267300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.93 | ATM | Zornitza Stark Marked gene: ATM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.93 | ATM | Zornitza Stark Gene: atm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.93 | ATM | Zornitza Stark Phenotypes for gene: ATM were changed from Ataxia-telangiectasia, 208900 (3) to Ataxia-telangiectasia, MIM# 208900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.92 | ATM | Zornitza Stark Publications for gene: ATM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.91 | ASS1 | Zornitza Stark Marked gene: ASS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.91 | ASS1 | Zornitza Stark Gene: ass1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.91 | ASS1 | Zornitza Stark Phenotypes for gene: ASS1 were changed from Citrullinemia, 215700 (3) to Citrullinaemia (MIM# 215700) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.90 | ASS1 | Zornitza Stark Publications for gene: ASS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.89 | ASPM | Zornitza Stark Marked gene: ASPM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.89 | ASPM | Zornitza Stark Gene: aspm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.89 | ASPM | Zornitza Stark Phenotypes for gene: ASPM were changed from Microcephaly 5, primary, autosomal recessive, 608716 (3) to Microcephaly 5, primary, autosomal recessive (MIM#608716) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.88 | ASPM | Zornitza Stark Publications for gene: ASPM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.87 | ASPA | Zornitza Stark Marked gene: ASPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.87 | ASPA | Zornitza Stark Gene: aspa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.87 | ASPA | Zornitza Stark Phenotypes for gene: ASPA were changed from Canavan disease, 271900 (3) to Canavan disease MIM#271900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.86 | ASPA | Zornitza Stark Publications for gene: ASPA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.85 | ASNS | Zornitza Stark Marked gene: ASNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.85 | ASNS | Zornitza Stark Gene: asns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.85 | ASNS | Zornitza Stark Phenotypes for gene: ASNS were changed from Asparagine synthetase deficiency, 615574 (3) to Asparagine synthetase deficiency, MIM#615574 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.84 | ASNS | Zornitza Stark Publications for gene: ASNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.83 | ASL | Zornitza Stark Marked gene: ASL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.83 | ASL | Zornitza Stark Gene: asl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.83 | ASL | Zornitza Stark Phenotypes for gene: ASL were changed from Argininosuccinic aciduria, 207900 (3) to Argininosuccinic aciduria MIM#207900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.82 | ASL | Zornitza Stark Publications for gene: ASL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.81 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.81 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.81 | ARX | Zornitza Stark Phenotypes for gene: ARX were changed from Hydranencephaly with abnormal genitalia, 300215 (3) to Epileptic encephalopathy, early infantile, 1 MIM#308350; Hydranencephaly with abnormal genitalia MIM#300215; Lissencephaly, X-linked 2 MIM#300215; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510; Proud syndrome MIM#300004 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.80 | ARX | Zornitza Stark Publications for gene: ARX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.79 | ARSB | Zornitza Stark Marked gene: ARSB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.79 | ARSB | Zornitza Stark Gene: arsb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.79 | ARSB | Zornitza Stark Phenotypes for gene: ARSB were changed from Mucopolysaccharidosis type VI (Maroteaux-Lamy), 253200 (3) to Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.78 | ARSB | Zornitza Stark Publications for gene: ARSB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.77 | ARSA | Zornitza Stark Marked gene: ARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.77 | ARSA | Zornitza Stark Gene: arsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.77 | ARSA | Zornitza Stark Phenotypes for gene: ARSA were changed from Metachromatic leukodystrophy, 250100 (3) to Metachromatic leukodystrophy, MIM# 250100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.76 | ARSA | Zornitza Stark Publications for gene: ARSA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.75 | ARL6 | Zornitza Stark Marked gene: ARL6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.75 | ARL6 | Zornitza Stark Gene: arl6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.75 | ARL6 | Zornitza Stark Phenotypes for gene: ARL6 were changed from Bardet-Biedl syndrome 3, 600151 (3) to Bardet-Biedl syndrome 3, MIM# 600151 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.74 | ARL6 | Zornitza Stark Publications for gene: ARL6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.73 | ARL13B | Zornitza Stark Marked gene: ARL13B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.73 | ARL13B | Zornitza Stark Gene: arl13b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.73 | ARL13B | Zornitza Stark Phenotypes for gene: ARL13B were changed from Joubert syndrome 8, 612291 (3) to Joubert syndrome 8, MIM# 612291 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.72 | ARL13B | Zornitza Stark Publications for gene: ARL13B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.71 | ARG1 | Zornitza Stark Marked gene: ARG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.71 | ARG1 | Zornitza Stark Gene: arg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.71 | ARG1 | Zornitza Stark Phenotypes for gene: ARG1 were changed from Argininemia, 207800 (3) to Argininemia MIM# 207800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.70 | ARG1 | Zornitza Stark Publications for gene: ARG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.69 | AQP2 | Zornitza Stark Marked gene: AQP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.69 | AQP2 | Zornitza Stark Gene: aqp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.69 | AQP2 | Zornitza Stark Phenotypes for gene: AQP2 were changed from Diabetes insipidus, nephrogenic, 125800 (3) to Diabetes insipidus, nephrogenic, type 2 MIM# 125800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.68 | AQP2 | Zornitza Stark Publications for gene: AQP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.67 | AP1S2 | Zornitza Stark Marked gene: AP1S2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.67 | AP1S2 | Zornitza Stark Gene: ap1s2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.67 | AP1S2 | Zornitza Stark Publications for gene: AP1S2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Marked gene: FOXP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Gene: foxp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Classified gene: FOXP3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Gene: foxp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Marked gene: FGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Added comment: Comment when marking as ready: Variants are missense/indels with limited other supporting information, hence Amber rating. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Gene: fga has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Classified gene: FGA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Gene: fga has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Marked gene: KPNA7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Gene: kpna7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Classified gene: KPNA7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Gene: kpna7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Marked gene: CHEK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Gene: chek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Classified gene: CHEK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Gene: chek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Marked gene: BTG4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Gene: btg4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Classified gene: BTG4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Gene: btg4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Marked gene: ASTL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Gene: astl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Classified gene: ASTL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Gene: astl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Marked gene: AIRE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Gene: aire has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Classified gene: AIRE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Gene: aire has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.66 | AMT | Zornitza Stark Marked gene: AMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.66 | AMT | Zornitza Stark Gene: amt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.66 | AMT | Zornitza Stark Phenotypes for gene: AMT were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy MIM#620398 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.65 | AMT | Zornitza Stark Publications for gene: AMT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.64 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.64 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.64 | AMPD2 | Zornitza Stark Phenotypes for gene: AMPD2 were changed from Pontocerebellar hypoplasia, type 9, 615809 (3) to Pontocerebellar hypoplasia, type 9, MIM#615809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.63 | AMPD2 | Zornitza Stark Publications for gene: AMPD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.62 | ALPL | Zornitza Stark Marked gene: ALPL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.62 | ALPL | Zornitza Stark Gene: alpl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.62 | ALPL | Zornitza Stark Phenotypes for gene: ALPL were changed from Hypophosphatasia, infantile, 241500 (3) to Hypophosphatasia, childhood (MIM#241510); Hypophosphatasia, infantile (MIM#241500) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.61 | ALPL | Zornitza Stark Publications for gene: ALPL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.60 | ALMS1 | Zornitza Stark Marked gene: ALMS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.60 | ALMS1 | Zornitza Stark Gene: alms1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.60 | ALMS1 | Zornitza Stark Phenotypes for gene: ALMS1 were changed from Alstrom syndrome, 203800 (3) to Alstrom syndrome, MIM# 203800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.59 | ALG6 | Zornitza Stark Marked gene: ALG6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.59 | ALG6 | Zornitza Stark Gene: alg6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.59 | ALG6 | Zornitza Stark Phenotypes for gene: ALG6 were changed from Congenital disorder of glycosylation, type Ic, 603147 (3) to Congenital disorder of glycosylation, type Ic, MIM#603147 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.58 | ALG6 | Zornitza Stark Publications for gene: ALG6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.57 | ALG3 | Zornitza Stark Marked gene: ALG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.57 | ALG3 | Zornitza Stark Gene: alg3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.57 | ALG3 | Zornitza Stark Phenotypes for gene: ALG3 were changed from Congenital disorder of glycosylation, type Id, 601110 (3) to Congenital disorder of glycosylation, type Id, MIM#601110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.56 | ALG3 | Zornitza Stark Publications for gene: ALG3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.55 | ALG1 | Zornitza Stark Marked gene: ALG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.55 | ALG1 | Zornitza Stark Gene: alg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.55 | ALG1 | Zornitza Stark Phenotypes for gene: ALG1 were changed from Congenital disorder of glycosylation, type Ik, 608540 (3) to Congenital disorder of glycosylation, type Ik, MIM# 608540 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.54 | ALG1 | Zornitza Stark Publications for gene: ALG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.53 | ALDOB | Zornitza Stark Marked gene: ALDOB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.53 | ALDOB | Zornitza Stark Gene: aldob has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.53 | ALDOB | Zornitza Stark Phenotypes for gene: ALDOB were changed from Fructose intolerance, 229600 (3) to Fructose intolerance, hereditary, MIM# 229600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.52 | ALDOB | Zornitza Stark Publications for gene: ALDOB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.51 | ALDH7A1 | Zornitza Stark Marked gene: ALDH7A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.51 | ALDH7A1 | Zornitza Stark Gene: aldh7a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.51 | ALDH7A1 | Zornitza Stark Phenotypes for gene: ALDH7A1 were changed from Epilepsy, pyridoxine-dependent, 266100 (3) to Epilepsy, early-onset, 4, vitamin B6-dependent MIM #266100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.50 | ALDH7A1 | Zornitza Stark Publications for gene: ALDH7A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.49 | ALDH5A1 | Zornitza Stark Marked gene: ALDH5A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.49 | ALDH5A1 | Zornitza Stark Gene: aldh5a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||