Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Dystonia and Chorea v0.130 SQSTM1 Zornitza Stark Phenotypes for gene: SQSTM1 were changed from Myopathy, distal, with rimmed vacuoles 617158 to Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145
Dystonia and Chorea v0.129 SQSTM1 Zornitza Stark reviewed gene: SQSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Brain Calcification v0.38 FARSA Zornitza Stark Marked gene: FARSA as ready
Brain Calcification v0.38 FARSA Zornitza Stark Gene: farsa has been classified as Red List (Low Evidence).
Brain Calcification v0.38 FARSA Zornitza Stark gene: FARSA was added
gene: FARSA was added to Brain Calcification. Sources: Expert list
Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FARSA were set to 31355908
Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2, MIM# 619013
Review for gene: FARSA was set to RED
Added comment: Autosomal recessive disorder characterized by growth delay, interstitial lung disease, liver disease, and abnormal brain MRI findings, including brain calcifications and periventricular cysts. Single affected individual reported, but FARSA interacts with FARSB, which causes a similar disorder.
Sources: Expert list
Mendeliome v0.4304 FARSA Zornitza Stark Marked gene: FARSA as ready
Mendeliome v0.4304 FARSA Zornitza Stark Gene: farsa has been classified as Red List (Low Evidence).
Mendeliome v0.4304 FARSA Zornitza Stark gene: FARSA was added
gene: FARSA was added to Mendeliome. Sources: Expert list
Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FARSA were set to 31355908
Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2, MIM# 619013
Review for gene: FARSA was set to RED
Added comment: Autosomal recessive disorder characterized by growth delay, interstitial lung disease, liver disease, and abnormal brain MRI findings, including brain calcifications and periventricular cysts. Single affected individual reported, but FARSA interacts with FARSB, which causes a similar disorder.
Sources: Expert list
Pulmonary Fibrosis_Interstitial Lung Disease v0.13 FARSA Zornitza Stark Marked gene: FARSA as ready
Pulmonary Fibrosis_Interstitial Lung Disease v0.13 FARSA Zornitza Stark Gene: farsa has been classified as Red List (Low Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.13 FARSA Zornitza Stark Phenotypes for gene: FARSA were changed from Rajab interstitial lung disease with brain calcifications 2 619013 to Rajab interstitial lung disease with brain calcifications 2, MIM# 619013
Pulmonary Fibrosis_Interstitial Lung Disease v0.12 FARSA Zornitza Stark gene: FARSA was added
gene: FARSA was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Literature
Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FARSA were set to 31355908
Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2 619013
Review for gene: FARSA was set to RED
Added comment: Autosomal recessive disorder characterized by growth delay, interstitial lung disease, liver disease, and abnormal brain MRI findings, including brain calcifications and periventricular cysts. Single affected individual reported, but FARSA interacts with FARSB, which causes a similar disorder.
Sources: Literature
Dystonia and Chorea v0.129 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Dystonia and Chorea v0.129 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.129 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Dystonia and Chorea v0.128 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463, 24411498; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4303 SLC1A3 Zornitza Stark Marked gene: SLC1A3 as ready
Mendeliome v0.4303 SLC1A3 Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence).
Mendeliome v0.4303 SLC1A3 Zornitza Stark Phenotypes for gene: SLC1A3 were changed from to Episodic ataxia, type 6, MIM# 612656
Mendeliome v0.4302 SLC1A3 Zornitza Stark Publications for gene: SLC1A3 were set to
Mendeliome v0.4301 SLC1A3 Zornitza Stark Mode of inheritance for gene: SLC1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4300 SLC1A3 Zornitza Stark reviewed gene: SLC1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19139306, 16116111, 29208948, 27829685; Phenotypes: Episodic ataxia, type 6, MIM# 612656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.64 SLC1A3 Zornitza Stark Marked gene: SLC1A3 as ready
Paroxysmal Dyskinesia v0.64 SLC1A3 Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.64 SLC1A3 Zornitza Stark Phenotypes for gene: SLC1A3 were changed from to Episodic ataxia, type 6, MIM# 612656
Paroxysmal Dyskinesia v0.63 SLC1A3 Zornitza Stark Publications for gene: SLC1A3 were set to
Paroxysmal Dyskinesia v0.62 SLC1A3 Zornitza Stark Mode of inheritance for gene: SLC1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.61 SLC1A3 Zornitza Stark reviewed gene: SLC1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19139306, 16116111, 29208948, 27829685; Phenotypes: Episodic ataxia, type 6, MIM# 612656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4300 ANGPT2 Zornitza Stark Marked gene: ANGPT2 as ready
Mendeliome v0.4300 ANGPT2 Zornitza Stark Gene: angpt2 has been classified as Green List (High Evidence).
Mendeliome v0.4300 ANGPT2 Zornitza Stark Classified gene: ANGPT2 as Green List (high evidence)
Mendeliome v0.4300 ANGPT2 Zornitza Stark Gene: angpt2 has been classified as Green List (High Evidence).
Mendeliome v0.4299 ANGPT2 Zornitza Stark gene: ANGPT2 was added
gene: ANGPT2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ANGPT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANGPT2 were set to https://stm.sciencemag.org/content/12/560/eaax8013
Phenotypes for gene: ANGPT2 were set to Primary lymphoedema
Review for gene: ANGPT2 was set to GREEN
Added comment: Five unrelated individuals reported with primary lymphedema and variants in this gene, together with functional data.
Sources: Literature
Mendeliome v0.4298 UBR4 Zornitza Stark changed review comment from: Episodic ataxia reported in two families, but another molecular diagnosis present in the second, so suggested as a modifier. Only one individual reported with childhood-onset progressive neurological disorder as part of a large paper proposing multiple candidate genes.; to: Episodic ataxia reported in four families, but another molecular diagnosis present in the some, so suggested as a modifier. Variants are missense, with no supportive segregation or functional data, some are present at a low level in population databases. Only one individual reported with childhood-onset progressive neurological disorder as part of a large paper proposing multiple candidate genes.
Paroxysmal Dyskinesia v0.61 UBR4 Zornitza Stark Marked gene: UBR4 as ready
Paroxysmal Dyskinesia v0.61 UBR4 Zornitza Stark Gene: ubr4 has been classified as Red List (Low Evidence).
Paroxysmal Dyskinesia v0.61 UBR4 Zornitza Stark Publications for gene: UBR4 were set to PMID 23982692 PMID 29062094
Paroxysmal Dyskinesia v0.60 UBR4 Zornitza Stark Mode of inheritance for gene: UBR4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.59 UBR4 Zornitza Stark Classified gene: UBR4 as Red List (low evidence)
Paroxysmal Dyskinesia v0.59 UBR4 Zornitza Stark Gene: ubr4 has been classified as Red List (Low Evidence).
Paroxysmal Dyskinesia v0.58 UBR4 Zornitza Stark changed review comment from: Four unrelated individuals reported with missense variants in this gene and episodic ataxia. However, no segregation or functional data to support gene-disease association, and some of the variants are present at a low frequency in population databases.; to: Four unrelated individuals reported with missense variants in this gene and episodic ataxia. However, no segregation or functional data to support gene-disease association, and some of the variants are present at a low frequency in population databases. Variants in other putative ataxia genes present in some of the individuals.
Paroxysmal Dyskinesia v0.58 UBR4 Zornitza Stark reviewed gene: UBR4: Rating: RED; Mode of pathogenicity: None; Publications: 23982692, 29062094; Phenotypes: Episodic ataxia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.58 TBC1D24 Zornitza Stark Marked gene: TBC1D24 as ready
Paroxysmal Dyskinesia v0.58 TBC1D24 Zornitza Stark Gene: tbc1d24 has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.58 TBC1D24 Zornitza Stark Phenotypes for gene: TBC1D24 were changed from Episodic dystonia (Exercise induced or without clear trigger); epilepsy; myoclonus; hearing loss to Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp, MIM# 608105; Episodic dystonia (Exercise induced or without clear trigger); epilepsy; myoclonus; hearing loss
Paroxysmal Dyskinesia v0.57 TBC1D24 Zornitza Stark Mode of inheritance for gene: TBC1D24 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Paroxysmal Dyskinesia v0.56 TBC1D24 Zornitza Stark reviewed gene: TBC1D24: Rating: GREEN; Mode of pathogenicity: None; Publications: 31257402; Phenotypes: Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp, MIM# 608105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Paroxysmal Dyskinesia v0.56 TBC1D24 Zornitza Stark Classified gene: TBC1D24 as Green List (high evidence)
Paroxysmal Dyskinesia v0.56 TBC1D24 Zornitza Stark Gene: tbc1d24 has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.55 HIBCH Zornitza Stark Marked gene: HIBCH as ready
Paroxysmal Dyskinesia v0.55 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.55 HIBCH Zornitza Stark Phenotypes for gene: HIBCH were changed from Paroxysmal dyskinesia (exercise induced or without clear trigger; isolated or with additional features; mitochondrial disorder (Leigh syndrome); neurodevelopmental disability; epilepsy. to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620; Paroxysmal dyskinesia (exercise induced or without clear trigger; isolated or with additional features; mitochondrial disorder (Leigh syndrome); neurodevelopmental disability; epilepsy.
Paroxysmal Dyskinesia v0.54 HIBCH Zornitza Stark Classified gene: HIBCH as Green List (high evidence)
Paroxysmal Dyskinesia v0.54 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.53 HIBCH Zornitza Stark reviewed gene: HIBCH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.57 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Early-onset Parkinson disease v0.57 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.57 SLC20A2 Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600
Early-onset Parkinson disease v0.56 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Early-onset Parkinson disease v0.55 SLC20A2 Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.54 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Regression v0.154 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Regression v0.154 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence).
Regression v0.154 SLC20A2 Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600
Regression v0.153 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Regression v0.152 SLC20A2 Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Regression v0.152 SLC20A2 Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Regression v0.151 SLC20A2 Zornitza Stark Classified gene: SLC20A2 as Red List (low evidence)
Regression v0.151 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence).
Regression v0.150 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: RED; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4298 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Mendeliome v0.4298 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence).
Mendeliome v0.4298 SLC20A2 Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600
Mendeliome v0.4297 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Mendeliome v0.4296 SLC20A2 Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4295 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Brain Calcification v0.37 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Brain Calcification v0.37 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence).
Brain Calcification v0.37 SLC20A2 Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600
Brain Calcification v0.36 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to
Brain Calcification v0.35 SLC20A2 Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Brain Calcification v0.34 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.53 SLC20A2 Zornitza Stark Marked gene: SLC20A2 as ready
Paroxysmal Dyskinesia v0.53 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence).
Paroxysmal Dyskinesia v0.53 SLC20A2 Zornitza Stark Phenotypes for gene: SLC20A2 were changed from Paroxysmal kinesigenic dyskinesia; Basal ganglia calcification to Basal ganglia calcification, idiopathic, 1, MIM# 213600; Paroxysmal kinesigenic dyskinesia
Paroxysmal Dyskinesia v0.52 SLC20A2 Zornitza Stark Publications for gene: SLC20A2 were set to PMID 24411498
Paroxysmal Dyskinesia v0.51 SLC20A2 Zornitza Stark Classified gene: SLC20A2 as Red List (low evidence)
Paroxysmal Dyskinesia v0.51 SLC20A2 Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence).
Paroxysmal Dyskinesia v0.50 SLC20A2 Zornitza Stark reviewed gene: SLC20A2: Rating: RED; Mode of pathogenicity: None; Publications: 22327515, 23334463, 24411498; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hereditary Spastic Paraplegia v0.116 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Hereditary Spastic Paraplegia v0.116 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v0.116 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to
Hereditary Spastic Paraplegia v0.115 SLC16A2 Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Leukodystrophy v0.174 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Leukodystrophy v0.174 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Leukodystrophy v0.174 SLC16A2 Zornitza Stark Phenotypes for gene: SLC16A2 were changed from General Leukodystrophy & Mitochondrial Leukoencephalopathy; Allan-Herndon-Dudley syndrome; Monocarboxylate transporter 8 deficiency (MCT8); Hypomyelinating Leukodystrophy & Pelizaeus-Merzbacher Disease to Allan-Herndon-Dudley syndrome, MIM# 300523; Hypomyelination
Leukodystrophy v0.173 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to
Leukodystrophy v0.172 SLC16A2 Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Leukodystrophy v0.171 SLC16A2 Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Dystonia and Chorea v0.128 SLC16A2 Zornitza Stark changed review comment from: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. Paroxysmal dystonic dyskinesia triggered by passive movements, excitement, crying reported.
Sources: Expert Review; to: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. In a recent review of 24 affected individuals (PMID 31410843), 16 presented with profound developmental delay, three had severe intellectual disability with poor language and walking with an aid, four had moderate intellectual disability with language and walking abilities, and one had mild intellectual disability with hypotonia. Overall, eight had learned to walk, all had hypotonia, 17 had spasticity, 18 had dystonia, 12 had choreoathetosis, 19 had hypomyelination, and 10 had brain atrophy. Kyphoscoliosis (n=12), seizures (n=7), and pneumopathies (n=5) were the most severe complications. Paroxysmal dystonic dyskinesia triggered by passive movements, excitement, crying is reported.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2982 SLC16A2 Zornitza Stark changed review comment from: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability.; to: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. In a recent review of 24 affected individuals (PMID 31410843), 16 presented with profound developmental delay, three had severe intellectual disability with poor language and walking with an aid, four had moderate intellectual disability with language and walking abilities, and one had mild intellectual disability with hypotonia. Overall, eight had learned to walk, all had hypotonia, 17 had spasticity, 18 had dystonia, 12 had choreoathetosis, 19 had hypomyelination, and 10 had brain atrophy. Kyphoscoliosis (n=12), seizures (n=7), and pneumopathies (n=5) were the most severe complications.
Genetic Epilepsy v0.851 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Genetic Epilepsy v0.851 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.851 SLC16A2 Zornitza Stark Phenotypes for gene: SLC16A2 were changed from to Allan-Herndon-Dudley syndrome, MIM# 300523
Genetic Epilepsy v0.850 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to
Genetic Epilepsy v0.849 SLC16A2 Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Genetic Epilepsy v0.848 SLC16A2 Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4295 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Mendeliome v0.4295 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Mendeliome v0.4295 SLC16A2 Zornitza Stark Phenotypes for gene: SLC16A2 were changed from to Allan-Herndon-Dudley syndrome, MIM# 300523
Mendeliome v0.4294 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to
Mendeliome v0.4293 SLC16A2 Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4292 SLC16A2 Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Dystonia and Chorea v0.128 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Dystonia and Chorea v0.128 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.128 SLC16A2 Zornitza Stark Classified gene: SLC16A2 as Green List (high evidence)
Dystonia and Chorea v0.128 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.127 SLC16A2 Zornitza Stark gene: SLC16A2 was added
gene: SLC16A2 was added to Dystonia - complex. Sources: Expert Review
Mode of inheritance for gene: SLC16A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SLC16A2 were set to 15980113; 31410843; 20301789
Phenotypes for gene: SLC16A2 were set to Allan-Herndon-Dudley syndrome, MIM# 300523
Review for gene: SLC16A2 was set to GREEN
Added comment: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. Paroxysmal dystonic dyskinesia triggered by passive movements, excitement, crying reported.
Sources: Expert Review
Craniosynostosis v0.136 ADAMTSL4 Zornitza Stark Marked gene: ADAMTSL4 as ready
Craniosynostosis v0.136 ADAMTSL4 Zornitza Stark Gene: adamtsl4 has been classified as Red List (Low Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.35 Zornitza Stark removed gene:TRIP13 from the panel
Mendeliome v0.4292 TRIP13 Zornitza Stark Tag founder tag was added to gene: TRIP13.
Mendeliome v0.4292 TRIP13 Zornitza Stark Phenotypes for gene: TRIP13 were changed from to Mosaic variegated aneuploidy syndrome 3, MIM# 617598; Oocyte maturation defect 9, MIM# 619011
Mendeliome v0.4291 TRIP13 Zornitza Stark Publications for gene: TRIP13 were set to
Mendeliome v0.4290 TRIP13 Zornitza Stark Mode of inheritance for gene: TRIP13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4289 TRIP13 Zornitza Stark reviewed gene: TRIP13: Rating: GREEN; Mode of pathogenicity: None; Publications: 28553959, 32473092; Phenotypes: Mosaic variegated aneuploidy syndrome 3, MIM# 617598, Oocyte maturation defect 9, MIM# 619011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.848 TRIP13 Zornitza Stark Tag founder tag was added to gene: TRIP13.
Cancer Predisposition_Paediatric v0.83 TRIP13 Zornitza Stark Tag founder tag was added to gene: TRIP13.
Cancer Predisposition_Paediatric v0.83 TRIP13 Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence)
Cancer Predisposition_Paediatric v0.83 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Cancer Predisposition_Paediatric v0.82 TRIP13 Zornitza Stark changed review comment from: Predisposition to Wilms tumour, six unrelated individuals reported.; to: Predisposition to Wilms tumour, six unrelated individuals reported. Note 5/6 families had the same variant, suggestive of founder effect.
Cancer Predisposition_Paediatric v0.82 TRIP13 Zornitza Stark edited their review of gene: TRIP13: Changed rating: AMBER
Craniosynostosis v0.136 ADAMTSL4 Bryony Thompson gene: ADAMTSL4 was added
gene: ADAMTSL4 was added to Craniosynostosis. Sources: Literature
Mode of inheritance for gene: ADAMTSL4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAMTSL4 were set to 22871183; 20702823
Phenotypes for gene: ADAMTSL4 were set to Ectopia lentis et pupillae MIM#225200
Review for gene: ADAMTSL4 was set to RED
Added comment: Two cases with craniosynostosis and the same 20 bp deletion have been repeated, but cases with the same variant in the same family have been reported with ectopia lentis only.
Sources: Literature
Mendeliome v0.4289 HSP90B2P Bryony Thompson changed review comment from: Cannot find any link to any disease at all. This is a pseudogene. It may have been included because its previous gene symbol is TRAP1; to: Cannot find any link to any disease at all. There is no OMIM entry for this pseudogene. It may have been included because its previous gene symbol is TRAP1.
Mendeliome v0.4289 HSP90B2P Bryony Thompson Marked gene: HSP90B2P as ready
Mendeliome v0.4289 HSP90B2P Bryony Thompson Gene: hsp90b2p has been classified as Red List (Low Evidence).
Mendeliome v0.4289 HSP90B2P Bryony Thompson Classified gene: HSP90B2P as Red List (low evidence)
Mendeliome v0.4289 HSP90B2P Bryony Thompson Gene: hsp90b2p has been classified as Red List (Low Evidence).
Mendeliome v0.4288 HSP90B2P Bryony Thompson reviewed gene: HSP90B2P: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown
Polymicrogyria and Schizencephaly v0.146 NEDD4L Zornitza Stark Classified gene: NEDD4L as Green List (high evidence)
Polymicrogyria and Schizencephaly v0.146 NEDD4L Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.145 NEDD4L Zornitza Stark Marked gene: NEDD4L as ready
Polymicrogyria and Schizencephaly v0.145 NEDD4L Zornitza Stark Gene: nedd4l has been removed from the panel.
Polymicrogyria and Schizencephaly v0.145 NEDD4L Zornitza Stark Phenotypes for gene: NEDD4L were changed from Periventricular nodular heterotopia; polymicrogyria; syndactyly to Periventricular nodular heterotopia 7, MIM# 617201; polymicrogyria; syndactyly
Polymicrogyria and Schizencephaly v0.144 COL4A2 Zornitza Stark Marked gene: COL4A2 as ready
Polymicrogyria and Schizencephaly v0.144 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.144 COL4A2 Zornitza Stark Phenotypes for gene: COL4A2 were changed from 614483 to Brain small vessel disease 2, MIM#614483
Polymicrogyria and Schizencephaly v0.143 COL4A2 Zornitza Stark Classified gene: COL4A2 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.143 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2982 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Intellectual disability syndromic and non-syndromic v0.2982 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2982 SLC16A2 Zornitza Stark Phenotypes for gene: SLC16A2 were changed from to Allan-Herndon-Dudley syndrome, MIM# 300523
Intellectual disability syndromic and non-syndromic v0.2981 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to
Intellectual disability syndromic and non-syndromic v0.2980 SLC16A2 Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.2979 SLC16A2 Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Paroxysmal Dyskinesia v0.50 SLC16A2 Zornitza Stark Marked gene: SLC16A2 as ready
Paroxysmal Dyskinesia v0.50 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.50 SLC16A2 Zornitza Stark Phenotypes for gene: SLC16A2 were changed from paroxysmal dyskinesia (passive movement trigger); neurodevelopmental disability, hypotonia to Allan-Herndon-Dudley syndrome, MIM# 300523; paroxysmal dyskinesia (passive movement trigger); neurodevelopmental disability, hypotonia
Paroxysmal Dyskinesia v0.49 SLC16A2 Zornitza Stark Publications for gene: SLC16A2 were set to PMID 20301789
Paroxysmal Dyskinesia v0.48 SLC16A2 Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Other to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Paroxysmal Dyskinesia v0.47 SLC16A2 Zornitza Stark Classified gene: SLC16A2 as Green List (high evidence)
Paroxysmal Dyskinesia v0.47 SLC16A2 Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.46 SLC16A2 Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Paroxysmal Dyskinesia v0.46 PDGFB Zornitza Stark Marked gene: PDGFB as ready
Paroxysmal Dyskinesia v0.46 PDGFB Zornitza Stark Gene: pdgfb has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.46 PDGFB Zornitza Stark Phenotypes for gene: PDGFB were changed from Paroxysmal nonkinesigenic dyskinesia; paroxysmal kinesigenic dyskinesia; Brain calcification to Basal ganglia calcification, idiopathic, 5, MIM# 615483; Paroxysmal nonkinesigenic dyskinesia; paroxysmal kinesigenic dyskinesia; Brain calcification
Paroxysmal Dyskinesia v0.45 PDGFB Zornitza Stark Publications for gene: PDGFB were set to PMID 28556368; PMID 32443735
Paroxysmal Dyskinesia v0.44 PDGFB Zornitza Stark Mode of inheritance for gene: PDGFB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.43 PDGFB Zornitza Stark Classified gene: PDGFB as Green List (high evidence)
Paroxysmal Dyskinesia v0.43 PDGFB Zornitza Stark Gene: pdgfb has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.42 PDGFB Zornitza Stark reviewed gene: PDGFB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23913003; Phenotypes: Basal ganglia calcification, idiopathic, 5, MIM# 615483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.142 COL4A2 Chloe Stutterd gene: COL4A2 was added
gene: COL4A2 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: COL4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL4A2 were set to 30315939
Phenotypes for gene: COL4A2 were set to 614483
Review for gene: COL4A2 was set to AMBER
Added comment: Two unrelated individuals reported with PMG.
Third unrelated family identified in MCRI study not yet published
Sources: Literature
Polymicrogyria and Schizencephaly v0.142 NEDD4L Chloe Stutterd gene: NEDD4L was added
gene: NEDD4L was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NEDD4L were set to 27694961; 28515470; 30393983
Phenotypes for gene: NEDD4L were set to Periventricular nodular heterotopia; polymicrogyria; syndactyly
Review for gene: NEDD4L was set to GREEN
Added comment: Sources: Literature
Dystonia and Chorea v0.126 OPA3 Zornitza Stark Marked gene: OPA3 as ready
Dystonia and Chorea v0.126 OPA3 Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.126 OPA3 Zornitza Stark Phenotypes for gene: OPA3 were changed from developmental delay, hypotonia; dystonia and chorea; ataxia, optic atrophy; spastic paraplegia to 3-methylglutaconic aciduria, type III, MIM# 258501; developmental delay, hypotonia; dystonia and chorea; ataxia, optic atrophy; spastic paraplegia
Dystonia and Chorea v0.125 OPA3 Zornitza Stark Publications for gene: OPA3 were set to PMID: 20301646
Dystonia and Chorea v0.124 OPA3 Zornitza Stark Classified gene: OPA3 as Green List (high evidence)
Dystonia and Chorea v0.124 OPA3 Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.123 OPA3 Zornitza Stark reviewed gene: OPA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 7510656, 2494568, 11668429; Phenotypes: 3-methylglutaconic aciduria, type III, MIM# 258501; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v0.387 DMXL2 Zornitza Stark Phenotypes for gene: DMXL2 were changed from Autosomal dominant hearing loss; autosomal recessive EE with deafness to Autosomal dominant hearing loss; Epileptic encephalopathy, early infantile, 81, MIM#618663, includes deafness
Mendeliome v0.4288 NOBOX Zornitza Stark Marked gene: NOBOX as ready
Mendeliome v0.4288 NOBOX Zornitza Stark Gene: nobox has been classified as Green List (High Evidence).
Mendeliome v0.4288 NOBOX Zornitza Stark Phenotypes for gene: NOBOX were changed from to Premature ovarian failure 5,MIM#611548
Mendeliome v0.4287 NOBOX Zornitza Stark Publications for gene: NOBOX were set to
Mendeliome v0.4286 NOBOX Zornitza Stark Mode of inheritance for gene: NOBOX was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4285 NOBOX Zornitza Stark reviewed gene: NOBOX: Rating: GREEN; Mode of pathogenicity: None; Publications: 27836978, 21837770, 25514101, 17701902, 27798098, 29067606; Phenotypes: Premature ovarian failure 5,MIM#611548; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.34 NOBOX Zornitza Stark Marked gene: NOBOX as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.34 NOBOX Zornitza Stark Gene: nobox has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.34 NOBOX Zornitza Stark Publications for gene: NOBOX were set to
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.33 NOBOX Zornitza Stark Mode of inheritance for gene: NOBOX was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Paroxysmal Dyskinesia v0.42 UBR4 Eunice Chan gene: UBR4 was added
gene: UBR4 was added to Paroxysmal Dyskinesia. Sources: Expert list
Mode of inheritance for gene: UBR4 was set to Unknown
Publications for gene: UBR4 were set to PMID 23982692 PMID 29062094
Phenotypes for gene: UBR4 were set to early onset episodic ataxia; nystagmus; myokymia; tremor
Paroxysmal Dyskinesia v0.42 TBC1D24 Eunice Chan gene: TBC1D24 was added
gene: TBC1D24 was added to Paroxysmal Dyskinesia. Sources: Expert list
Mode of inheritance for gene: TBC1D24 was set to Unknown
Publications for gene: TBC1D24 were set to PMID 31257402; PMID 31226716; PMID 25719194
Phenotypes for gene: TBC1D24 were set to Episodic dystonia (Exercise induced or without clear trigger); epilepsy; myoclonus; hearing loss
Added comment: Main phenotype with epilepsy and seizures.
Other phenotypes include paroxysmal exercise induced dyskinesia, episodic dystonia, DOORS, non-syndromic hearing loss, myoclonus
Sources: Expert list
Paroxysmal Dyskinesia v0.42 HIBCH Eunice Chan gene: HIBCH was added
gene: HIBCH was added to Paroxysmal Dyskinesia. Sources: Expert list
Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HIBCH were set to PMID 31679561
Phenotypes for gene: HIBCH were set to Paroxysmal dyskinesia (exercise induced or without clear trigger; isolated or with additional features; mitochondrial disorder (Leigh syndrome); neurodevelopmental disability; epilepsy.
Added comment: OMIM 610690
If mild phenotype, can present with PED, hyperCKaemia, hyperammoniaemia and pallidal hyperintensities on MRI
Sources: Expert list
Paroxysmal Dyskinesia v0.42 SLC20A2 Eunice Chan gene: SLC20A2 was added
gene: SLC20A2 was added to Paroxysmal Dyskinesia. Sources: Expert list
Mode of inheritance for gene: SLC20A2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SLC20A2 were set to PMID 24411498
Phenotypes for gene: SLC20A2 were set to Paroxysmal kinesigenic dyskinesia; Basal ganglia calcification
Added comment: Case report of 1 family
Sources: Expert list
Paroxysmal Dyskinesia v0.42 SLC16A2 Eunice Chan gene: SLC16A2 was added
gene: SLC16A2 was added to Paroxysmal Dyskinesia. Sources: Expert list
Mode of inheritance for gene: SLC16A2 was set to Other
Publications for gene: SLC16A2 were set to PMID 20301789
Phenotypes for gene: SLC16A2 were set to paroxysmal dyskinesia (passive movement trigger); neurodevelopmental disability, hypotonia
Added comment: X-linked inheritance
Allan-Herndon-Dudley Syndrome
paroxysmal dystonic dyskinesia triggered by poassive movements, excitement, crying
High fT3 also characteristic
Please also include on dystonia-Complex panel
Sources: Expert list
Paroxysmal Dyskinesia v0.42 PDGFB Eunice Chan reviewed gene: PDGFB: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Paroxysmal Dyskinesia v0.42 PDGFB Eunice Chan gene: PDGFB was added
gene: PDGFB was added to Paroxysmal Dyskinesia. Sources: Expert list
Mode of inheritance for gene: PDGFB was set to Unknown
Publications for gene: PDGFB were set to PMID 28556368; PMID 32443735
Phenotypes for gene: PDGFB were set to Paroxysmal nonkinesigenic dyskinesia; paroxysmal kinesigenic dyskinesia; Brain calcification
Dystonia and Chorea v0.123 OPA3 Eunice Chan gene: OPA3 was added
gene: OPA3 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: OPA3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OPA3 were set to PMID: 20301646
Phenotypes for gene: OPA3 were set to developmental delay, hypotonia; dystonia and chorea; ataxia, optic atrophy; spastic paraplegia
Added comment: Costeff syndrome, most patients are Iraqi-Jewish ancestry
Sources: Expert list
Deafness_IsolatedAndComplex v0.386 DMXL2 Chern Lim reviewed gene: DMXL2: Rating: ; Mode of pathogenicity: None; Publications: 30732576, 27657680; Phenotypes: Epileptic encephalopathy, early infantile, 81, MIM#618663, Autosomal recessive; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Dystonia and Chorea v0.123 SETX Zornitza Stark Marked gene: SETX as ready
Dystonia and Chorea v0.123 SETX Zornitza Stark Gene: setx has been classified as Green List (High Evidence).
Dystonia and Chorea v0.123 SETX Zornitza Stark Classified gene: SETX as Green List (high evidence)
Dystonia and Chorea v0.123 SETX Zornitza Stark Gene: setx has been classified as Green List (High Evidence).
Dystonia and Chorea v0.122 SETX Zornitza Stark gene: SETX was added
gene: SETX was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: SETX was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SETX were set to 19696032
Phenotypes for gene: SETX were set to Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM# 606002
Review for gene: SETX was set to GREEN
Added comment: Dystonia was present in around 13% in a cohort of 90 affected individuals.
Sources: Expert list
Dystonia and Chorea v0.121 PSEN1 Zornitza Stark Marked gene: PSEN1 as ready
Dystonia and Chorea v0.121 PSEN1 Zornitza Stark Gene: psen1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.121 PSEN1 Zornitza Stark Phenotypes for gene: PSEN1 were changed from Frontotemporal dementia; Dystonia to Frontotemporal dementia, MIM# 600274; Dystonia
Dystonia and Chorea v0.120 PSEN1 Zornitza Stark Classified gene: PSEN1 as Green List (high evidence)
Dystonia and Chorea v0.120 PSEN1 Zornitza Stark Gene: psen1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.119 PSEN1 Zornitza Stark changed review comment from: Variants in this gene are typically associated with Alzheimer's disease and other dementias. One case report of a primary presentation with Parkinsonism-dystonia, later complicated by dementia.; to: Variants in this gene are typically associated with Alzheimer's disease and other dementias but there are reports of complex movement disorders preceding or as part of dementia presentations.
Dystonia and Chorea v0.119 PSEN1 Zornitza Stark edited their review of gene: PSEN1: Changed rating: GREEN; Changed publications: 12810495, 15159497, 29316780, 28664294
Dystonia and Chorea v0.119 PSEN1 Zornitza Stark Classified gene: PSEN1 as Red List (low evidence)
Dystonia and Chorea v0.119 PSEN1 Zornitza Stark Gene: psen1 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.118 PSEN1 Zornitza Stark reviewed gene: PSEN1: Rating: RED; Mode of pathogenicity: None; Publications: 28664294; Phenotypes: Dementia, frontotemporal, MIM# 600274; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia and Chorea v0.118 POLR3A Zornitza Stark Marked gene: POLR3A as ready
Dystonia and Chorea v0.118 POLR3A Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence).
Dystonia and Chorea v0.118 POLR3A Zornitza Stark Classified gene: POLR3A as Green List (high evidence)
Dystonia and Chorea v0.118 POLR3A Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence).
Dystonia and Chorea v0.117 POLR3A Zornitza Stark gene: POLR3A was added
gene: POLR3A was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: POLR3A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLR3A were set to 32600288; 32373668; 31940116; 31932101; 29618326
Phenotypes for gene: POLR3A were set to Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; Striatal abnormalities; Dystonia
Review for gene: POLR3A was set to GREEN
Added comment: Multiple individuals reported where dystonia is part of the phenotype. Some of these have had hypomyelinating leukodystrophy, whereas others have had very prominent striatal abnormalities on MRI, in the absence of white matter changes. It is unclear whether this represents a continuum or a separate disorder.
Sources: Expert list
Dystonia and Chorea v0.116 PNKP Zornitza Stark Marked gene: PNKP as ready
Dystonia and Chorea v0.116 PNKP Zornitza Stark Gene: pnkp has been classified as Green List (High Evidence).
Dystonia and Chorea v0.116 PNKP Zornitza Stark Classified gene: PNKP as Green List (high evidence)
Dystonia and Chorea v0.116 PNKP Zornitza Stark Gene: pnkp has been classified as Green List (High Evidence).
Dystonia and Chorea v0.115 PNKP Zornitza Stark gene: PNKP was added
gene: PNKP was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: PNKP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PNKP were set to 28552035; 25728773
Phenotypes for gene: PNKP were set to Ataxia-oculomotor apraxia 4, MIM# 616267
Review for gene: PNKP was set to GREEN
Added comment: Dystonia is part of this complex neurological phenotype, which also includes ataxia, oculomotor apraxia and peripheral neuropathy.
Sources: Expert list
Dystonia and Chorea v0.114 PDGFRB Zornitza Stark Marked gene: PDGFRB as ready
Dystonia and Chorea v0.114 PDGFRB Zornitza Stark Gene: pdgfrb has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.114 PDGFRB Zornitza Stark Phenotypes for gene: PDGFRB were changed from Dystonia; Basal ganglia calcification, idiopathic, 4 615007 to Basal ganglia calcification, idiopathic, 4, MIM# 615007
Dystonia and Chorea v0.113 PDGFRB Zornitza Stark Publications for gene: PDGFRB were set to
Dystonia and Chorea v0.112 PDGFRB Zornitza Stark Classified gene: PDGFRB as Red List (low evidence)
Dystonia and Chorea v0.112 PDGFRB Zornitza Stark Gene: pdgfrb has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.111 PDGFRB Zornitza Stark reviewed gene: PDGFRB: Rating: RED; Mode of pathogenicity: None; Publications: 24518837; Phenotypes: Basal ganglia calcification, idiopathic, MIM#4 615007; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4285 Zornitza Stark removed gene:DNAJC7 from the panel
Motor Neurone Disease v0.54 DNAJC7 Zornitza Stark reviewed gene: DNAJC7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: amyotrophic lateral sclerosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Incidentalome v0.35 DNAJC7 Zornitza Stark Marked gene: DNAJC7 as ready
Incidentalome v0.35 DNAJC7 Zornitza Stark Gene: dnajc7 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.35 DNAJC7 Zornitza Stark Classified gene: DNAJC7 as Amber List (moderate evidence)
Incidentalome v0.35 DNAJC7 Zornitza Stark Gene: dnajc7 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.34 DNAJC7 Zornitza Stark gene: DNAJC7 was added
gene: DNAJC7 was added to Incidentalome. Sources: Literature
Mode of inheritance for gene: DNAJC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DNAJC7 were set to 31768050
Phenotypes for gene: DNAJC7 were set to amyotrophic lateral sclerosis
Review for gene: DNAJC7 was set to AMBER
Added comment: Two cohort studies in ALS patients identified 11 and 1 patient, respectively, with variants in DNAJC7. Seven of these are putative PTVs. No segregation or functional data. A small number of individuals with LOF variants are present in gnomad albeit less than expected. Given these are cohort studies, and an adult-onset condition, potentially of variable penetrance, we have taken a cautious approach and rated Amber for now.
Sources: Literature
Mendeliome v0.4284 TET2 Zornitza Stark Phenotypes for gene: TET2 were changed from Dementia; Lymphoma/myeloid malignancy to Dementia; Lymphoma/myeloid malignancy; Immunodeficiency
Mendeliome v0.4283 TET2 Zornitza Stark Mode of inheritance for gene: TET2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4282 TET2 Zornitza Stark Classified gene: TET2 as Green List (high evidence)
Mendeliome v0.4282 TET2 Zornitza Stark Gene: tet2 has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 NOBOX Ee Ming Wong edited their review of gene: NOBOX: Changed publications: PMIDs: 27836978, 21837770, 25514101, 17701902, 27798098, 29067606; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 NOBOX Ee Ming Wong changed review comment from: - Missense and PTC variants have been identified in > 3 unrelated women diagnosed with POI from different studies
- The vast majority of variants are heterozygous, with only one homozygous variant reported in 1 individual with primary amenorrhea and serum FSH level significantly exceeding the threshold value (PMID: 27836978)
- Loss of Function has been clearly demonstrated, while dominant negative effect has also been suggested although there is currently limited evidence (PMID: 17701902)
- Individuals carrying the same variant can have heterogeneous clinical presentations; to: - Missense and PTC variants have been identified in > 3 unrelated women diagnosed with POI from different studies
- The vast majority of variants are heterozygous, with limited reports of homozygous variants (PMID: 27836978; 29067606)
- Loss of Function has been clearly demonstrated, while dominant negative effect has also been suggested although there is currently limited evidence (PMID: 17701902)
- Individuals carrying the same variant can have heterogeneous clinical presentations
Intellectual disability syndromic and non-syndromic v0.2979 HECW2 Zornitza Stark Marked gene: HECW2 as ready
Intellectual disability syndromic and non-syndromic v0.2979 HECW2 Zornitza Stark Gene: hecw2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2979 HECW2 Zornitza Stark Phenotypes for gene: HECW2 were changed from to Neurodevelopmental disorder with hypotonia, seizures, and absent language (MIM#617268)
Intellectual disability syndromic and non-syndromic v0.2978 HECW2 Zornitza Stark Publications for gene: HECW2 were set to
Intellectual disability syndromic and non-syndromic v0.2977 HECW2 Zornitza Stark Mode of inheritance for gene: HECW2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 NOBOX Ee Ming Wong reviewed gene: NOBOX: Rating: GREEN; Mode of pathogenicity: None; Publications: PMIDs: 27836978, 21837770, 25514101, 17701902, 27798098; Phenotypes: Premature ovarian failure 5, 611548, AD (more commonly referred to as Premature ovarian insufficiency (POI) in the literature); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Motor Neurone Disease v0.54 NEK1 Bryony Thompson Marked gene: NEK1 as ready
Motor Neurone Disease v0.54 NEK1 Bryony Thompson Gene: nek1 has been classified as Green List (High Evidence).
Motor Neurone Disease v0.54 NEK1 Bryony Thompson Classified gene: NEK1 as Green List (high evidence)
Motor Neurone Disease v0.54 NEK1 Bryony Thompson Gene: nek1 has been classified as Green List (High Evidence).
Motor Neurone Disease v0.53 NEK1 Bryony Thompson gene: NEK1 was added
gene: NEK1 was added to Motor Neuron Disease. Sources: Literature
Mode of inheritance for gene: NEK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NEK1 were set to 31768050; 26945885; 27455347; 29929116
Phenotypes for gene: NEK1 were set to Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892
Review for gene: NEK1 was set to GREEN
Added comment: Exome-wide significant burden of heterozygous loss-of-function identified in ALS case-control studies that is replicated in both familial and simplex cohorts. Segregation of a PTV reported in 2 affected first-degree relatives in a single family. A loss-of-function mutation induces DNA damage accumulation in ALS patient-derived motoneurons.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2976 HECW2 Teresa Zhao reviewed gene: HECW2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27389779; Phenotypes: Neurodevelopmental disorder with hypotonia, seizures, and absent language (MIM#617268); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4281 TLR7 Zornitza Stark Marked gene: TLR7 as ready
Mendeliome v0.4281 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Mendeliome v0.4281 TLR7 Zornitza Stark Phenotypes for gene: TLR7 were changed from to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051
Mendeliome v0.4280 TLR7 Zornitza Stark Publications for gene: TLR7 were set to
Mendeliome v0.4279 TLR7 Zornitza Stark Mode of inheritance for gene: TLR7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Susceptibility to Viral Infections v0.68 TLR7 Zornitza Stark Mode of inheritance for gene: TLR7 was changed from BIALLELIC, autosomal or pseudoautosomal to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Susceptibility to Viral Infections v0.67 TLR7 Zornitza Stark edited their review of gene: TLR7: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Callosome v0.215 NR2F1 Zornitza Stark Marked gene: NR2F1 as ready
Callosome v0.215 NR2F1 Zornitza Stark Gene: nr2f1 has been classified as Red List (Low Evidence).
Callosome v0.215 NR2F1 Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722
Callosome v0.214 NR2F1 Zornitza Stark Publications for gene: NR2F1 were set to
Callosome v0.213 NR2F1 Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.212 NR2F1 Zornitza Stark Classified gene: NR2F1 as Red List (low evidence)
Callosome v0.212 NR2F1 Zornitza Stark Gene: nr2f1 has been classified as Red List (Low Evidence).
Callosome v0.211 NR2F1 Zornitza Stark reviewed gene: NR2F1: Rating: RED; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.211 EXOSC5 Zornitza Stark Marked gene: EXOSC5 as ready
Callosome v0.211 EXOSC5 Zornitza Stark Gene: exosc5 has been classified as Red List (Low Evidence).
Callosome v0.211 EXOSC5 Zornitza Stark Phenotypes for gene: EXOSC5 were changed from to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia
Callosome v0.210 EXOSC5 Zornitza Stark Publications for gene: EXOSC5 were set to
Callosome v0.209 EXOSC5 Zornitza Stark Classified gene: EXOSC5 as Red List (low evidence)
Callosome v0.209 EXOSC5 Zornitza Stark Gene: exosc5 has been classified as Red List (Low Evidence).
Callosome v0.208 EXOSC5 Zornitza Stark reviewed gene: EXOSC5: Rating: RED; Mode of pathogenicity: None; Publications: 32504085, 29302074; Phenotypes: Short stature, Motor developmental delays, Cerebellar hypoplasia, Ataxia; Mode of inheritance: None
Ataxia v0.225 EXOSC5 Zornitza Stark Marked gene: EXOSC5 as ready
Ataxia v0.225 EXOSC5 Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence).
Ataxia v0.225 EXOSC5 Zornitza Stark Classified gene: EXOSC5 as Green List (high evidence)
Ataxia v0.225 EXOSC5 Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence).
Ataxia v0.224 EXOSC5 Zornitza Stark gene: EXOSC5 was added
gene: EXOSC5 was added to Ataxia - paediatric. Sources: Literature
Mode of inheritance for gene: EXOSC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EXOSC5 were set to 32504085; 29302074
Phenotypes for gene: EXOSC5 were set to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia
Review for gene: EXOSC5 was set to GREEN
Added comment: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient. Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively. A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5.

- PMID: 29302074 (2019) - Three sibs with a homozygous EXOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken.
Sources: Literature
Cerebellar and Pontocerebellar Hypoplasia v0.150 EXOSC5 Zornitza Stark Phenotypes for gene: EXOSC5 were changed from Developmental delays, short stature, cerebellar hypoplasia and motor weakness to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia
Cerebellar and Pontocerebellar Hypoplasia v0.149 EXOSC5 Zornitza Stark Classified gene: EXOSC5 as Green List (high evidence)
Cerebellar and Pontocerebellar Hypoplasia v0.149 EXOSC5 Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence).
Cerebellar and Pontocerebellar Hypoplasia v0.148 EXOSC5 Zornitza Stark Deleted their comment
Cerebellar and Pontocerebellar Hypoplasia v0.148 EXOSC5 Zornitza Stark edited their review of gene: EXOSC5: Added comment: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient.
Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively.

A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5.

- PMID: 29302074 (2019) - Three sibs with a homozygous EXOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken.; Changed rating: GREEN; Changed publications: 32504085, 29302074; Changed phenotypes: Short stature, Motor developmental delays, Cerebellar hypoplasia, Ataxia; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4278 EXOSC5 Zornitza Stark Marked gene: EXOSC5 as ready
Mendeliome v0.4278 EXOSC5 Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence).
Mendeliome v0.4278 EXOSC5 Zornitza Stark Phenotypes for gene: EXOSC5 were changed from to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia
Mendeliome v0.4277 EXOSC5 Zornitza Stark Publications for gene: EXOSC5 were set to
Mendeliome v0.4276 EXOSC5 Zornitza Stark Mode of inheritance for gene: EXOSC5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4275 EXOSC5 Arina Puzriakova changed review comment from: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXCOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient.
Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively.

A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5.

- PMID: 29302074 (2019) - Three sibs with a homozygous EXCOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken.; to: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient.
Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively.

A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5.

- PMID: 29302074 (2019) - Three sibs with a homozygous EXOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken.
Mendeliome v0.4275 EXOSC5 Arina Puzriakova reviewed gene: EXOSC5: Rating: ; Mode of pathogenicity: None; Publications: 32504085, 29302074; Phenotypes: Short stature, Motor developmental delays, Cerebellar hypoplasia, Ataxia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.11 TMEM173 Zornitza Stark Marked gene: TMEM173 as ready
Pulmonary Fibrosis_Interstitial Lung Disease v0.11 TMEM173 Zornitza Stark Gene: tmem173 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.11 TMEM173 Zornitza Stark Classified gene: TMEM173 as Green List (high evidence)
Pulmonary Fibrosis_Interstitial Lung Disease v0.11 TMEM173 Zornitza Stark Gene: tmem173 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.10 TMEM173 Zornitza Stark gene: TMEM173 was added
gene: TMEM173 was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Expert Review
Mode of inheritance for gene: TMEM173 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM173 were set to 27613991; 32398023
Phenotypes for gene: TMEM173 were set to STING-associated vasculopathy, infantile-onset, MIM# 615934
Review for gene: TMEM173 was set to GREEN
Added comment: Four individuals reported with severe interstitial lung disease in the setting of STING-associated vasculopathy.
Sources: Expert Review
Mendeliome v0.4275 SLC20A1 Zornitza Stark Marked gene: SLC20A1 as ready
Mendeliome v0.4275 SLC20A1 Zornitza Stark Gene: slc20a1 has been classified as Green List (High Evidence).
Mendeliome v0.4275 SLC20A1 Zornitza Stark Phenotypes for gene: SLC20A1 were changed from to Bladder-Exstrophy-Epispadias Complex (BEEC)
Mendeliome v0.4274 SLC20A1 Zornitza Stark Publications for gene: SLC20A1 were set to
Mendeliome v0.4273 SLC20A1 Zornitza Stark Mode of inheritance for gene: SLC20A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4272 SLC20A1 Zornitza Stark reviewed gene: SLC20A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32850778, 27013921; Phenotypes: Bladder-Exstrophy-Epispadias Complex (BEEC); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mitochondrial disease v0.484 PNPLA8 Zornitza Stark Marked gene: PNPLA8 as ready
Mitochondrial disease v0.484 PNPLA8 Zornitza Stark Gene: pnpla8 has been classified as Green List (High Evidence).
Mitochondrial disease v0.484 PNPLA8 Zornitza Stark Phenotypes for gene: PNPLA8 were changed from to Mitochondrial myopathy with lactic acidosis (MIM#251950), AR
Mitochondrial disease v0.483 PNPLA8 Zornitza Stark Publications for gene: PNPLA8 were set to
Mitochondrial disease v0.482 PNPLA8 Zornitza Stark Mode of inheritance for gene: PNPLA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.481 PNPLA8 Zornitza Stark reviewed gene: PNPLA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681094, 25512002; Phenotypes: Mitochondrial myopathy with lactic acidosis (MIM#251950), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4272 PNPLA8 Zornitza Stark Marked gene: PNPLA8 as ready
Mendeliome v0.4272 PNPLA8 Zornitza Stark Gene: pnpla8 has been classified as Green List (High Evidence).
Mendeliome v0.4272 PNPLA8 Zornitza Stark Phenotypes for gene: PNPLA8 were changed from to Mitochondrial myopathy with lactic acidosis (MIM#251950), AR
Mendeliome v0.4271 PNPLA8 Zornitza Stark Publications for gene: PNPLA8 were set to
Mendeliome v0.4270 PNPLA8 Zornitza Stark Mode of inheritance for gene: PNPLA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4269 NR2F1 Zornitza Stark Marked gene: NR2F1 as ready
Mendeliome v0.4269 NR2F1 Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence).
Mendeliome v0.4269 NR2F1 Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722
Mendeliome v0.4268 NR2F1 Zornitza Stark Publications for gene: NR2F1 were set to
Mendeliome v0.4267 NR2F1 Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Optic Atrophy v0.117 NR2F1 Zornitza Stark Marked gene: NR2F1 as ready
Optic Atrophy v0.117 NR2F1 Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence).
Optic Atrophy v0.117 NR2F1 Zornitza Stark Publications for gene: NR2F1 were set to
Optic Atrophy v0.116 NR2F1 Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722
Optic Atrophy v0.115 NR2F1 Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Optic Atrophy v0.114 NR2F1 Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Autism v0.114 NR2F1 Zornitza Stark Marked gene: NR2F1 as ready
Autism v0.114 NR2F1 Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence).
Autism v0.114 NR2F1 Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722
Mendeliome v0.4266 NR2F1 Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2976 NR2F1 Zornitza Stark Marked gene: NR2F1 as ready
Intellectual disability syndromic and non-syndromic v0.2976 NR2F1 Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence).
Autism v0.113 NR2F1 Zornitza Stark Publications for gene: NR2F1 were set to
Autism v0.112 NR2F1 Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Autism v0.111 NR2F1 Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2976 NR2F1 Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722
Intellectual disability syndromic and non-syndromic v0.2975 NR2F1 Zornitza Stark Publications for gene: NR2F1 were set to
Intellectual disability syndromic and non-syndromic v0.2974 NR2F1 Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2973 NR2F1 Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Chromosome Breakage Disorders v0.23 RAD50 Zornitza Stark Marked gene: RAD50 as ready
Chromosome Breakage Disorders v0.23 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Mendeliome v0.4266 RAD50 Zornitza Stark Marked gene: RAD50 as ready
Mendeliome v0.4266 RAD50 Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence).
Chromosome Breakage Disorders v0.23 RAD50 Zornitza Stark Phenotypes for gene: RAD50 were changed from to Nijmegen breakage syndrome-like disorder, MIM# 613078
Mendeliome v0.4266 RAD50 Zornitza Stark Phenotypes for gene: RAD50 were changed from to Nijmegen breakage syndrome-like disorder, MIM# 613078
Mendeliome v0.4265 RAD50 Zornitza Stark Publications for gene: RAD50 were set to
Mendeliome v0.4264 RAD50 Zornitza Stark Mode of inheritance for gene: RAD50 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Chromosome Breakage Disorders v0.22 RAD50 Zornitza Stark Publications for gene: RAD50 were set to
Mendeliome v0.4263 RAD50 Zornitza Stark reviewed gene: RAD50: Rating: GREEN; Mode of pathogenicity: None; Publications: 19409520, 32212377; Phenotypes: Nijmegen breakage syndrome-like disorder, MIM# 613078; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Chromosome Breakage Disorders v0.21 RAD50 Zornitza Stark Mode of inheritance for gene: RAD50 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Chromosome Breakage Disorders v0.20 RAD50 Zornitza Stark reviewed gene: RAD50: Rating: GREEN; Mode of pathogenicity: None; Publications: 19409520, 32212377; Phenotypes: Nijmegen breakage syndrome-like disorder, MIM# 613078; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4263 KMT2D Zornitza Stark Publications for gene: KMT2D were set to 31949313
Mendeliome v0.4262 KMT2D Zornitza Stark edited their review of gene: KMT2D: Added comment: Four further individuals with KMT2D-associated neurodevelopmental syndrome reported. Features include: athelia (absent nipples), choanal atresia, hypoparathyroidism, delayed or absent pubertal development, and extreme short stature. Two of the four individuals had severe interstitial lung disease.; Changed publications: 31949313, 32083401
Intellectual disability syndromic and non-syndromic v0.2973 HSPA9 Zornitza Stark Marked gene: HSPA9 as ready
Intellectual disability syndromic and non-syndromic v0.2973 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2973 HSPA9 Zornitza Stark Phenotypes for gene: HSPA9 were changed from OMIM 616854; skeletal anomalies; congenital cardiac and renal anom to Even-plus syndrome, OMIM 616854; skeletal anomalies; congenital cardiac and renal anom
Intellectual disability syndromic and non-syndromic v0.2972 HSPA9 Sue White Classified gene: HSPA9 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2972 HSPA9 Sue White Gene: hspa9 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2971 HSPA9 Sue White commented on gene: HSPA9: 2 patients with dev delay in 5 published patients with Even-plus syndrome
Intellectual disability syndromic and non-syndromic v0.2971 HSPA9 Sue White gene: HSPA9 was added
gene: HSPA9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSPA9 were set to 32869452; 26598328
Phenotypes for gene: HSPA9 were set to OMIM 616854; skeletal anomalies; congenital cardiac and renal anom
Penetrance for gene: HSPA9 were set to Complete
Review for gene: HSPA9 was set to AMBER
Added comment: Sources: Literature
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 HSPA9 Zornitza Stark Marked gene: HSPA9 as ready
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 HSPA9 Zornitza Stark Classified gene: HSPA9 as Green List (high evidence)
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Congenital anomalies of the kidney and urinary tract (CAKUT) v0.67 HSPA9 Zornitza Stark gene: HSPA9 was added
gene: HSPA9 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Literature
Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSPA9 were set to 26598328; 32869452
Phenotypes for gene: HSPA9 were set to Even-plus syndrome, MIM# 616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose
Review for gene: HSPA9 was set to GREEN
Added comment: Biallelic variants in 4 individuals from 5 families. Significant skeletal features and marked nasal hypoplasia with mid-face hypoplasia. 2/5 with developmental delay and abnormalities of the corpus callosum 4/5 with congenital heart disease
Sources: Literature
Congenital Heart Defect v0.66 HSPA9 Zornitza Stark Marked gene: HSPA9 as ready
Congenital Heart Defect v0.66 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.66 HSPA9 Zornitza Stark Phenotypes for gene: HSPA9 were changed from https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose to Even-plus syndrome, MIM# 616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose
Achromatopsia v0.21 Sue White removed gene:HSPA9 from the panel
Congenital Heart Defect v0.65 HSPA9 Zornitza Stark Classified gene: HSPA9 as Green List (high evidence)
Congenital Heart Defect v0.65 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Mendeliome v0.4262 CFAP58 Zornitza Stark Phenotypes for gene: CFAP58 were changed from Multiple morphological abnormalities of the sperm flagella (MMAF) (PMID: 32791035) to Multiple morphological abnormalities of the sperm flagella (MMAF)
Mendeliome v0.4261 CFAP58 Zornitza Stark Marked gene: CFAP58 as ready
Mendeliome v0.4261 CFAP58 Zornitza Stark Gene: cfap58 has been classified as Green List (High Evidence).
Mendeliome v0.4261 CFAP58 Zornitza Stark Classified gene: CFAP58 as Green List (high evidence)
Mendeliome v0.4261 CFAP58 Zornitza Stark Gene: cfap58 has been classified as Green List (High Evidence).
Mendeliome v0.4260 WASHC4 Zornitza Stark Marked gene: WASHC4 as ready
Mendeliome v0.4260 WASHC4 Zornitza Stark Gene: washc4 has been classified as Green List (High Evidence).
Mendeliome v0.4260 WASHC4 Zornitza Stark Classified gene: WASHC4 as Green List (high evidence)
Mendeliome v0.4260 WASHC4 Zornitza Stark Gene: washc4 has been classified as Green List (High Evidence).
Mendeliome v0.4259 WASHC4 Zornitza Stark gene: WASHC4 was added
gene: WASHC4 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: WASHC4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WASHC4 were set to 31953988; 21498477
Phenotypes for gene: WASHC4 were set to Mental retardation, autosomal recessive 43, MIM #615817
Review for gene: WASHC4 was set to GREEN
Added comment: Three unrelated families reported.
Sources: Literature
Mendeliome v0.4258 DNAJC7 Seb Lunke Marked gene: DNAJC7 as ready
Mendeliome v0.4258 DNAJC7 Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4258 DNAJC7 Seb Lunke Classified gene: DNAJC7 as Amber List (moderate evidence)
Mendeliome v0.4258 DNAJC7 Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2970 WASHC4 Zornitza Stark reviewed gene: WASHC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4257 DNAJC7 Seb Lunke gene: DNAJC7 was added
gene: DNAJC7 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: DNAJC7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DNAJC7 were set to 31768050
Phenotypes for gene: DNAJC7 were set to amyotrophic lateral sclerosis
Review for gene: DNAJC7 was set to AMBER
Added comment: Two cohort studies in ALS patients identified 11 and 1 patient, respectively, with variants in DNAJC7. Seven of these are putative PTVs. However gene described as risk factor, unclear why.

DOI: https://doi.org/10.1212/NXG.0000000000000503
Sources: Literature
Motor Neurone Disease v0.52 DNAJC7 Seb Lunke Marked gene: DNAJC7 as ready
Motor Neurone Disease v0.52 DNAJC7 Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence).
Motor Neurone Disease v0.52 DNAJC7 Seb Lunke Classified gene: DNAJC7 as Amber List (moderate evidence)
Motor Neurone Disease v0.52 DNAJC7 Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2970 WASHC4 Alison Yeung Classified gene: WASHC4 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.2970 WASHC4 Alison Yeung Gene: washc4 has been classified as Green List (High Evidence).
Motor Neurone Disease v0.51 DNAJC7 Seb Lunke gene: DNAJC7 was added
gene: DNAJC7 was added to Motor Neuron Disease. Sources: Literature
Mode of inheritance for gene: DNAJC7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DNAJC7 were set to 31768050
Phenotypes for gene: DNAJC7 were set to amyotrophic lateral sclerosis
Review for gene: DNAJC7 was set to AMBER
Added comment: Two cohort studies in ALS patients identified 11 and 1 patient, respectively, with variants in DNAJC7. Seven of these are putative PTVs. However gene described as risk factor, unclear why.

DOI: https://doi.org/10.1212/NXG.0000000000000503
Sources: Literature
Macrocephaly_Megalencephaly v0.49 MYT1L Zornitza Stark Marked gene: MYT1L as ready
Macrocephaly_Megalencephaly v0.49 MYT1L Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.49 MYT1L Zornitza Stark Phenotypes for gene: MYT1L were changed from intellectual disability; macrocephaly; epilepsy; autism to intellectual disability; macrocephaly; epilepsy; autism; Mental retardation, autosomal dominant 39, MIM# 616521
Mendeliome v0.4256 SVIL Melanie Marty Deleted their comment
Intellectual disability syndromic and non-syndromic v0.2969 WASHC4 Alison Yeung Deleted their comment
Mendeliome v0.4256 SVIL Melanie Marty edited their review of gene: SVIL: Added comment: Four patients from two unrelated consanguineous families with a childhood/adolescence onset of a myopathy associated with homozygous loss-of-function mutations in SVIL. Wide neck, anteverted shoulders and prominent trapezius muscles together with variable contractures were characteristic features. Functional studies on muscle biopsies showed complete loss protein in muscle fibres by western blot.; Changed rating: AMBER
Mendeliome v0.4256 CFAP58 Crystle Lee edited their review of gene: CFAP58: Added comment: Biallelic variants reported in 5 unrelated males with nultiple morphological abnormalities of the sperm flagella (MMAF). Knockout mice were infertile.; Changed rating: GREEN; Changed publications: 32791035; Changed phenotypes: Multiple morphological abnormalities of the sperm flagella (MMAF) (PMID: 32791035); Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Macrocephaly_Megalencephaly v0.48 MYT1L Natasha Brown Classified gene: MYT1L as Green List (high evidence)
Macrocephaly_Megalencephaly v0.48 MYT1L Natasha Brown Gene: myt1l has been classified as Green List (High Evidence).
Congenital Heart Defect v0.62 HSPA9 Sue White gene: HSPA9 was added
gene: HSPA9 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSPA9 were set to 26598328; 32869452
Phenotypes for gene: HSPA9 were set to https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose
Review for gene: HSPA9 was set to GREEN
Added comment: Biallelic variants in 4 individuals from 5 families. Significant skeletal features and marked nasal hypoplasia with mid-face hypoplasia.
2/5 with developmental delay and abnormalities of the corpus callosum
4/5 with congenital heart disease
Sources: Literature
Congenital Heart Defect v0.62 HSPA9 Sue White gene: HSPA9 was added
gene: HSPA9 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSPA9 were set to 26598328; 32869452
Phenotypes for gene: HSPA9 were set to https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose
Review for gene: HSPA9 was set to GREEN
Added comment: Biallelic variants in 4 individuals from 5 families. Significant skeletal features and marked nasal hypoplasia with mid-face hypoplasia.
2/5 with developmental delay and abnormalities of the corpus callosum
4/5 with congenital heart disease
Sources: Literature
Macrocephaly_Megalencephaly v0.47 MYT1L Natasha Brown gene: MYT1L was added
gene: MYT1L was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: MYT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYT1L were set to (PMID: 32065501)
Phenotypes for gene: MYT1L were set to intellectual disability; macrocephaly; epilepsy; autism
Review for gene: MYT1L was set to GREEN
Added comment: Over 50 individuals reported with deletions and SNVs affecting MYT1L, and variable phenotype comprising intellectual disability, obesity, and behavioral problems. 66% in a recent cohort had seizures. 13% had macrocephaly
Sources: Literature
Autism v0.111 MYT1L Zornitza Stark Marked gene: MYT1L as ready
Autism v0.111 MYT1L Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence).
Autism v0.111 MYT1L Zornitza Stark Phenotypes for gene: MYT1L were changed from to Mental retardation, autosomal dominant 39, MIM# 616521
Mendeliome v0.4256 CFAP58 Crystle Lee commented on gene: CFAP58
Mendeliome v0.4256 CFAP58 Crystle Lee Deleted their review
Autism v0.110 MYT1L Zornitza Stark Tag SV/CNV tag was added to gene: MYT1L.
Intellectual disability syndromic and non-syndromic v0.2969 WASHC4 Alison Yeung reviewed gene: WASHC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 31953988; Phenotypes: Intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4256 HSPA9 Zornitza Stark Marked gene: HSPA9 as ready
Mendeliome v0.4256 HSPA9 Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence).
Mendeliome v0.4256 HSPA9 Zornitza Stark Phenotypes for gene: HSPA9 were changed from to Anemia, sideroblastic, 4, MIM# 182170; Even-plus syndrome, MIM#616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose
Autism v0.110 MYT1L Natasha Brown Classified gene: MYT1L as Green List (high evidence)
Autism v0.110 MYT1L Natasha Brown Gene: myt1l has been classified as Green List (High Evidence).
Mendeliome v0.4255 HSPA9 Zornitza Stark Publications for gene: HSPA9 were set to
Autism v0.109 MYT1L Natasha Brown Classified gene: MYT1L as Green List (high evidence)
Autism v0.109 MYT1L Natasha Brown Gene: myt1l has been classified as Green List (High Evidence).
Mendeliome v0.4254 HSPA9 Zornitza Stark Mode of inheritance for gene: HSPA9 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4253 HSPA9 Seb Lunke Mode of inheritance for gene: HSPA9 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Autism v0.109 MYT1L Natasha Brown Classified gene: MYT1L as Green List (high evidence)
Autism v0.109 MYT1L Natasha Brown Gene: myt1l has been classified as Green List (High Evidence).
Mendeliome v0.4252 SVIL Zornitza Stark Marked gene: SVIL as ready
Mendeliome v0.4252 SVIL Zornitza Stark Added comment: Comment when marking as ready: Two unrelated families only.
Mendeliome v0.4252 SVIL Zornitza Stark Gene: svil has been classified as Amber List (Moderate Evidence).
Achromatopsia v0.20 HSPA9 Sue White Classified gene: HSPA9 as Green List (high evidence)
Achromatopsia v0.20 HSPA9 Sue White Gene: hspa9 has been classified as Green List (High Evidence).
Achromatopsia v0.19 HSPA9 Sue White gene: HSPA9 was added
gene: HSPA9 was added to Achromatopsia. Sources: Literature
Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HSPA9 were set to 32869452; 26598328
Phenotypes for gene: HSPA9 were set to https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose
Penetrance for gene: HSPA9 were set to Complete
Review for gene: HSPA9 was set to GREEN
Added comment: Biallelic variants cause a syndromic skeletal dysplasia with small nose, microtia and cardiac and renal malformations.
2/5 have developmental delay and corpus callosum anomalies
Sources: Literature
Autism v0.108 MYT1L Natasha Brown gene: MYT1L was added
gene: MYT1L was added to Autism. Sources: Literature
Mode of inheritance for gene: MYT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYT1L were set to PMID: 32065501
Review for gene: MYT1L was set to GREEN
Added comment: 9 new cases reported bringing total to 51, some of which are larger CNVs including additional genes (2p25.3 deletion syndrome). Of those with microdeletion or SNV of MYT1L only, 66.7% (12/18) had autism.
Sources: Literature
Mendeliome v0.4252 SVIL Zornitza Stark Classified gene: SVIL as Amber List (moderate evidence)
Mendeliome v0.4252 SVIL Zornitza Stark Gene: svil has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4251 CFAP57 Zornitza Stark Mode of inheritance for gene: CFAP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4250 CFAP57 Zornitza Stark reviewed gene: CFAP57: Rating: AMBER; Mode of pathogenicity: None; Publications: 21574244, 32764743; Phenotypes: Van der Woude Syndrome, Primary ciliary dyskinesia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4250 HSPA9 Sue White reviewed gene: HSPA9: Rating: GREEN; Mode of pathogenicity: None; Publications: 26598328, 32869452; Phenotypes: https://www.omim.org/entry/616854, skeletal anomalies, congenital cardiac and renal anomalies: marked small nose; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ciliary Dyskinesia v0.125 CFAP57 Zornitza Stark Phenotypes for gene: CFAP57 were changed from to Van der Woude Syndrome; Primary ciliary dyskinesia
Ciliary Dyskinesia v0.124 CFAP57 Zornitza Stark Publications for gene: CFAP57 were set to
Genetic Epilepsy v0.848 MYT1L Zornitza Stark Marked gene: MYT1L as ready
Genetic Epilepsy v0.848 MYT1L Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence).
Genetic Epilepsy v0.848 MYT1L Zornitza Stark Classified gene: MYT1L as Green List (high evidence)
Genetic Epilepsy v0.848 MYT1L Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence).
Genetic Epilepsy v0.847 MYT1L Zornitza Stark gene: MYT1L was added
gene: MYT1L was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: MYT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYT1L were set to 32065501
Phenotypes for gene: MYT1L were set to Mental retardation, autosomal dominant 39, MIM# 616521
Review for gene: MYT1L was set to GREEN
Added comment: Over 50 individuals reported with deletions and SNVs affecting MYT1L, and variable phenotype comprising intellectual disability, obesity, and behavioral problems. 66% in a recent cohort had seizures.
Sources: Literature
Mendeliome v0.4250 SVIL Melanie Marty gene: SVIL was added
gene: SVIL was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SVIL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SVIL were set to 32779703
Phenotypes for gene: SVIL were set to myopathy
Penetrance for gene: SVIL were set to unknown
Review for gene: SVIL was set to GREEN
Added comment: Four patients from two unrelated consanguineous families with a childhood/adolescence onset of a myopathy associated with homozygous loss-of-function mutations in SVIL. Wide neck, anteverted shoulders and prominent trapezius muscles together with variable contractures were characteristic features. Functional studies on muscle biopsies showed complete loss protein in muscle fibres by western blot.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2969 ATP1A3 Seb Lunke Classified gene: ATP1A3 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.2969 ATP1A3 Seb Lunke Gene: atp1a3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2968 ATP1A3 Seb Lunke reviewed gene: ATP1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4250 HSPA9 Zornitza Stark edited their review of gene: HSPA9: Changed publications: 26491070
Mendeliome v0.4250 HSPA9 Zornitza Stark reviewed gene: HSPA9: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Anemia, sideroblastic, 4, MIM# 182170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Skeletal dysplasia v0.44 COL27A1 Alison Yeung Classified gene: COL27A1 as Green List (high evidence)
Skeletal dysplasia v0.44 COL27A1 Alison Yeung Gene: col27a1 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.43 COL27A1 Alison Yeung Classified gene: COL27A1 as Green List (high evidence)
Skeletal dysplasia v0.43 COL27A1 Alison Yeung Gene: col27a1 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.42 COL27A1 Alison Yeung Marked gene: COL27A1 as ready
Skeletal dysplasia v0.42 COL27A1 Alison Yeung Gene: col27a1 has been classified as Red List (Low Evidence).
Skeletal dysplasia v0.42 COL27A1 Alison Yeung gene: COL27A1 was added
gene: COL27A1 was added to Skeletal dysplasia. Sources: Literature
Mode of inheritance for gene: COL27A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COL27A1 were set to 24986830; 28276056; 28322503
Phenotypes for gene: COL27A1 were set to OMIM #615155 Steel Syndrome
Mendeliome v0.4250 CFAP58 Crystle Lee gene: CFAP58 was added
gene: CFAP58 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: CFAP58 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CFAP58 were set to 32791035
Phenotypes for gene: CFAP58 were set to Multiple morphological abnormalities of the sperm flagella (MMAF) (PMID: 32791035)
Review for gene: CFAP58 was set to AMBER
Added comment: 5 unrelated males reported with biallelic loss of function variants. Knockout mice were infertile (Abstract only)
Sources: Expert Review
Ciliary Dyskinesia v0.123 CFAP57 Elena Savva edited their review of gene: CFAP57: Added comment: Gene not in PubMed but recently published in bioRxiv in single patient with hom nonsense variants and Primary ciliary dyskinesia. Some functional data provided.

PMID: 21574244 - patient with a heterozygous missense and Van der Woude Syndrome. Classed in OMIM as a VUS.

PMID: 32764743 - one homozygous patient p.(Arg588*) w/ PCD - variant results in the skipping of exon 11 (58 amino acids), which may be due to disruption of an exonic splicing enhancer. Functional studies on Chlamydomonas animal model is defective. Potentially the same patient as bioRxiv; Changed publications: PMID: 21574244, 32764743
Intellectual disability syndromic and non-syndromic v0.2968 MYT1L Zornitza Stark Tag SV/CNV tag was added to gene: MYT1L.
Mendeliome v0.4250 MYT1L Zornitza Stark Tag SV/CNV tag was added to gene: MYT1L.
Mendeliome v0.4250 MYT1L Zornitza Stark Publications for gene: MYT1L were set to 28859103
Mendeliome v0.4249 MYT1L Zornitza Stark edited their review of gene: MYT1L: Added comment: Over 50 individuals reported with deletions and SNVs affecting MYT1L, and variable phenotype comprising intellectual disability, obesity, and behavioral problems.; Changed publications: 28859103, 32065501
Intellectual disability syndromic and non-syndromic v0.2968 MYT1L Zornitza Stark Publications for gene: MYT1L were set to 28859103
Intellectual disability syndromic and non-syndromic v0.2967 MYT1L Zornitza Stark reviewed gene: MYT1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 32065501; Phenotypes: Mental retardation, autosomal dominant 39, MIM# 616521; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4249 ARID1A Zornitza Stark Marked gene: ARID1A as ready
Mendeliome v0.4249 ARID1A Zornitza Stark Gene: arid1a has been classified as Green List (High Evidence).
Mendeliome v0.4249 ARID1A Zornitza Stark Phenotypes for gene: ARID1A were changed from to Coffin-Siris syndrome 2 (MIM#614607)
Mendeliome v0.4248 ARID1A Zornitza Stark Publications for gene: ARID1A were set to
Mendeliome v0.4247 ARID1A Zornitza Stark Mode of inheritance for gene: ARID1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4246 PDE10A Zornitza Stark Marked gene: PDE10A as ready
Mendeliome v0.4246 PDE10A Zornitza Stark Gene: pde10a has been classified as Green List (High Evidence).
Mendeliome v0.4246 PDE10A Zornitza Stark Phenotypes for gene: PDE10A were changed from to Dyskinesia, limb and orofacial, infantile-onset, MIM#616921; Striatal degeneration, autosomal dominant, MIM# 616922
Mendeliome v0.4245 PDE10A Zornitza Stark Publications for gene: PDE10A were set to
Mendeliome v0.4244 PDE10A Zornitza Stark Mode of inheritance for gene: PDE10A was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4243 PDE10A Zornitza Stark reviewed gene: PDE10A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27058446, 27058447; Phenotypes: Dyskinesia, limb and orofacial, infantile-onset, MIM#616921, Striatal degeneration, autosomal dominant, MIM# 616922; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Combined Immunodeficiency v0.163 MYSM1 Zornitza Stark Publications for gene: MYSM1 were set to 24288411; 28115216; 26220525
Combined Immunodeficiency v0.162 MYSM1 Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay
Sources: Expert list; to: Early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list
Combined Immunodeficiency v0.162 MYSM1 Zornitza Stark edited their review of gene: MYSM1: Changed publications: 24288411, 28115216, 26220525, 32640305
Bone Marrow Failure v0.82 MYSM1 Zornitza Stark Publications for gene: MYSM1 were set to 24288411; 28115216; 26220525
Mendeliome v0.4243 MYSM1 Zornitza Stark Publications for gene: MYSM1 were set to 4288411; 28115216; 26220525
Mendeliome v0.4242 MYSM1 Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay
Sources: Expert list; to: Early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list
Bone Marrow Failure v0.81 MYSM1 Zornitza Stark changed review comment from: Aarly-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list; to: Early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list
Mendeliome v0.4242 MYSM1 Zornitza Stark edited their review of gene: MYSM1: Changed publications: 4288411, 28115216, 26220525, 32640305
Bone Marrow Failure v0.81 MYSM1 Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list; to: Aarly-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list
Mendeliome v0.4242 PNPLA8 Kristin Rigbye reviewed gene: PNPLA8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29681094, 25512002; Phenotypes: Mitochondrial myopathy with lactic acidosis (MIM#251950), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2967 ARID1A Crystle Lee reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23929686, 22426308, 25168959; Phenotypes: Coffin-Siris syndrome 2 (MIM#614607); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4242 ARID1A Crystle Lee reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23929686, 22426308, 25168959; Phenotypes: Coffin-Siris syndrome 2 (MIM#614607); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Bone Marrow Failure v0.81 MYSM1 Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay
Sources: Expert list; to: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported.
Sources: Expert list
Bone Marrow Failure v0.81 MYSM1 Zornitza Stark edited their review of gene: MYSM1: Changed publications: 24288411, 28115216, 26220525, 32640305
Mendeliome v0.4242 BTG4 Zornitza Stark Phenotypes for gene: BTG4 were changed from Zygotic cleavage failure (ZCF) to Zygotic cleavage failure (ZCF); Oocyte maturation defect, MIM#619009
Mendeliome v0.4241 BTG4 Zornitza Stark reviewed gene: BTG4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte maturation defect, MIM#619009; Mode of inheritance: None
Dystonia and Chorea v0.111 PCCB Zornitza Stark Marked gene: PCCB as ready
Dystonia and Chorea v0.111 PCCB Zornitza Stark Gene: pccb has been classified as Green List (High Evidence).
Dystonia and Chorea v0.111 PCCB Zornitza Stark Classified gene: PCCB as Green List (high evidence)
Dystonia and Chorea v0.111 PCCB Zornitza Stark Gene: pccb has been classified as Green List (High Evidence).
Dystonia and Chorea v0.110 PCCB Zornitza Stark gene: PCCB was added
gene: PCCB was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: PCCB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCCB were set to 30879957
Phenotypes for gene: PCCB were set to Propionicacidemia, MIM# 606054
Review for gene: PCCB was set to GREEN
Added comment: The neonatal form is frequently accompanied by metabolic acidosis with anion gap, ketonuria, hypoglycemia, hyperammonemia, and cytopenia. A late-onset form in older children and adults is pertinent to this panel as it has a milder phenotype. It is less common, and may present with developmental regression, chronic vomiting, protein intolerance, failure to thrive, hypotonia, and occasionally basal ganglia infarction, which may result in dystonia and choreoathetosis, and cardiomyopathy.
Sources: Expert list
Dystonia and Chorea v0.109 PCCA Zornitza Stark Marked gene: PCCA as ready
Dystonia and Chorea v0.109 PCCA Zornitza Stark Gene: pcca has been classified as Green List (High Evidence).
Dystonia and Chorea v0.109 PCCA Zornitza Stark Classified gene: PCCA as Green List (high evidence)
Dystonia and Chorea v0.109 PCCA Zornitza Stark Gene: pcca has been classified as Green List (High Evidence).
Dystonia and Chorea v0.108 PCCA Zornitza Stark gene: PCCA was added
gene: PCCA was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: PCCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCCA were set to 30879957
Phenotypes for gene: PCCA were set to Propionicacidemia, MIM# 606054
Review for gene: PCCA was set to GREEN
Added comment: The neonatal form is frequently accompanied by metabolic acidosis with anion gap, ketonuria, hypoglycemia, hyperammonemia, and cytopenia. A late-onset form in older children and adults is pertinent to this panel as it has a milder phenotype. It is less common, and may present with developmental regression, chronic vomiting, protein intolerance, failure to thrive, hypotonia, and occasionally basal ganglia infarction, which may result in dystonia and choreoathetosis, and cardiomyopathy.
Sources: Expert list
Hereditary Spastic Paraplegia v0.115 KIF1C Zornitza Stark Marked gene: KIF1C as ready
Hereditary Spastic Paraplegia v0.115 KIF1C Zornitza Stark Gene: kif1c has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v0.115 KIF1C Zornitza Stark Publications for gene: KIF1C were set to
Hereditary Spastic Paraplegia v0.114 KIF1C Zornitza Stark reviewed gene: KIF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24319291, 31413903, 29544888; Phenotypes: Spastic ataxia 2, autosomal recessive, MIM# 611302; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ataxia v0.223 KIF1C Zornitza Stark Publications for gene: KIF1C were set to
Ataxia v0.222 KIF1C Zornitza Stark reviewed gene: KIF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24319291, 31413903, 29544888; Phenotypes: Spastic ataxia 2, autosomal recessive, MIM# 611302; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4241 KIF1C Zornitza Stark Marked gene: KIF1C as ready
Mendeliome v0.4241 KIF1C Zornitza Stark Gene: kif1c has been classified as Green List (High Evidence).
Mendeliome v0.4241 KIF1C Zornitza Stark Phenotypes for gene: KIF1C were changed from to Spastic ataxia 2, autosomal recessive, MIM# 611302
Mendeliome v0.4240 KIF1C Zornitza Stark Publications for gene: KIF1C were set to
Mendeliome v0.4239 KIF1C Zornitza Stark Mode of inheritance for gene: KIF1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4238 KIF1C Zornitza Stark reviewed gene: KIF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24319291, 31413903, 29544888; Phenotypes: Spastic ataxia 2, autosomal recessive, MIM# 611302; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Dystonia and Chorea v0.107 KIF1C Zornitza Stark Marked gene: KIF1C as ready
Dystonia and Chorea v0.107 KIF1C Zornitza Stark Gene: kif1c has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.107 KIF1C Zornitza Stark Classified gene: KIF1C as Amber List (moderate evidence)
Dystonia and Chorea v0.107 KIF1C Zornitza Stark Gene: kif1c has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.106 KIF1C Zornitza Stark gene: KIF1C was added
gene: KIF1C was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: KIF1C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF1C were set to 31413903
Phenotypes for gene: KIF1C were set to Spastic ataxia 2, autosomal recessive, MIM# 611302
Review for gene: KIF1C was set to AMBER
Added comment: Neurologic disorder characterized by onset in the first 2 decades of cerebellar ataxia, dysarthria, and variable spasticity of the lower limbs. At least one report of a more complex movement disorder including dystonia.
Sources: Expert list
Paroxysmal Dyskinesia v0.42 KCNA2 Zornitza Stark Marked gene: KCNA2 as ready
Paroxysmal Dyskinesia v0.42 KCNA2 Zornitza Stark Gene: kcna2 has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.42 KCNA2 Zornitza Stark Phenotypes for gene: KCNA2 were changed from to Episodic ataxia; Epileptic encephalopathy, early infantile, 32, MIM# 616366
Paroxysmal Dyskinesia v0.41 KCNA2 Zornitza Stark Publications for gene: KCNA2 were set to
Paroxysmal Dyskinesia v0.40 KCNA2 Zornitza Stark Mode of inheritance for gene: KCNA2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Paroxysmal Dyskinesia v0.39 KCNA2 Zornitza Stark edited their review of gene: KCNA2: Changed rating: GREEN
Paroxysmal Dyskinesia v0.39 KCNA2 Zornitza Stark reviewed gene: KCNA2: Rating: ; Mode of pathogenicity: None; Publications: 27733563, 27543892, 25477152; Phenotypes: Episodic ataxia, Epileptic encephalopathy, early infantile, 32 616366; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.846 IRF2BPL Zornitza Stark Marked gene: IRF2BPL as ready
Genetic Epilepsy v0.846 IRF2BPL Zornitza Stark Gene: irf2bpl has been classified as Green List (High Evidence).
Genetic Epilepsy v0.846 IRF2BPL Zornitza Stark Phenotypes for gene: IRF2BPL were changed from to Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM# 618088
Genetic Epilepsy v0.845 IRF2BPL Zornitza Stark Publications for gene: IRF2BPL were set to
Genetic Epilepsy v0.844 IRF2BPL Zornitza Stark Mode of inheritance for gene: IRF2BPL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.843 IRF2BPL Zornitza Stark reviewed gene: IRF2BPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 30057031, 30166628; Phenotypes: Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM# 618088; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia and Chorea v0.105 ACTB Zornitza Stark Marked gene: ACTB as ready
Dystonia and Chorea v0.105 ACTB Zornitza Stark Gene: actb has been classified as Green List (High Evidence).
Dystonia and Chorea v0.105 ACTB Zornitza Stark Mode of pathogenicity for gene: ACTB was changed from to Other
Dystonia and Chorea v0.104 DNAJC12 Zornitza Stark Marked gene: DNAJC12 as ready
Dystonia and Chorea v0.104 DNAJC12 Zornitza Stark Gene: dnajc12 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.104 GNAO1 Zornitza Stark Marked gene: GNAO1 as ready
Dystonia and Chorea v0.104 GNAO1 Zornitza Stark Gene: gnao1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.104 GNAO1 Zornitza Stark Publications for gene: GNAO1 were set to
Dystonia and Chorea v0.103 GNAO1 Zornitza Stark Mode of pathogenicity for gene: GNAO1 was changed from to Other
Dystonia and Chorea v0.102 CACNA1A Zornitza Stark Marked gene: CACNA1A as ready
Dystonia and Chorea v0.102 CACNA1A Zornitza Stark Gene: cacna1a has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 PDHX Zornitza Stark Marked gene: PDHX as ready
Dystonia and Chorea v0.102 PDHX Zornitza Stark Gene: pdhx has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 RNASEH2B Zornitza Stark Marked gene: RNASEH2B as ready
Dystonia and Chorea v0.102 RNASEH2B Zornitza Stark Gene: rnaseh2b has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 RNASEH2C Zornitza Stark Marked gene: RNASEH2C as ready
Dystonia and Chorea v0.102 RNASEH2C Zornitza Stark Gene: rnaseh2c has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 SNORD118 Zornitza Stark Marked gene: SNORD118 as ready
Dystonia and Chorea v0.102 SNORD118 Zornitza Stark Gene: snord118 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 SUOX Zornitza Stark Marked gene: SUOX as ready
Dystonia and Chorea v0.102 SUOX Zornitza Stark Gene: suox has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 SYT1 Zornitza Stark Marked gene: SYT1 as ready
Dystonia and Chorea v0.102 SYT1 Zornitza Stark Gene: syt1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.102 SAMHD1 Zornitza Stark Marked gene: SAMHD1 as ready
Dystonia and Chorea v0.102 SAMHD1 Zornitza Stark Gene: samhd1 has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.102 AFG3L2 Zornitza Stark Marked gene: AFG3L2 as ready
Dystonia and Chorea v0.102 AFG3L2 Zornitza Stark Gene: afg3l2 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.102 CHMP2B Zornitza Stark Marked gene: CHMP2B as ready
Dystonia and Chorea v0.102 CHMP2B Zornitza Stark Gene: chmp2b has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.102 EARS2 Zornitza Stark Marked gene: EARS2 as ready
Dystonia and Chorea v0.102 EARS2 Zornitza Stark Gene: ears2 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.102 GAMT Zornitza Stark Marked gene: GAMT as ready
Dystonia and Chorea v0.102 GAMT Zornitza Stark Gene: gamt has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.102 KCNQ2 Zornitza Stark Marked gene: KCNQ2 as ready
Dystonia and Chorea v0.102 KCNQ2 Zornitza Stark Gene: kcnq2 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.102 MAPT Zornitza Stark Marked gene: MAPT as ready
Dystonia and Chorea v0.102 MAPT Zornitza Stark Gene: mapt has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.102 MAPT Zornitza Stark Classified gene: MAPT as Amber List (moderate evidence)
Dystonia and Chorea v0.102 MAPT Zornitza Stark Gene: mapt has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.101 MAT1A Zornitza Stark Marked gene: MAT1A as ready
Dystonia and Chorea v0.101 MAT1A Zornitza Stark Gene: mat1a has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 MMADHC Zornitza Stark Marked gene: MMADHC as ready
Dystonia and Chorea v0.101 MMADHC Zornitza Stark Gene: mmadhc has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 MPV17 Zornitza Stark Marked gene: MPV17 as ready
Dystonia and Chorea v0.101 MPV17 Zornitza Stark Gene: mpv17 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 PLP1 Zornitza Stark Marked gene: PLP1 as ready
Dystonia and Chorea v0.101 PLP1 Zornitza Stark Gene: plp1 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 RNASEH2A Zornitza Stark Marked gene: RNASEH2A as ready
Dystonia and Chorea v0.101 RNASEH2A Zornitza Stark Gene: rnaseh2a has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 VPS37A Zornitza Stark Marked gene: VPS37A as ready
Dystonia and Chorea v0.101 VPS37A Zornitza Stark Gene: vps37a has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 TOR1AIP1 Zornitza Stark Marked gene: TOR1AIP1 as ready
Dystonia and Chorea v0.101 TOR1AIP1 Zornitza Stark Gene: tor1aip1 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 UNC80 Zornitza Stark Marked gene: UNC80 as ready
Dystonia and Chorea v0.101 UNC80 Zornitza Stark Gene: unc80 has been classified as Red List (Low Evidence).
Dystonia and Chorea v0.101 HPRT1 Zornitza Stark Marked gene: HPRT1 as ready
Dystonia and Chorea v0.101 HPRT1 Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.101 HPRT1 Zornitza Stark Publications for gene: HPRT1 were set to
Dystonia and Chorea v0.100 HPRT1 Zornitza Stark reviewed gene: HPRT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301328; Phenotypes: Lesch-Nyhan syndrome, MIM# 300322; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Dystonia and Chorea v0.100 HIBCH Zornitza Stark Marked gene: HIBCH as ready
Dystonia and Chorea v0.100 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Dystonia and Chorea v0.100 HIBCH Zornitza Stark Classified gene: HIBCH as Green List (high evidence)
Dystonia and Chorea v0.100 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Dystonia and Chorea v0.99 HIBCH Zornitza Stark gene: HIBCH was added
gene: HIBCH was added to Dystonia - complex. Sources: Expert Review
Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HIBCH were set to 26026795; 25251209; 24299452; 32677093
Phenotypes for gene: HIBCH were set to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620
Review for gene: HIBCH was set to GREEN
Added comment: Autosomal recessive inborn error of metabolism characterized by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Dystonia is a feature.
Sources: Expert Review
Regression v0.150 HIBCH Zornitza Stark Marked gene: HIBCH as ready
Regression v0.150 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Regression v0.150 HIBCH Zornitza Stark Classified gene: HIBCH as Green List (high evidence)
Regression v0.150 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Regression v0.149 HIBCH Zornitza Stark gene: HIBCH was added
gene: HIBCH was added to Regression. Sources: Expert list
Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: HIBCH were set to 26026795; 25251209; 24299452; 32677093
Phenotypes for gene: HIBCH were set to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620
Review for gene: HIBCH was set to GREEN
Added comment: Autosomal recessive inborn error of metabolism characterized by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Multiple unrelated families reported.
Sources: Expert list
Dystonia and Chorea v0.98 ECHS1 Zornitza Stark Marked gene: ECHS1 as ready
Dystonia and Chorea v0.98 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.98 ECHS1 Zornitza Stark Classified gene: ECHS1 as Green List (high evidence)
Dystonia and Chorea v0.98 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.97 ECHS1 Zornitza Stark gene: ECHS1 was added
gene: ECHS1 was added to Dystonia - complex. Sources: Expert Review
Mode of inheritance for gene: ECHS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ECHS1 were set to 32677093; 32858208
Phenotypes for gene: ECHS1 were set to Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277
Review for gene: ECHS1 was set to GREEN
Added comment: Paroxysmal and non-paroxysmal dystonia described as a manifestation of this metabolic disorder.
Sources: Expert Review
Mackenzie's Mission_Reproductive Carrier Screening v0.21 GTPBP2 Zornitza Stark gene: GTPBP2 was added
gene: GTPBP2 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: GTPBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTPBP2 were set to 26675814; 29449720; 30790272
Phenotypes for gene: GTPBP2 were set to Jaberi-Elahi syndrome, MIM#617988
Review for gene: GTPBP2 was set to GREEN
Added comment: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation.
Sources: Expert Review
Microcephaly v0.481 GTPBP2 Zornitza Stark Marked gene: GTPBP2 as ready
Microcephaly v0.481 GTPBP2 Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence).
Microcephaly v0.481 GTPBP2 Zornitza Stark Classified gene: GTPBP2 as Green List (high evidence)
Microcephaly v0.481 GTPBP2 Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.96 GTPBP2 Zornitza Stark Marked gene: GTPBP2 as ready
Dystonia and Chorea v0.96 GTPBP2 Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.96 GTPBP2 Zornitza Stark Classified gene: GTPBP2 as Green List (high evidence)
Dystonia and Chorea v0.96 GTPBP2 Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence).
Microcephaly v0.480 GTPBP2 Zornitza Stark gene: GTPBP2 was added
gene: GTPBP2 was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: GTPBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTPBP2 were set to 26675814; 29449720; 30790272
Phenotypes for gene: GTPBP2 were set to Jaberi-Elahi syndrome, MIM#617988
Review for gene: GTPBP2 was set to GREEN
Added comment: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation.
Sources: Expert Review
Dystonia and Chorea v0.95 GTPBP2 Zornitza Stark gene: GTPBP2 was added
gene: GTPBP2 was added to Dystonia - complex. Sources: Expert Review
Mode of inheritance for gene: GTPBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GTPBP2 were set to 26675814; 29449720; 30790272
Phenotypes for gene: GTPBP2 were set to Jaberi-Elahi syndrome, MIM#617988
Review for gene: GTPBP2 was set to GREEN
Added comment: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation.
Sources: Expert Review
Mendeliome v0.4238 GTPBP2 Zornitza Stark Marked gene: GTPBP2 as ready
Mendeliome v0.4238 GTPBP2 Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence).
Mendeliome v0.4238 GTPBP2 Zornitza Stark Phenotypes for gene: GTPBP2 were changed from to Jaberi-Elahi syndrome, MIM#617988
Mendeliome v0.4237 GTPBP2 Zornitza Stark Publications for gene: GTPBP2 were set to
Mendeliome v0.4236 GTPBP2 Zornitza Stark Mode of inheritance for gene: GTPBP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4235 GTPBP2 Zornitza Stark reviewed gene: GTPBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26675814, 29449720, 30790272; Phenotypes: Jaberi-Elahi syndrome, MIM#617988; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.843 GTPBP2 Zornitza Stark changed review comment from: Six unrelated families with this neurodevelopmental syndrome, seizures are a feature.
Sources: Expert list; to: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2967 GTPBP2 Zornitza Stark Marked gene: GTPBP2 as ready
Intellectual disability syndromic and non-syndromic v0.2967 GTPBP2 Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2967 GTPBP2 Zornitza Stark Phenotypes for gene: GTPBP2 were changed from to Jaberi-Elahi syndrome, MIM#617988
Intellectual disability syndromic and non-syndromic v0.2966 GTPBP2 Zornitza Stark Publications for gene: GTPBP2 were set to
Intellectual disability syndromic and non-syndromic v0.2965 GTPBP2 Zornitza Stark Mode of inheritance for gene: GTPBP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2964 GTPBP2 Zornitza Stark reviewed gene: GTPBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26675814, 29449720, 30790272; Phenotypes: Jaberi-Elahi syndrome, MIM#617988; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.843 GTPBP2 Zornitza Stark changed review comment from: Four unrelated families with this neurodevelopmental syndrome, seizures are a feature.
Sources: Expert list; to: Six unrelated families with this neurodevelopmental syndrome, seizures are a feature.
Sources: Expert list
Genetic Epilepsy v0.843 GTPBP2 Zornitza Stark edited their review of gene: GTPBP2: Changed publications: 26675814, 29449720, 30790272
Mendeliome v0.4235 GNB1 Zornitza Stark Marked gene: GNB1 as ready
Mendeliome v0.4235 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2964 GNB1 Zornitza Stark Marked gene: GNB1 as ready
Intellectual disability syndromic and non-syndromic v0.2964 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2964 GNB1 Zornitza Stark Phenotypes for gene: GNB1 were changed from to Mental retardation, autosomal dominant 42, MIM# 616973
Intellectual disability syndromic and non-syndromic v0.2963 GNB1 Zornitza Stark Publications for gene: GNB1 were set to
Mendeliome v0.4235 GNB1 Zornitza Stark Phenotypes for gene: GNB1 were changed from to Mental retardation, autosomal dominant 42, MIM# 616973
Mendeliome v0.4234 GNB1 Zornitza Stark Publications for gene: GNB1 were set to
Intellectual disability syndromic and non-syndromic v0.2962 GNB1 Zornitza Stark Mode of inheritance for gene: GNB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4233 GNB1 Zornitza Stark Mode of inheritance for gene: GNB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2961 GNB1 Zornitza Stark reviewed gene: GNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108799, 30194818, 27668284, 31034681; Phenotypes: Mental retardation, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4232 GNB1 Zornitza Stark reviewed gene: GNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108799, 30194818, 27668284, 31034681; Phenotypes: Mental retardation, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia and Chorea v0.94 GNB1 Zornitza Stark Marked gene: GNB1 as ready
Dystonia and Chorea v0.94 GNB1 Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.94 GNB1 Zornitza Stark Phenotypes for gene: GNB1 were changed from Mental retardation, autosomal dominant 42; Myoclonus dystonia to Mental retardation, autosomal dominant 42, MIM# 616973; Myoclonus dystonia
Dystonia and Chorea v0.93 GNB1 Zornitza Stark Publications for gene: GNB1 were set to 30194818
Dystonia and Chorea v0.92 GNB1 Zornitza Stark edited their review of gene: GNB1: Changed rating: GREEN
Dystonia and Chorea v0.92 GNB1 Zornitza Stark reviewed gene: GNB1: Rating: RED; Mode of pathogenicity: None; Publications: 27108799, 30194818, 27668284, 31034681; Phenotypes: Mental retardation, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia and Chorea v0.92 GJC2 Zornitza Stark Marked gene: GJC2 as ready
Dystonia and Chorea v0.92 GJC2 Zornitza Stark Gene: gjc2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.92 GJC2 Zornitza Stark Classified gene: GJC2 as Green List (high evidence)
Dystonia and Chorea v0.92 GJC2 Zornitza Stark Gene: gjc2 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.91 GJC2 Zornitza Stark gene: GJC2 was added
gene: GJC2 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: GJC2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GJC2 were set to 15192806; 18094336
Phenotypes for gene: GJC2 were set to Leukodystrophy, hypomyelinating, 2, MIM# 608804
Review for gene: GJC2 was set to GREEN
Added comment: Complex CNS involvement manifesting as nystagmus, impaired motor development, ataxia, choreoathetotic movements, dystonia, dysarthria, and progressive spasticity, in addition to intellectual disability. Multiple families reported.
Sources: Expert list
Dystonia and Chorea v0.90 GBA Zornitza Stark Marked gene: GBA as ready
Dystonia and Chorea v0.90 GBA Zornitza Stark Gene: gba has been classified as Green List (High Evidence).
Dystonia and Chorea v0.90 GBA Zornitza Stark Classified gene: GBA as Green List (high evidence)
Dystonia and Chorea v0.90 GBA Zornitza Stark Gene: gba has been classified as Green List (High Evidence).
Dystonia and Chorea v0.89 GBA Zornitza Stark gene: GBA was added
gene: GBA was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: GBA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GBA were set to 27789132
Phenotypes for gene: GBA were set to Gaucher disease, type III, MIM# 231000
Review for gene: GBA was set to GREEN
Added comment: Dystonia-like hyperkinetic movement disorder reported in GD3.
Sources: Expert list
Dystonia and Chorea v0.88 FOXG1 Zornitza Stark Marked gene: FOXG1 as ready
Dystonia and Chorea v0.88 FOXG1 Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.88 FOXG1 Zornitza Stark Publications for gene: FOXG1 were set to
Dystonia and Chorea v0.87 FOXG1 Zornitza Stark reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27029630; Phenotypes: Rett syndrome, congenital variant, MIM# 613454; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2961 FITM2 Zornitza Stark Marked gene: FITM2 as ready
Intellectual disability syndromic and non-syndromic v0.2961 FITM2 Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2961 FITM2 Zornitza Stark Classified gene: FITM2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.2961 FITM2 Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2960 FITM2 Zornitza Stark gene: FITM2 was added
gene: FITM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: FITM2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FITM2 were set to 28067622; 30214770; 30288795
Phenotypes for gene: FITM2 were set to Siddiqi syndrome MIM#618635
Review for gene: FITM2 was set to GREEN
Added comment: Autosomal recessive condition characterised by global developmental delay, early-onset progressive sensorineural hearing impairment, regression of motor skills, dystonia, poor overall growth, and low body mass index (BMI). More variable features may include ichthyosis-like skin abnormalities or sensory neuropathy. 7 individuals from three unrelated families reported, supportive Drosophila model.
Sources: Expert list
Mackenzie's Mission_Reproductive Carrier Screening v0.20 FITM2 Zornitza Stark gene: FITM2 was added
gene: FITM2 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list
Mode of inheritance for gene: FITM2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FITM2 were set to 28067622; 30214770; 30288795
Phenotypes for gene: FITM2 were set to Siddiqi syndrome MIM#618635
Review for gene: FITM2 was set to GREEN
Added comment: Autosomal recessive condition characterised by global developmental delay, early-onset progressive sensorineural hearing impairment, regression of motor skills, dystonia, poor overall growth, and low body mass index (BMI). More variable features may include ichthyosis-like skin abnormalities or sensory neuropathy. 7 individuals from 3 unrelated families reported, supportive Drosophila model.
Sources: Expert list
Dystonia and Chorea v0.87 CYP27A1 Zornitza Stark Marked gene: CYP27A1 as ready
Dystonia and Chorea v0.87 CYP27A1 Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.87 CYP27A1 Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cholestanol storage disease; Dystonia to Cerebrotendinous xanthomatosis, MIM# 213700; Cholestanol storage disease; Dystonia
Dystonia and Chorea v0.86 CYP27A1 Zornitza Stark Publications for gene: CYP27A1 were set to
Dystonia and Chorea v0.85 CYP27A1 Zornitza Stark edited their review of gene: CYP27A1: Changed rating: GREEN
Dystonia and Chorea v0.85 CYP27A1 Zornitza Stark reviewed gene: CYP27A1: Rating: ; Mode of pathogenicity: None; Publications: 19373932, 21531161, 25424010; Phenotypes: Cerebrotendinous xanthomatosis, MIM# 213700; Mode of inheritance: None
Dystonia and Chorea v0.85 CP Zornitza Stark Marked gene: CP as ready
Dystonia and Chorea v0.85 CP Zornitza Stark Gene: cp has been classified as Green List (High Evidence).
Dystonia and Chorea v0.85 CP Zornitza Stark Phenotypes for gene: CP were changed from Hemosiderosis, systemic, due to aceruloplasminemia 604290; Dystonia; Cerebellar ataxia 604290; Aceruloplasminemia; [Hypoceruloplasminemia, hereditary] 604290 to Aceruloplasminaemia, MIM#604290
Dystonia and Chorea v0.84 CP Zornitza Stark commented on gene: CP: Iron deposition in brain, specifically in basal ganglia, resulting in extrapyramidal movement disorders as part of the neurodegenerative phenotype.
Dystonia and Chorea v0.84 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Dystonia and Chorea v0.84 CLN3 Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.84 CLN3 Zornitza Stark Classified gene: CLN3 as Green List (high evidence)
Dystonia and Chorea v0.84 CLN3 Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.83 CLN3 Zornitza Stark gene: CLN3 was added
gene: CLN3 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: CLN3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CLN3 were set to 19353721
Phenotypes for gene: CLN3 were set to Ceroid lipofuscinosis, neuronal, 3 204200
Review for gene: CLN3 was set to GREEN
Added comment: Movement disorders, including dystonia, are a feature of Batten disease.
Sources: Expert list
Paroxysmal Dyskinesia v0.39 CLCN1 Zornitza Stark reviewed gene: CLCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Myotonia congenita, dominant, MIM# 160800, Myotonia congenita, recessive, MIM# 255700; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Dystonia and Chorea v0.82 CACNA1G Zornitza Stark changed review comment from: Variable spasticity, hypertonia, or dystonia of the limbs in addition to intellectual disability and ataxia.
Sources: Expert list; to: Four unrelated individuals reported with variable spasticity, hypertonia, or dystonia of the limbs in addition to intellectual disability and ataxia.
Sources: Expert list
Dystonia and Chorea v0.82 CACNA1G Zornitza Stark Marked gene: CACNA1G as ready
Dystonia and Chorea v0.82 CACNA1G Zornitza Stark Gene: cacna1g has been classified as Green List (High Evidence).
Dystonia and Chorea v0.82 CACNA1G Zornitza Stark Classified gene: CACNA1G as Green List (high evidence)
Dystonia and Chorea v0.82 CACNA1G Zornitza Stark Gene: cacna1g has been classified as Green List (High Evidence).
Dystonia and Chorea v0.81 CACNA1G Zornitza Stark gene: CACNA1G was added
gene: CACNA1G was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: CACNA1G was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CACNA1G were set to 29878067
Phenotypes for gene: CACNA1G were set to Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM# 618087
Review for gene: CACNA1G was set to GREEN
Added comment: Variable spasticity, hypertonia, or dystonia of the limbs in addition to intellectual disability and ataxia.
Sources: Expert list
Dystonia and Chorea v0.80 C9orf72 Zornitza Stark Marked gene: C9orf72 as ready
Dystonia and Chorea v0.80 C9orf72 Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.80 C9orf72 Zornitza Stark Classified gene: C9orf72 as Green List (high evidence)
Dystonia and Chorea v0.80 C9orf72 Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.79 C9orf72 Zornitza Stark gene: C9orf72 was added
gene: C9orf72 was added to Dystonia - complex. Sources: Expert list
STR tags were added to gene: C9orf72.
Mode of inheritance for gene: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: C9orf72 were set to 26166205; 24363131; 26187722
Phenotypes for gene: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1, MIM# 105550
Review for gene: C9orf72 was set to GREEN
Added comment: Dystonia is a well described feature of this condition. Note condition is caused by heterozygous hexanucleotide repeat expansion (GGGGCC) in a noncoding region of the C9ORF72 gene.
Sources: Expert list
Dystonia and Chorea v0.78 AUH Zornitza Stark Marked gene: AUH as ready
Dystonia and Chorea v0.78 AUH Zornitza Stark Gene: auh has been classified as Green List (High Evidence).
Dystonia and Chorea v0.78 AUH Zornitza Stark reviewed gene: AUH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria, type I, MIM# 250950; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Dystonia and Chorea v0.78 ARX Zornitza Stark Marked gene: ARX as ready
Dystonia and Chorea v0.78 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Dystonia and Chorea v0.78 ARX Zornitza Stark Publications for gene: ARX were set to
Dystonia and Chorea v0.77 ARX Zornitza Stark edited their review of gene: ARX: Changed publications: 11889467, 15200506
Dystonia and Chorea v0.77 ARX Zornitza Stark Mode of pathogenicity for gene: ARX was changed from to Other
Dystonia and Chorea v0.76 ARX Zornitza Stark Phenotypes for gene: ARX were changed from Early infantile epileptic encephalopathy; Dystonia to Partington syndrome, MIM# 309510; Dystonia
Dystonia and Chorea v0.75 ARX Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Partington syndrome, MIM# 309510; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mitochondrial disease v0.481 NDUFB10 Zornitza Stark Phenotypes for gene: NDUFB10 were changed from fatal infantile lactic acidosis; cardiomyopathy to fatal infantile lactic acidosis; cardiomyopathy; Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003
Mitochondrial disease v0.480 NDUFB10 Zornitza Stark reviewed gene: NDUFB10: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4232 NDUFB10 Zornitza Stark Phenotypes for gene: NDUFB10 were changed from fatal infantile lactic acidosis; cardiomyopathy to fatal infantile lactic acidosis; cardiomyopathy; Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003
Mendeliome v0.4231 NDUFB10 Zornitza Stark edited their review of gene: NDUFB10: Changed phenotypes: fatal infantile lactic acidosis, cardiomyopathy, Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003
Mitochondrial disease v0.480 SSBP1 Zornitza Stark Phenotypes for gene: SSBP1 were changed from Optic atrophy with or without extraocular phenotypes to Optic atrophy with or without extraocular phenotypes; Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510
Mitochondrial disease v0.479 SSBP1 Zornitza Stark reviewed gene: SSBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510; Mode of inheritance: None
Optic Atrophy v0.114 SSBP1 Zornitza Stark Phenotypes for gene: SSBP1 were changed from Optic atrophy with or without extraocular phenotypes to Optic atrophy with or without extraocular phenotypes; Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510
Optic Atrophy v0.113 SSBP1 Zornitza Stark reviewed gene: SSBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510; Mode of inheritance: None
Mendeliome v0.4231 SSBP1 Zornitza Stark Phenotypes for gene: SSBP1 were changed from Optic atrophy with or without extraocular phenotypes to Optic atrophy with or without extraocular phenotypes; Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510
Mendeliome v0.4230 SSBP1 Zornitza Stark reviewed gene: SSBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510; Mode of inheritance: None
Mendeliome v0.4230 MCM10 Zornitza Stark Marked gene: MCM10 as ready
Mendeliome v0.4230 MCM10 Zornitza Stark Gene: mcm10 has been classified as Red List (Low Evidence).
Mendeliome v0.4230 MCM10 Zornitza Stark gene: MCM10 was added
gene: MCM10 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: MCM10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MCM10 were set to 32865517
Phenotypes for gene: MCM10 were set to Susceptibility to CMV
Review for gene: MCM10 was set to RED
Added comment: Compound heterozygous variants in minichromosomal maintenance complex member 10 (MCM10) reported as a cause of NK-cell deficiency in a child with fatal susceptibility to CMV.
Sources: Literature
Susceptibility to Viral Infections v0.67 MCM10 Zornitza Stark Marked gene: MCM10 as ready
Susceptibility to Viral Infections v0.67 MCM10 Zornitza Stark Gene: mcm10 has been classified as Red List (Low Evidence).
Susceptibility to Viral Infections v0.67 MCM10 Zornitza Stark Mode of inheritance for gene: MCM10 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Susceptibility to Viral Infections v0.66 MCM10 Zornitza Stark gene: MCM10 was added
gene: MCM10 was added to Susceptibility to Viral Infections. Sources: Literature
Mode of inheritance for gene: MCM10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MCM10 were set to 32865517
Phenotypes for gene: MCM10 were set to Susceptibility to CMV
Review for gene: MCM10 was set to RED
Added comment: Compound heterozygous variants in minichromosomal maintenance complex member 10 (MCM10) reported as a cause of NK-cell deficiency in a child with fatal susceptibility to CMV.
Sources: Literature
Disorders of immune dysregulation v0.64 TET2 Zornitza Stark Marked gene: TET2 as ready
Disorders of immune dysregulation v0.64 TET2 Zornitza Stark Gene: tet2 has been classified as Green List (High Evidence).
Disorders of immune dysregulation v0.64 TET2 Zornitza Stark Classified gene: TET2 as Green List (high evidence)
Disorders of immune dysregulation v0.64 TET2 Zornitza Stark Gene: tet2 has been classified as Green List (High Evidence).
Disorders of immune dysregulation v0.63 TET2 Zornitza Stark gene: TET2 was added
gene: TET2 was added to Disorders of immune dysregulation. Sources: Literature
Mode of inheritance for gene: TET2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TET2 were set to 32518946
Phenotypes for gene: TET2 were set to Immune dysregulation; Lymphoma
Review for gene: TET2 was set to GREEN
Added comment: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2.
Sources: Literature
Mendeliome v0.4229 TET2 Zornitza Stark changed review comment from: Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established.; to: Mono-allelic variants: Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established.
Mendeliome v0.4229 TET2 Zornitza Stark changed review comment from: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution.; to: Mono-allelic variants: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution.
Mendeliome v0.4229 TET2 Zornitza Stark changed review comment from: PMID 32518946: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2.; to: Bi-allelic variants PMID 32518946: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2.
Mendeliome v0.4229 TET2 Zornitza Stark changed review comment from: No evidence for Mendelian gene-disease association. Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established.; to: Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established.
Mendeliome v0.4229 TET2 Zornitza Stark edited their review of gene: TET2: Added comment: PMID 32518946: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2.; Changed rating: GREEN; Changed publications: 30890702, 31827242, 32330418, 32518946; Changed phenotypes: Dementia, Lymphoma/myeloid malignancy, Immunodeficiency; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.479 CASK Zornitza Stark Marked gene: CASK as ready
Microcephaly v0.479 CASK Zornitza Stark Gene: cask has been classified as Green List (High Evidence).
Microcephaly v0.479 CASK Zornitza Stark Phenotypes for gene: CASK were changed from to Mental retardation and microcephaly with pontine and cerebellar hypoplasia, MIM# 300749
Microcephaly v0.478 CASK Zornitza Stark Publications for gene: CASK were set to
Microcephaly v0.477 CASK Zornitza Stark Mode of inheritance for gene: CASK was changed from Unknown to Other
Microcephaly v0.476 CASK Zornitza Stark reviewed gene: CASK: Rating: GREEN; Mode of pathogenicity: None; Publications: 21954287, 19165920, 21735175; Phenotypes: Mental retardation and microcephaly with pontine and cerebellar hypoplasia, MIM# 300749; Mode of inheritance: Other
Microcephaly v0.476 ATR Zornitza Stark Marked gene: ATR as ready
Microcephaly v0.476 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Microcephaly v0.476 ATR Zornitza Stark Phenotypes for gene: ATR were changed from to Seckel syndrome 1, MIM# 210600
Microcephaly v0.475 ATR Zornitza Stark Publications for gene: ATR were set to
Microcephaly v0.474 ATR Zornitza Stark Mode of inheritance for gene: ATR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.473 ATR Zornitza Stark reviewed gene: ATR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12640452, 19620979, 30199583, 23111928; Phenotypes: Seckel syndrome 1, MIM# 210600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mackenzie's Mission_Reproductive Carrier Screening v0.19 YIF1B Zornitza Stark gene: YIF1B was added
gene: YIF1B was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YIF1B were set to 32006098; 26077767
Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement
Review for gene: YIF1B was set to GREEN
Added comment: 6 individuals (from 5 families) with biallelic YIF1B truncating variants reported. Presenting features: hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3. Affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function.
Sources: Expert Review
Microcephaly v0.473 UGP2 Zornitza Stark edited their review of gene: UGP2: Changed rating: GREEN
Microcephaly v0.473 UBE3A Zornitza Stark reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Angelman syndrome MIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Microcephaly v0.473 UBE3A Zornitza Stark Mode of inheritance for gene: UBE3A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)
Mackenzie's Mission_Reproductive Carrier Screening v0.18 DYNC1I2 Zornitza Stark gene: DYNC1I2 was added
gene: DYNC1I2 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: DYNC1I2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DYNC1I2 were set to 31079899
Phenotypes for gene: DYNC1I2 were set to Neurodevelopmental disorder with microcephaly and structural brain anomalies , MIM#618492
Review for gene: DYNC1I2 was set to GREEN
Added comment: Five individuals from three unrelated families reported.
Sources: Expert Review
Microcephaly v0.472 DPM1 Zornitza Stark reviewed gene: DPM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type Ie 608799; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.472 DNMT3A Zornitza Stark edited their review of gene: DNMT3A: Changed rating: GREEN
Angelman Rett like syndromes v0.14 FOXG1 Zornitza Stark Marked gene: FOXG1 as ready
Angelman Rett like syndromes v0.14 FOXG1 Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence).
Angelman Rett like syndromes v0.14 FOXG1 Zornitza Stark Phenotypes for gene: FOXG1 were changed from to Rett syndrome, congenital variant, MIM# 613454
Angelman Rett like syndromes v0.13 FOXG1 Zornitza Stark Publications for gene: FOXG1 were set to
Angelman Rett like syndromes v0.12 FOXG1 Zornitza Stark Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Angelman Rett like syndromes v0.11 FOXG1 Zornitza Stark reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21441262, 19564653, 19578037; Phenotypes: Rett syndrome, congenital variant, MIM# 613454; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.472 FOXG1 Zornitza Stark Marked gene: FOXG1 as ready
Microcephaly v0.472 FOXG1 Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence).
Microcephaly v0.472 FOXG1 Zornitza Stark Phenotypes for gene: FOXG1 were changed from to Rett syndrome, congenital variant, MIM# 613454
Microcephaly v0.471 FOXG1 Zornitza Stark Publications for gene: FOXG1 were set to
Microcephaly v0.470 FOXG1 Zornitza Stark Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.469 FOXG1 Zornitza Stark edited their review of gene: FOXG1: Changed rating: GREEN; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.469 FOXG1 Zornitza Stark reviewed gene: FOXG1: Rating: ; Mode of pathogenicity: None; Publications: 21441262, 19564653, 19578037; Phenotypes: Rett syndrome, congenital variant, MIM# 613454; Mode of inheritance: None
Mendeliome v0.4229 FDXR Zornitza Stark Marked gene: FDXR as ready
Mendeliome v0.4229 FDXR Zornitza Stark Gene: fdxr has been classified as Green List (High Evidence).
Mendeliome v0.4229 FDXR Zornitza Stark Phenotypes for gene: FDXR were changed from to Auditory neuropathy and optic atrophy, MIM#617717
Mendeliome v0.4228 FDXR Zornitza Stark Publications for gene: FDXR were set to
Mendeliome v0.4227 FDXR Zornitza Stark Mode of inheritance for gene: FDXR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4226 FDXR Zornitza Stark edited their review of gene: FDXR: Added comment: Four families reported with bi-allelic variants in FDXR causing an autosomal recessive neurologic disorder characterised by onset of visual and hearing impairment in the first or second decades. Two individuals described with a more severe progressive neurological phenotype. Mouse model exhibits neurodegeneration.; Changed rating: GREEN; Changed publications: 30250212, 28965846
Regression v0.148 FDXR Zornitza Stark Marked gene: FDXR as ready
Regression v0.148 FDXR Zornitza Stark Gene: fdxr has been classified as Amber List (Moderate Evidence).
Regression v0.148 FDXR Zornitza Stark Phenotypes for gene: FDXR were changed from to Auditory neuropathy and optic atrophy, MIM# 617717
Regression v0.147 FDXR Zornitza Stark Publications for gene: FDXR were set to
Regression v0.146 FDXR Zornitza Stark Mode of inheritance for gene: FDXR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.145 FDXR Zornitza Stark Classified gene: FDXR as Amber List (moderate evidence)
Regression v0.145 FDXR Zornitza Stark Gene: fdxr has been classified as Amber List (Moderate Evidence).
Regression v0.144 FDXR Zornitza Stark reviewed gene: FDXR: Rating: AMBER; Mode of pathogenicity: None; Publications: 30250212; Phenotypes: Auditory neuropathy and optic atrophy, MIM# 617717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2959 FDXR Zornitza Stark Publications for gene: FDXR were set to
Intellectual disability syndromic and non-syndromic v0.2958 FDXR Zornitza Stark changed review comment from: ID is not part of the phenotype.; to: Bi-allelic variants in FDXR cause an autosomal recessive neurologic disorder characterised by onset of visual and hearing impairment in the first or second decades. Two individuals described with a more severe phenotype, including one with intellectual disability.
Intellectual disability syndromic and non-syndromic v0.2958 FDXR Zornitza Stark edited their review of gene: FDXR: Changed publications: 30250212
Microcephaly v0.469 FDXR Zornitza Stark Marked gene: FDXR as ready
Microcephaly v0.469 FDXR Zornitza Stark Gene: fdxr has been classified as Red List (Low Evidence).
Microcephaly v0.469 FDXR Zornitza Stark Phenotypes for gene: FDXR were changed from to Auditory neuropathy and optic atrophy, MIM# 617717
Microcephaly v0.468 FDXR Zornitza Stark Publications for gene: FDXR were set to
Microcephaly v0.467 FDXR Zornitza Stark Mode of inheritance for gene: FDXR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.466 FDXR Zornitza Stark Classified gene: FDXR as Red List (low evidence)
Microcephaly v0.466 FDXR Zornitza Stark Gene: fdxr has been classified as Red List (Low Evidence).
Microcephaly v0.465 FDXR Zornitza Stark reviewed gene: FDXR: Rating: RED; Mode of pathogenicity: None; Publications: 30250212; Phenotypes: Auditory neuropathy and optic atrophy, MIM# 617717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4226 EXOC7 Zornitza Stark Marked gene: EXOC7 as ready
Mendeliome v0.4226 EXOC7 Zornitza Stark Gene: exoc7 has been classified as Green List (High Evidence).
Mendeliome v0.4226 EXOC7 Zornitza Stark Classified gene: EXOC7 as Green List (high evidence)
Mendeliome v0.4226 EXOC7 Zornitza Stark Gene: exoc7 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2958 EIF2S3 Zornitza Stark Marked gene: EIF2S3 as ready
Intellectual disability syndromic and non-syndromic v0.2958 EIF2S3 Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2958 EIF2S3 Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome, MIM# 300148
Intellectual disability syndromic and non-syndromic v0.2957 EIF2S3 Zornitza Stark Publications for gene: EIF2S3 were set to
Intellectual disability syndromic and non-syndromic v0.2956 EIF2S3 Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.2955 EIF2S3 Zornitza Stark reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23063529, 27333055, 28055140, 32799315; Phenotypes: MEHMO syndrome, MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.465 EIF2S3 Zornitza Stark Marked gene: EIF2S3 as ready
Microcephaly v0.465 EIF2S3 Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence).
Mendeliome v0.4225 EIF2S3 Zornitza Stark Marked gene: EIF2S3 as ready
Mendeliome v0.4225 EIF2S3 Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence).
Mendeliome v0.4225 EIF2S3 Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome, MIM# 300148
Mendeliome v0.4224 EIF2S3 Zornitza Stark Publications for gene: EIF2S3 were set to
Mendeliome v0.4223 EIF2S3 Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4222 EIF2S3 Zornitza Stark reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23063529, 27333055, 28055140, 32799315; Phenotypes: MEHMO syndrome, MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.465 EIF2S3 Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome, MIM# 300148
Microcephaly v0.464 EIF2S3 Zornitza Stark Publications for gene: EIF2S3 were set to
Microcephaly v0.463 EIF2S3 Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.462 EIF2S3 Zornitza Stark reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23063529, 27333055, 28055140, 32799315; Phenotypes: MEHMO syndrome, MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mitochondrial disease v0.479 IDH3A Zornitza Stark Phenotypes for gene: IDH3A were changed from Retinitis pigmentosa to Retinitis pigmentosa 90, MIM#619007
Mitochondrial disease v0.478 IDH3A Zornitza Stark edited their review of gene: IDH3A: Changed phenotypes: Retinitis pigmentosa 90, MIM#619007
Mendeliome v0.4222 IDH3A Zornitza Stark Phenotypes for gene: IDH3A were changed from Retinitis pigmentosa to Retinitis pigmentosa 90, MIM#619007
Mendeliome v0.4221 IDH3A Zornitza Stark edited their review of gene: IDH3A: Changed phenotypes: Retinitis pigmentosa 90, MIM#619007
Retinitis pigmentosa v0.60 IDH3A Zornitza Stark Marked gene: IDH3A as ready
Retinitis pigmentosa v0.60 IDH3A Zornitza Stark Gene: idh3a has been classified as Green List (High Evidence).
Retinitis pigmentosa v0.60 IDH3A Zornitza Stark Phenotypes for gene: IDH3A were changed from Retinitis pigmentosa; Leber congenital amaurosis to Retinitis pigmentosa, MIM#619007; Leber congenital amaurosis
Intellectual disability syndromic and non-syndromic v0.2955 SETD1B Zornitza Stark Phenotypes for gene: SETD1B were changed from SETD1B-related neurodevelopmental disorder to Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000
Genetic Epilepsy v0.843 SETD1B Zornitza Stark Phenotypes for gene: SETD1B were changed from Epilepsy with myoclonic absences; intellectual disability; SETD1B-related neurodevelopmental disorder to Epilepsy with myoclonic absences; intellectual disability; Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000
Mendeliome v0.4221 SETD1B Zornitza Stark Phenotypes for gene: SETD1B were changed from Epilepsy with myoclonic absences; intellectual disability; SETD1B-related neurodevelopmental disorder to Epilepsy with myoclonic absences; intellectual disability; Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000
Atypical Haemolytic Uraemic Syndrome_MPGN v0.32 CD46 Zornitza Stark Marked gene: CD46 as ready
Atypical Haemolytic Uraemic Syndrome_MPGN v0.32 CD46 Zornitza Stark Gene: cd46 has been classified as Green List (High Evidence).
Atypical Haemolytic Uraemic Syndrome_MPGN v0.32 CD46 Zornitza Stark Phenotypes for gene: CD46 were changed from to {Susceptibility to atypical hemolytic uremic syndrome 2} (MIM#612922), AD, AR; Atypical hemolytic uremic syndrome 2
Atypical Haemolytic Uraemic Syndrome_MPGN v0.31 CD46 Zornitza Stark Publications for gene: CD46 were set to
Atypical Haemolytic Uraemic Syndrome_MPGN v0.30 CD46 Zornitza Stark Mode of inheritance for gene: CD46 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Genetic Epilepsy v0.842 TRIP13 Zornitza Stark Marked gene: TRIP13 as ready
Genetic Epilepsy v0.842 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.842 TRIP13 Zornitza Stark Phenotypes for gene: TRIP13 were changed from to Mosaic variegated aneuploidy syndrome 3, MIM# 617598
Genetic Epilepsy v0.841 TRIP13 Zornitza Stark Publications for gene: TRIP13 were set to
Genetic Epilepsy v0.840 TRIP13 Zornitza Stark Mode of inheritance for gene: TRIP13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.839 TRIP13 Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence)
Genetic Epilepsy v0.839 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v0.838 TRIP13 Zornitza Stark reviewed gene: TRIP13: Rating: AMBER; Mode of pathogenicity: None; Publications: 28553959; Phenotypes: Mosaic variegated aneuploidy syndrome 3, MIM# 617598; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.462 TRIP13 Zornitza Stark Marked gene: TRIP13 as ready
Microcephaly v0.462 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.462 TRIP13 Zornitza Stark Phenotypes for gene: TRIP13 were changed from to Mosaic variegated aneuploidy syndrome 3, MIM# 617598
Microcephaly v0.461 TRIP13 Zornitza Stark Publications for gene: TRIP13 were set to
Microcephaly v0.460 TRIP13 Zornitza Stark Tag founder tag was added to gene: TRIP13.
Intellectual disability syndromic and non-syndromic v0.2954 TRIP13 Zornitza Stark Tag founder tag was added to gene: TRIP13.
Microcephaly v0.460 TRIP13 Zornitza Stark Mode of inheritance for gene: TRIP13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2954 TRIP13 Zornitza Stark changed review comment from: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable.; to: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable. Also note 5/6 reported families had the same homozygous variant, p.Arg354X, suggestive of founder effect.
Microcephaly v0.459 TRIP13 Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence)
Microcephaly v0.459 TRIP13 Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.458 TRIP13 Zornitza Stark reviewed gene: TRIP13: Rating: AMBER; Mode of pathogenicity: None; Publications: 28553959; Phenotypes: Mosaic variegated aneuploidy syndrome 3, MIM# 617598; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.838 TRAPPC6B Zornitza Stark Marked gene: TRAPPC6B as ready
Genetic Epilepsy v0.838 TRAPPC6B Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence).
Genetic Epilepsy v0.838 TRAPPC6B Zornitza Stark Publications for gene: TRAPPC6B were set to 28626029; 28397838; 31687267
Genetic Epilepsy v0.837 TRAPPC6B Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Regression v0.144 TRAPPC6B Zornitza Stark Marked gene: TRAPPC6B as ready
Regression v0.144 TRAPPC6B Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence).
Regression v0.144 TRAPPC6B Zornitza Stark Classified gene: TRAPPC6B as Green List (high evidence)
Regression v0.144 TRAPPC6B Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence).
Genetic Epilepsy v0.836 TRAPPC6B Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Genetic Epilepsy v0.836 TRAPPC6B Zornitza Stark Publications for gene: TRAPPC6B were set to
Genetic Epilepsy v0.835 TRAPPC6B Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.143 TRAPPC6B Zornitza Stark gene: TRAPPC6B was added
gene: TRAPPC6B was added to Regression. Sources: Expert Review
Mode of inheritance for gene: TRAPPC6B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC6B were set to 28626029; 28397838; 31687267
Phenotypes for gene: TRAPPC6B were set to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Review for gene: TRAPPC6B was set to GREEN
Added comment: Five unrelated families reported with autosomal recessive neurodegenerative disorder characterised by global developmental delay, severe intellectual disability with poor or absent speech and autistic stereotypic behaviors, microcephaly, early-onset generalized seizures, and hypotonia.
Sources: Expert Review
Genetic Epilepsy v0.834 TRAPPC6B Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2954 TRAPPC6B Zornitza Stark Marked gene: TRAPPC6B as ready
Intellectual disability syndromic and non-syndromic v0.2954 TRAPPC6B Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2954 TRAPPC6B Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Intellectual disability syndromic and non-syndromic v0.2953 TRAPPC6B Zornitza Stark Publications for gene: TRAPPC6B were set to
Intellectual disability syndromic and non-syndromic v0.2952 TRAPPC6B Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2951 TRAPPC6B Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4220 TRAPPC6B Zornitza Stark Marked gene: TRAPPC6B as ready
Mendeliome v0.4220 TRAPPC6B Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence).
Mendeliome v0.4220 TRAPPC6B Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Mendeliome v0.4219 TRAPPC6B Zornitza Stark Publications for gene: TRAPPC6B were set to
Mackenzie's Mission_Reproductive Carrier Screening v0.17 TRAPPC6B Zornitza Stark gene: TRAPPC6B was added
gene: TRAPPC6B was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: TRAPPC6B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC6B were set to 28626029; 28397838; 31687267
Phenotypes for gene: TRAPPC6B were set to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Review for gene: TRAPPC6B was set to GREEN
Added comment: Five unrelated families reported with autosomal recessive neurodegenerative disorder characterised by global developmental delay, severe intellectual disability with poor or absent speech and autistic stereotypic behaviors, microcephaly, early-onset generalized seizures, and hypotonia.
Sources: Expert Review
Mendeliome v0.4218 TRAPPC6B Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.458 TRAPPC6B Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862
Mendeliome v0.4217 TRAPPC6B Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.457 TRAPPC6B Zornitza Stark Publications for gene: TRAPPC6B were set to
Microcephaly v0.456 TRAPPC6B Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.455 TRAPPC6B Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.455 TRAPPC12 Zornitza Stark Marked gene: TRAPPC12 as ready
Microcephaly v0.455 TRAPPC12 Zornitza Stark Gene: trappc12 has been classified as Green List (High Evidence).
Regression v0.142 TRAPPC12 Zornitza Stark Marked gene: TRAPPC12 as ready
Regression v0.142 TRAPPC12 Zornitza Stark Gene: trappc12 has been classified as Green List (High Evidence).
Regression v0.142 TRAPPC12 Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669
Regression v0.141 TRAPPC12 Zornitza Stark Publications for gene: TRAPPC12 were set to
Regression v0.140 TRAPPC12 Zornitza Stark Mode of inheritance for gene: TRAPPC12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.139 TRAPPC12 Zornitza Stark reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mackenzie's Mission_Reproductive Carrier Screening v0.16 TRAPPC12 Zornitza Stark gene: TRAPPC12 was added
gene: TRAPPC12 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: TRAPPC12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC12 were set to 32369837; 28777934
Phenotypes for gene: TRAPPC12 were set to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669
Review for gene: TRAPPC12 was set to GREEN
Added comment: Four families reported with a severe progressive encephalopathy characterized by microcephaly, global developmental delay, and hearing loss.
Sources: Expert Review
Mendeliome v0.4217 TRAPPC12 Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669
Mendeliome v0.4216 TRAPPC12 Zornitza Stark Publications for gene: TRAPPC12 were set to
Mendeliome v0.4215 TRAPPC12 Zornitza Stark Mode of inheritance for gene: TRAPPC12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4214 TRAPPC12 Zornitza Stark reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.455 TRAPPC12 Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669
Microcephaly v0.454 TRAPPC12 Zornitza Stark Publications for gene: TRAPPC12 were set to
Microcephaly v0.453 TRAPPC12 Zornitza Stark Mode of inheritance for gene: TRAPPC12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.452 TRAPPC12 Zornitza Stark reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mackenzie's Mission_Reproductive Carrier Screening v0.15 TPRKB Zornitza Stark gene: TPRKB was added
gene: TPRKB was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: TPRKB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TPRKB were set to 28805828; 30053862
Phenotypes for gene: TPRKB were set to Galloway-Mowat syndrome 5, MIM# 617731
Review for gene: TPRKB was set to GREEN
Added comment: Three unrelated families reported with renal-neurologic disease characterized by early-onset nephrotic syndrome associated with microcephaly.
Sources: Expert Review
Mendeliome v0.4214 TPRKB Zornitza Stark Marked gene: TPRKB as ready
Mendeliome v0.4214 TPRKB Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence).
Mendeliome v0.4214 TPRKB Zornitza Stark Phenotypes for gene: TPRKB were changed from to Galloway-Mowat syndrome 5, MIM# 617731
Mendeliome v0.4213 TPRKB Zornitza Stark Publications for gene: TPRKB were set to
Mendeliome v0.4212 TPRKB Zornitza Stark Mode of inheritance for gene: TPRKB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4211 TPRKB Zornitza Stark reviewed gene: TPRKB: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 5, MIM# 617731; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.452 TPRKB Zornitza Stark Marked gene: TPRKB as ready
Microcephaly v0.452 TPRKB Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence).
Microcephaly v0.452 TPRKB Zornitza Stark Phenotypes for gene: TPRKB were changed from to Galloway-Mowat syndrome 5, MIM# 617731
Microcephaly v0.451 TPRKB Zornitza Stark Publications for gene: TPRKB were set to
Microcephaly v0.450 TPRKB Zornitza Stark Mode of inheritance for gene: TPRKB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.449 TPRKB Zornitza Stark reviewed gene: TPRKB: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 5, MIM# 617731; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.133 TP53RK Zornitza Stark Marked gene: TP53RK as ready
Proteinuria v0.133 TP53RK Zornitza Stark Gene: tp53rk has been classified as Green List (High Evidence).
Mackenzie's Mission_Reproductive Carrier Screening v0.14 TP53RK Zornitza Stark gene: TP53RK was added
gene: TP53RK was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review
Mode of inheritance for gene: TP53RK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TP53RK were set to 28805828; 30053862
Phenotypes for gene: TP53RK were set to Galloway-Mowat syndrome 4, MIM# 617730
Review for gene: TP53RK was set to GREEN
Added comment: At least 4 unrelated families reported with renal-neurologic disease characterised by early-onset nephrotic syndrome associated with microcephaly, gyral abnormalities, and delayed psychomotor development. Most individuals have dysmorphic facial features, often including hypertelorism, ear abnormalities, and micrognathia. Other features, such as arachnodactyly and visual impairment, are more variable.
Sources: Expert Review
Proteinuria v0.133 TP53RK Zornitza Stark Phenotypes for gene: TP53RK were changed from to Galloway-Mowat syndrome 4, MIM# 617730
Proteinuria v0.132 TP53RK Zornitza Stark Publications for gene: TP53RK were set to
Proteinuria v0.131 TP53RK Zornitza Stark Mode of inheritance for gene: TP53RK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.130 TP53RK Zornitza Stark reviewed gene: TP53RK: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 4, MIM# 617730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4211 TP53RK Zornitza Stark Marked gene: TP53RK as ready
Mendeliome v0.4211 TP53RK Zornitza Stark Gene: tp53rk has been classified as Green List (High Evidence).
Mendeliome v0.4211 TP53RK Zornitza Stark Phenotypes for gene: TP53RK were changed from to Galloway-Mowat syndrome 4, MIM# 617730
Mendeliome v0.4210 TP53RK Zornitza Stark Publications for gene: TP53RK were set to
Mendeliome v0.4209 TP53RK Zornitza Stark Mode of inheritance for gene: TP53RK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4208 TP53RK Zornitza Stark reviewed gene: TP53RK: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 4, MIM# 617730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.449 TP53RK Zornitza Stark Marked gene: TP53RK as ready
Microcephaly v0.449 TP53RK Zornitza Stark Gene: tp53rk has been classified as Green List (High Evidence).
Microcephaly v0.449 TP53RK Zornitza Stark Phenotypes for gene: TP53RK were changed from to Galloway-Mowat syndrome 4, MIM# 617730
Microcephaly v0.448 TP53RK Zornitza Stark Publications for gene: TP53RK were set to
Microcephaly v0.447 TP53RK Zornitza Stark Mode of inheritance for gene: TP53RK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.446 TP53RK Zornitza Stark reviewed gene: TP53RK: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 4, MIM# 617730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Atypical Haemolytic Uraemic Syndrome_MPGN v0.29 CD46 Kristin Rigbye reviewed gene: CD46: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26054645, 26826462; Phenotypes: {Susceptibility to atypical hemolytic uremic syndrome 2} (MIM#612922), AD, AR, Atypical hemolytic uremic syndrome 2; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Microcephaly v0.446 TCF4 Zornitza Stark Marked gene: TCF4 as ready
Microcephaly v0.446 TCF4 Zornitza Stark Gene: tcf4 has been classified as Green List (High Evidence).
Microcephaly v0.446 TCF4 Zornitza Stark Phenotypes for gene: TCF4 were changed from to Pitt-Hopkins syndrome, MIM# 610954
Microcephaly v0.445 TCF4 Zornitza Stark Publications for gene: TCF4 were set to
Microcephaly v0.444 TCF4 Zornitza Stark Mode of inheritance for gene: TCF4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.443 TCF4 Zornitza Stark reviewed gene: TCF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728071, 22934316; Phenotypes: Pitt-Hopkins syndrome, MIM# 610954; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mackenzie's Mission_Reproductive Carrier Screening v0.13 TBC1D20 Zornitza Stark gene: TBC1D20 was added
gene: TBC1D20 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list
Mode of inheritance for gene: TBC1D20 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBC1D20 were set to 24239381; 32740904; 32162791
Phenotypes for gene: TBC1D20 were set to Warburg micro syndrome 4, MIM# 615663; Martsolf syndrome
Review for gene: TBC1D20 was set to GREEN
Added comment: 7 unrelated families reported with autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. One of the families is described as Martsolf syndrome, the rest as Warburg micro.
Sources: Expert list
Mendeliome v0.4208 TBC1D20 Zornitza Stark Marked gene: TBC1D20 as ready
Mendeliome v0.4208 TBC1D20 Zornitza Stark Gene: tbc1d20 has been classified as Green List (High Evidence).
Mendeliome v0.4208 TBC1D20 Zornitza Stark Phenotypes for gene: TBC1D20 were changed from to Warburg micro syndrome 4, MIM# 615663; Martsolf syndrome
Mendeliome v0.4207 TBC1D20 Zornitza Stark Publications for gene: TBC1D20 were set to
Mendeliome v0.4206 TBC1D20 Zornitza Stark Mode of inheritance for gene: TBC1D20 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4205 TBC1D20 Zornitza Stark reviewed gene: TBC1D20: Rating: GREEN; Mode of pathogenicity: None; Publications: 24239381, 32740904, 32162791; Phenotypes: Warburg micro syndrome 4, MIM# 615663, Martsolf syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.443 TBC1D20 Zornitza Stark Marked gene: TBC1D20 as ready
Microcephaly v0.443 TBC1D20 Zornitza Stark Gene: tbc1d20 has been classified as Green List (High Evidence).
Microcephaly v0.443 TBC1D20 Zornitza Stark Phenotypes for gene: TBC1D20 were changed from to Warburg micro syndrome 4, MIM# 615663
Microcephaly v0.442 TBC1D20 Zornitza Stark Publications for gene: TBC1D20 were set to
Microcephaly v0.441 TBC1D20 Zornitza Stark Mode of inheritance for gene: TBC1D20 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.440 TBC1D20 Zornitza Stark reviewed gene: TBC1D20: Rating: GREEN; Mode of pathogenicity: None; Publications: 24239381; Phenotypes: Warburg micro syndrome 4, MIM# 615663; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mackenzie's Mission_Reproductive Carrier Screening v0.12 TMEM94 Zornitza Stark gene: TMEM94 was added
gene: TMEM94 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list
Mode of inheritance for gene: TMEM94 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM94 were set to 30526868
Phenotypes for gene: TMEM94 were set to Intellectual developmental disorder with cardiac defects and dysmorphic facies, MIM#618316
Review for gene: TMEM94 was set to GREEN
Added comment: 10 individuals from 6 unrelated families reported.
Sources: Expert list
Mendeliome v0.4205 DHX34 Zornitza Stark Marked gene: DHX34 as ready
Mendeliome v0.4205 DHX34 Zornitza Stark Gene: dhx34 has been classified as Red List (Low Evidence).
Mendeliome v0.4205 DHX34 Zornitza Stark gene: DHX34 was added
gene: DHX34 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: DHX34 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: DHX34 were set to 31256877
Phenotypes for gene: DHX34 were set to Intellectual disability; congenital anomalies
Review for gene: DHX34 was set to RED
Added comment: Three families reported. Two with bi-allelic variants and ID/multiple congenital anomalies but another molecular diagnosis present in both (variants in established genes). Single de novo missense in another individual with ID and dysmorphism. No supporting functional data. Overall RED rating for both MOI.
Sources: Literature
Mendeliome v0.4204 DDX54 Zornitza Stark Marked gene: DDX54 as ready
Mendeliome v0.4204 DDX54 Zornitza Stark Gene: ddx54 has been classified as Red List (Low Evidence).
Mendeliome v0.4204 DDX54 Zornitza Stark gene: DDX54 was added
gene: DDX54 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: DDX54 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: DDX54 were set to 31256877
Phenotypes for gene: DDX54 were set to Intellectual disability; congenital anomalies
Review for gene: DDX54 was set to RED
Added comment: Three individuals reported with different MOIs and different phenotypes. One with de novo variant and ID, another with bi-allelic variants and ID, and a third with bi-allelic variants and CAKUT. All variants are missense, no functional data. Overall, Red rating given inconsistent phenotypes and modes of inheritance, each one is essentially treated separately for now until further cases identified.
Sources: Literature
Mendeliome v0.4203 DHX16 Zornitza Stark Marked gene: DHX16 as ready
Mendeliome v0.4203 DHX16 Zornitza Stark Gene: dhx16 has been classified as Green List (High Evidence).
Mendeliome v0.4203 DHX16 Zornitza Stark Classified gene: DHX16 as Green List (high evidence)
Mendeliome v0.4203 DHX16 Zornitza Stark Gene: dhx16 has been classified as Green List (High Evidence).
Mendeliome v0.4202 DHX16 Zornitza Stark gene: DHX16 was added
gene: DHX16 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: DHX16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DHX16 were set to 31256877
Phenotypes for gene: DHX16 were set to Neuromuscular disease and ocular or auditory anomalies with or without seizures, MIM# 618733
Review for gene: DHX16 was set to GREEN
Added comment: Four unrelated individuals reported with de novo missense variants in this gene. Three of the individuals died in infancy, so phenotypic spectrum difficult to discern. Two had seizures. Individual with long-term survival had a progressive course, evidence of myopathy, loss of hearing and vision, and normal IQ.
Sources: Literature
Mendeliome v0.4201 DHX37 Zornitza Stark Phenotypes for gene: DHX37 were changed from 46,XY gonadal dysgenesis; testicular regression syndrome (TRS) to 46,XY gonadal dysgenesis; testicular regression syndrome (TRS); Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731
Mendeliome v0.4200 DHX37 Zornitza Stark Publications for gene: DHX37 were set to 31337883; 31745530
Mendeliome v0.4199 DHX37 Zornitza Stark Mode of inheritance for gene: DHX37 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4198 DHX37 Zornitza Stark changed review comment from: Seventeen individuals with 46,XY gonadal dysgenesis reported in two studies.
Sources: Literature; to: Mono-allelic disease: Seventeen individuals with 46,XY gonadal dysgenesis reported in two studies.
Sources: Literature
Mendeliome v0.4198 DHX37 Zornitza Stark edited their review of gene: DHX37: Added comment: Bi-allelic disease: 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype, which also includes congenital anomalies particularly affecting the vertebrae and heart, but also some with microcephaly, brain anomalies.; Changed publications: 31337883, 31745530, 26539891, 31256877; Changed phenotypes: 46,XY gonadal dysgenesis, testicular regression syndrome (TRS), Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2951 DHX37 Zornitza Stark changed review comment from: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease

Much less clear association between mono-allelic variants and ID, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease causing a neurodevelopmental phenotype at this stage. Note there is a separate association between mono allelic variants and DSD.; to: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease

Much less clear association between mono-allelic variants and ID, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic variants causing a neurodevelopmental phenotype at this stage. Note there is a separate association between mono allelic variants and DSD.
Intellectual disability syndromic and non-syndromic v0.2951 DHX37 Zornitza Stark changed review comment from: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease

Much less clear association between mono-allelic variants and disease, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease at this stage.; to: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease

Much less clear association between mono-allelic variants and ID, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease causing a neurodevelopmental phenotype at this stage. Note there is a separate association between mono allelic variants and DSD.
Intellectual disability syndromic and non-syndromic v0.2951 DHX37 Zornitza Stark Mode of inheritance for gene: DHX37 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2950 DHX37 Zornitza Stark changed review comment from: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype.

Much less clear association between mono-allelic variants and disease, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo.; to: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease

Much less clear association between mono-allelic variants and disease, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease at this stage.
Intellectual disability syndromic and non-syndromic v0.2950 DHX37 Zornitza Stark Marked gene: DHX37 as ready
Intellectual disability syndromic and non-syndromic v0.2950 DHX37 Zornitza Stark Gene: dhx37 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2950 DHX37 Zornitza Stark Classified gene: DHX37 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v0.2950 DHX37 Zornitza Stark Gene: dhx37 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2949 DHX37 Zornitza Stark reviewed gene: DHX37: Rating: GREEN; Mode of pathogenicity: None; Publications: 26539891, 31256877; Phenotypes: Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2949 DHX37 Naomi Baker gene: DHX37 was added
gene: DHX37 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: DHX37 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: DHX37 were set to PMID: 26539891; 31256877
Phenotypes for gene: DHX37 were set to Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731
Review for gene: DHX37 was set to GREEN
Added comment: Two unrelated patients from consanguineous families reported with biallelic missense variants. Clinical presentation included severe microcephaly, DD/ID, and cortical atrophy (PMID: 26539891).

Five individuals who share a phenotype of DD and/or ID and CNS dysfunction. Three out of five individuals also have scoliosis, and two have cardiac phenotypes (PMID: 31256877). Three of the patients had bialleleic missense variants, while two patients had a de novo monoallelic missense variant.

Note that OMIM lists inheritance as biallelic, however two monoallelic cases reportes.
Sources: Literature
Hypertrichosis syndromes v0.18 TMEM94 Alison Yeung Classified gene: TMEM94 as Green List (high evidence)
Hypertrichosis syndromes v0.18 TMEM94 Alison Yeung Gene: tmem94 has been classified as Green List (High Evidence).
Hypertrichosis syndromes v0.17 TMEM94 Alison Yeung Marked gene: TMEM94 as ready
Hypertrichosis syndromes v0.17 TMEM94 Alison Yeung Gene: tmem94 has been classified as Red List (Low Evidence).
Hypertrichosis syndromes v0.17 TMEM94 Alison Yeung gene: TMEM94 was added
gene: TMEM94 was added to Hypertrichosis syndromes. Sources: Literature
Mode of inheritance for gene: TMEM94 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMEM94 were set to 30526868
Phenotypes for gene: TMEM94 were set to OMIM# 618316 INTELLECTUAL DEVELOPMENTAL DISORDER WITH CARDIAC DEFECTS AND DYSMORPHIC FACIES; IDDCDF
Review for gene: TMEM94 was set to GREEN
Added comment: Sources: Literature
Mendeliome v0.4198 CFL2 Zornitza Stark Marked gene: CFL2 as ready
Mendeliome v0.4198 CFL2 Zornitza Stark Gene: cfl2 has been classified as Green List (High Evidence).
Mendeliome v0.4198 CFL2 Zornitza Stark Phenotypes for gene: CFL2 were changed from to Nemaline myopathy 7, autosomal recessive, MIM# 610687
Mendeliome v0.4197 CFL2 Zornitza Stark Publications for gene: CFL2 were set to
Mendeliome v0.4196 CFL2 Zornitza Stark Mode of inheritance for gene: CFL2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4195 CFL2 Zornitza Stark reviewed gene: CFL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17160903, 22560515, 32697999, 29457652, 24610938; Phenotypes: Nemaline myopathy 7, autosomal recessive, MIM# 610687; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cataract v0.231 TDRD7 Zornitza Stark Publications for gene: TDRD7 were set to 28837160; 21436445
Cataract v0.230 TDRD7 Zornitza Stark edited their review of gene: TDRD7: Added comment: PMID: 32420594 (2020) - Knockout mouse model recapitulates human cataracts phenotype and provides supporting functional data.; Changed publications: 28837160, 21436445, 32420594; Changed phenotypes: Cataract 36, 613887, glaucoma, nonobstructive azoospermia, arrested spermatogenesis
Mendeliome v0.4195 TDRD7 Zornitza Stark Marked gene: TDRD7 as ready
Mendeliome v0.4195 TDRD7 Zornitza Stark Gene: tdrd7 has been classified as Green List (High Evidence).
Mendeliome v0.4195 TDRD7 Zornitza Stark Phenotypes for gene: TDRD7 were changed from Cataract 36 613887; glaucoma; nonobstructive azoospermia; arrested spermatogenesis to Cataract 36, 613887; glaucoma; nonobstructive azoospermia; arrested spermatogenesis
Mendeliome v0.4194 TDRD7 Zornitza Stark Publications for gene: TDRD7 were set to 28837160; 21436445
Mendeliome v0.4193 TDRD7 Zornitza Stark reviewed gene: TDRD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cataract 36, MIM# 613887; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2949 PAK3 Zornitza Stark Marked gene: PAK3 as ready
Intellectual disability syndromic and non-syndromic v0.2949 PAK3 Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2949 PAK3 Zornitza Stark Phenotypes for gene: PAK3 were changed from to Mental retardation, X-linked 30/47, MIM# 300558; Intellectual disability
Intellectual disability syndromic and non-syndromic v0.2948 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Intellectual disability syndromic and non-syndromic v0.2947 PAK3 Zornitza Stark Mode of inheritance for gene: PAK3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4193 PAK3 Zornitza Stark Marked gene: PAK3 as ready
Mendeliome v0.4193 PAK3 Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2946 PAK3 Zornitza Stark reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9731525, 10946356, 12884430, 17853471, 18523455, 32050918, 32005903, 31943058, 31843706, 31678216; Phenotypes: Mental retardation, X-linked 30/47, MIM# 300558, Intellectual disability; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4193 PAK3 Zornitza Stark Phenotypes for gene: PAK3 were changed from to Mental retardation, X-linked 30/47, MIM# 300558; Intellectual disability
Mendeliome v0.4192 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Mendeliome v0.4191 PAK3 Zornitza Stark Mode of inheritance for gene: PAK3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4190 PAK3 Zornitza Stark reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9731525, 10946356, 12884430, 17853471, 18523455, 32050918, 32005903, 31943058, 31843706, 31678216; Phenotypes: Mental retardation, X-linked 30/47, MIM# 300558; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4190 CFL2 Arina Puzriakova reviewed gene: CFL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32160286; Phenotypes: Nemaline myopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4190 TDRD7 Arina Puzriakova reviewed gene: TDRD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32420594; Phenotypes: Congenital cataracts; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2946 CLTC Zornitza Stark Marked gene: CLTC as ready
Intellectual disability syndromic and non-syndromic v0.2946 CLTC Zornitza Stark Gene: cltc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2946 CLTC Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56, MIM# 617854
Intellectual disability syndromic and non-syndromic v0.2945 CLTC Zornitza Stark Publications for gene: CLTC were set to
Intellectual disability syndromic and non-syndromic v0.2944 CLTC Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2943 CLTC Zornitza Stark reviewed gene: CLTC: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100083, 26822784; Phenotypes: Mental retardation, autosomal dominant 56, MIM# 617854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.834 CLTC Zornitza Stark Marked gene: CLTC as ready
Genetic Epilepsy v0.834 CLTC Zornitza Stark Gene: cltc has been classified as Green List (High Evidence).
Genetic Epilepsy v0.834 CLTC Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56, MIM# 617854
Genetic Epilepsy v0.833 CLTC Zornitza Stark Publications for gene: CLTC were set to
Genetic Epilepsy v0.832 CLTC Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.831 CLTC Zornitza Stark reviewed gene: CLTC: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100083, 26822784; Phenotypes: Mental retardation, autosomal dominant 56, MIM# 617854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4190 CLTC Zornitza Stark Marked gene: CLTC as ready
Mendeliome v0.4190 CLTC Zornitza Stark Gene: cltc has been classified as Green List (High Evidence).
Mendeliome v0.4190 CLTC Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56, MIM# 617854
Mendeliome v0.4189 CLTC Zornitza Stark Publications for gene: CLTC were set to
Mendeliome v0.4188 CLTC Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4187 CLTC Zornitza Stark reviewed gene: CLTC: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100083, 26822784; Phenotypes: Mental retardation, autosomal dominant 56, MIM# 617854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.440 CLTC Zornitza Stark Marked gene: CLTC as ready
Microcephaly v0.440 CLTC Zornitza Stark Gene: cltc has been classified as Amber List (Moderate Evidence).
Microcephaly v0.440 CLTC Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56 (MIM#617854)
Microcephaly v0.439 CLTC Zornitza Stark Publications for gene: CLTC were set to
Microcephaly v0.438 CLTC Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.437 CLTC Zornitza Stark Classified gene: CLTC as Amber List (moderate evidence)
Microcephaly v0.437 CLTC Zornitza Stark Gene: cltc has been classified as Amber List (Moderate Evidence).
Microcephaly v0.436 RAB3GAP2 Zornitza Stark Marked gene: RAB3GAP2 as ready
Microcephaly v0.436 RAB3GAP2 Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence).
Mendeliome v0.4187 PAK3 Arina Puzriakova reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31943058; Phenotypes: Intellectual disability; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.436 STAG1 Zornitza Stark Marked gene: STAG1 as ready
Microcephaly v0.436 STAG1 Zornitza Stark Gene: stag1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.436 STAG1 Zornitza Stark Phenotypes for gene: STAG1 were changed from to Mental retardation, autosomal dominant 47, MIM# 617635
Microcephaly v0.435 STAG1 Zornitza Stark Publications for gene: STAG1 were set to
Microcephaly v0.434 STAG1 Zornitza Stark Mode of inheritance for gene: STAG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.433 STAG1 Zornitza Stark Classified gene: STAG1 as Amber List (moderate evidence)
Microcephaly v0.433 STAG1 Zornitza Stark Gene: stag1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.432 STAG1 Zornitza Stark reviewed gene: STAG1: Rating: AMBER; Mode of pathogenicity: None; Publications: 28119487; Phenotypes: Mental retardation, autosomal dominant 47, MIM# 617635; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.432 SMC3 Zornitza Stark Marked gene: SMC3 as ready
Microcephaly v0.432 SMC3 Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence).
Microcephaly v0.432 SMC3 Zornitza Stark Classified gene: SMC3 as Green List (high evidence)
Microcephaly v0.432 SMC3 Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence).
Microcephaly v0.431 SMC3 Zornitza Stark gene: SMC3 was added
gene: SMC3 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: SMC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMC3 were set to Cornelia de Lange syndrome 3, MIM# 610759
Review for gene: SMC3 was set to GREEN
Added comment: Well established gene-disease association, microcephaly is part of the phenotype.
Sources: Expert list
Microcephaly v0.430 SMC1A Zornitza Stark Marked gene: SMC1A as ready
Microcephaly v0.430 SMC1A Zornitza Stark Gene: smc1a has been classified as Green List (High Evidence).
Microcephaly v0.430 SMC1A Zornitza Stark Classified gene: SMC1A as Green List (high evidence)
Microcephaly v0.430 SMC1A Zornitza Stark Gene: smc1a has been classified as Green List (High Evidence).
Microcephaly v0.429 SMC1A Zornitza Stark gene: SMC1A was added
gene: SMC1A was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: SMC1A was set to Other
Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome 2, MIM# 300590
Review for gene: SMC1A was set to GREEN
Added comment: XLD. Well established gene-disease association. Microcephaly is part of the phenotype.
Sources: Expert list
Microcephaly v0.428 SLX4 Zornitza Stark Marked gene: SLX4 as ready
Microcephaly v0.428 SLX4 Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence).
Microcephaly v0.428 SLX4 Zornitza Stark Classified gene: SLX4 as Green List (high evidence)
Microcephaly v0.428 SLX4 Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence).
Microcephaly v0.427 SLX4 Zornitza Stark gene: SLX4 was added
gene: SLX4 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: SLX4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLX4 were set to Fanconi anemia, complementation group P, MIM#613951
Review for gene: SLX4 was set to GREEN
Added comment: Established gene-disease association, microcephaly is part of the phenotype.
Sources: Expert list
Microcephaly v0.426 SLC2A1 Zornitza Stark Marked gene: SLC2A1 as ready
Microcephaly v0.426 SLC2A1 Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence).
Microcephaly v0.426 SLC2A1 Zornitza Stark Phenotypes for gene: SLC2A1 were changed from to GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777
Microcephaly v0.425 SLC2A1 Zornitza Stark Mode of inheritance for gene: SLC2A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.424 SLC2A1 Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.424 SLC1A4 Zornitza Stark Marked gene: SLC1A4 as ready
Microcephaly v0.424 SLC1A4 Zornitza Stark Gene: slc1a4 has been classified as Green List (High Evidence).
Microcephaly v0.424 SLC1A4 Zornitza Stark Phenotypes for gene: SLC1A4 were changed from to Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657
Mendeliome v0.4187 SLC1A4 Zornitza Stark reviewed gene: SLC1A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25930971, 26138499, 26041762, 27193218, 29989513; Phenotypes: Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.423 SLC1A4 Zornitza Stark Publications for gene: SLC1A4 were set to
Microcephaly v0.422 SLC1A4 Zornitza Stark Tag founder tag was added to gene: SLC1A4.
Microcephaly v0.422 SLC1A4 Zornitza Stark Mode of inheritance for gene: SLC1A4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.421 SLC1A4 Zornitza Stark reviewed gene: SLC1A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25930971, 26138499, 26041762, 27193218, 29989513; Phenotypes: Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.421 RUSC2 Zornitza Stark reviewed gene: RUSC2: Rating: AMBER; Mode of pathogenicity: None; Publications: 27612186; Phenotypes: Mental retardation, autosomal recessive 61, MIM# 617773; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4187 RPL10 Zornitza Stark Marked gene: RPL10 as ready
Mendeliome v0.4187 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Mendeliome v0.4187 RPL10 Zornitza Stark Phenotypes for gene: RPL10 were changed from to Mental retardation, X-linked, syndromic, 35, MIM# 300998
Mendeliome v0.4186 RPL10 Zornitza Stark Publications for gene: RPL10 were set to
Mendeliome v0.4185 RPL10 Zornitza Stark Mode of inheritance for gene: RPL10 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4184 RPL10 Zornitza Stark reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Mental retardation, X-linked, syndromic, 35, MIM# 300998; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.421 RPL10 Zornitza Stark Marked gene: RPL10 as ready
Microcephaly v0.421 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Microcephaly v0.421 RPL10 Zornitza Stark Classified gene: RPL10 as Green List (high evidence)
Microcephaly v0.421 RPL10 Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence).
Microcephaly v0.420 RPL10 Zornitza Stark gene: RPL10 was added
gene: RPL10 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: RPL10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: RPL10 were set to 25316788; 25846674; 26290468
Phenotypes for gene: RPL10 were set to Mental retardation, X-linked, syndromic, 35, MIM# 300998
Review for gene: RPL10 was set to GREEN
Added comment: At least three families reported. Progressive microcephaly, up to -9.6 SD described.
Sources: Expert list
Microcephaly v0.419 RNU4ATAC Zornitza Stark Marked gene: RNU4ATAC as ready
Microcephaly v0.419 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Microcephaly v0.419 RNU4ATAC Zornitza Stark Classified gene: RNU4ATAC as Green List (high evidence)
Microcephaly v0.419 RNU4ATAC Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence).
Microcephaly v0.418 RNU4ATAC Zornitza Stark gene: RNU4ATAC was added
gene: RNU4ATAC was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: RNU4ATAC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNU4ATAC were set to 21474760; 20301772
Phenotypes for gene: RNU4ATAC were set to Microcephalic osteodysplastic primordial dwarfism, type I, MIM# 210710
Review for gene: RNU4ATAC was set to GREEN
Added comment: Established gene-disease association
Sources: Expert list
Mendeliome v0.4184 IFT122 Zornitza Stark Marked gene: IFT122 as ready
Mendeliome v0.4184 IFT122 Zornitza Stark Gene: ift122 has been classified as Green List (High Evidence).
Mendeliome v0.4184 IFT122 Zornitza Stark Phenotypes for gene: IFT122 were changed from to Cranioectodermal dysplasia 1, MIM# MIM#218330
Mendeliome v0.4183 IFT122 Zornitza Stark Publications for gene: IFT122 were set to
Mendeliome v0.4182 IFT122 Zornitza Stark Mode of inheritance for gene: IFT122 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4181 IFT122 Zornitza Stark reviewed gene: IFT122: Rating: GREEN; Mode of pathogenicity: None; Publications: 26792575, 28370949, 29037998; Phenotypes: Cranioectodermal dysplasia 1, MIM# MIM#218330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Defects of intrinsic and innate immunity v0.42 JAK1 Zornitza Stark Phenotypes for gene: JAK1 were changed from Susceptibility to mycobacteria and viruses to Susceptibility to mycobacteria and viruses; Viral infections; Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999
Defects of intrinsic and innate immunity v0.41 JAK1 Zornitza Stark edited their review of gene: JAK1: Changed phenotypes: Susceptibility to mycobacteria and viruses, Viral infections, Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999
Disorders of immune dysregulation v0.62 JAK1 Zornitza Stark Phenotypes for gene: JAK1 were changed from Eosinophilia; Eosinophilic enteritis; Thyroid disease; Poor growth; Viral infections to Eosinophilia; Eosinophilic enteritis; Thyroid disease; Poor growth; Viral infections; Viral infections; Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999
Disorders of immune dysregulation v0.61 JAK1 Zornitza Stark edited their review of gene: JAK1: Changed phenotypes: Eosinophilia, Eosinophilic enteritis, Thyroid disease, Poor growth, Viral infections, Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999
Mendeliome v0.4181 JAK1 Zornitza Stark edited their review of gene: JAK1: Changed phenotypes: Eosinophilia, Eosinophilic enteritis, Thyroid disease, Poor growth, Viral infections, Susceptibility to mycobacteria and viruses, Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999
Mendeliome v0.4181 RC3H1 Zornitza Stark Phenotypes for gene: RC3H1 were changed from Relapsing HLH to Relapsing HLH; Hemophagocytic lymphohistiocytosis, familial, 6, MIM# 618998
Mendeliome v0.4180 RC3H1 Zornitza Stark edited their review of gene: RC3H1: Changed phenotypes: Relapsing HLH, Hemophagocytic lymphohistiocytosis, familial, 6, MIM# 618998
Autoinflammatory Disorders v0.94 RC3H1 Zornitza Stark Phenotypes for gene: RC3H1 were changed from Relapsing HLH to Relapsing HLH; Hemophagocytic lymphohistiocytosis, familial, 6, MIM# 618998
Autoinflammatory Disorders v0.93 RC3H1 Zornitza Stark edited their review of gene: RC3H1: Changed phenotypes: Relapsing HLH, Hemophagocytic lymphohistiocytosis, familial, 6 618998
Mendeliome v0.4180 KIAA0319 Zornitza Stark Marked gene: KIAA0319 as ready
Mendeliome v0.4180 KIAA0319 Zornitza Stark Gene: kiaa0319 has been classified as Red List (Low Evidence).
Mendeliome v0.4180 KIAA0319 Zornitza Stark Phenotypes for gene: KIAA0319 were changed from to {Dyslexia, susceptibility to, 2}, MIM#600202
Mendeliome v0.4179 KIAA0319 Zornitza Stark Classified gene: KIAA0319 as Red List (low evidence)
Mendeliome v0.4179 KIAA0319 Zornitza Stark Gene: kiaa0319 has been classified as Red List (Low Evidence).
Mendeliome v0.4178 RARS2 Zornitza Stark Marked gene: RARS2 as ready
Mendeliome v0.4178 RARS2 Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence).
Mendeliome v0.4178 RARS2 Zornitza Stark Phenotypes for gene: RARS2 were changed from Pontocerebellar hypoplasia, type 6, MIM# 611523 to Pontocerebellar hypoplasia, type 6, MIM# 611523; early onset cerebellar ataxia
Mendeliome v0.4177 RARS2 Zornitza Stark Publications for gene: RARS2 were set to 17847012; 25809939; 20635367
Mendeliome v0.4176 RARS2 Zornitza Stark Phenotypes for gene: RARS2 were changed from to Pontocerebellar hypoplasia, type 6, MIM# 611523
Mendeliome v0.4175 RARS2 Zornitza Stark Publications for gene: RARS2 were set to
Mendeliome v0.4174 RARS2 Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4173 RARS2 Zornitza Stark edited their review of gene: RARS2: Changed rating: GREEN; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.417 RARS2 Zornitza Stark Marked gene: RARS2 as ready
Microcephaly v0.417 RARS2 Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence).
Microcephaly v0.417 RARS2 Zornitza Stark Phenotypes for gene: RARS2 were changed from to Pontocerebellar hypoplasia, type 6, MIM# 611523
Microcephaly v0.416 RARS2 Zornitza Stark Publications for gene: RARS2 were set to
Microcephaly v0.415 RARS2 Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.414 RARS2 Zornitza Stark reviewed gene: RARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17847012, 20635367, 25809939; Phenotypes: Pontocerebellar hypoplasia, type 6, MIM# 611523; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4173 RAD21 Zornitza Stark Mode of inheritance for gene: RAD21 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.4172 KIAA0319 Naomi Baker reviewed gene: KIAA0319: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: {Dyslexia, susceptibility to, 2}, MIM#600202; Mode of inheritance: None
Microcephaly v0.414 RAD21 Zornitza Stark Marked gene: RAD21 as ready
Microcephaly v0.414 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Microcephaly v0.414 RAD21 Zornitza Stark Classified gene: RAD21 as Green List (high evidence)
Microcephaly v0.414 RAD21 Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence).
Microcephaly v0.413 RAD21 Zornitza Stark gene: RAD21 was added
gene: RAD21 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: RAD21 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAD21 were set to 22633399; 32193685
Phenotypes for gene: RAD21 were set to Cornelia de Lange syndrome 4, MIM# 614701
Review for gene: RAD21 was set to GREEN
Added comment: Microcephaly reported in around 50% of affected individuals in a recent large series.
Sources: Expert list
Mendeliome v0.4172 RAB3GAP2 Zornitza Stark Marked gene: RAB3GAP2 as ready
Mendeliome v0.4172 RAB3GAP2 Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence).
Mendeliome v0.4172 RAB3GAP2 Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from to Warburg micro syndrome 2, MIM# 614225
Mendeliome v0.4171 RAB3GAP2 Zornitza Stark Publications for gene: RAB3GAP2 were set to
Mendeliome v0.4170 RAB3GAP2 Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.412 RAB3GAP2 Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from to Warburg micro syndrome 2, MIM# 614225
Mendeliome v0.4169 RAB3GAP2 Zornitza Stark reviewed gene: RAB3GAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23420520, 20967465; Phenotypes: Warburg micro syndrome 2, MIM# 614225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.411 RAB3GAP2 Zornitza Stark Publications for gene: RAB3GAP2 were set to
Microcephaly v0.410 RAB3GAP2 Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.409 RAB3GAP2 Zornitza Stark reviewed gene: RAB3GAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23420520, 20967465; Phenotypes: Warburg micro syndrome 2, MIM# 614225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4169 RAB3GAP1 Zornitza Stark Marked gene: RAB3GAP1 as ready
Mendeliome v0.4169 RAB3GAP1 Zornitza Stark Gene: rab3gap1 has been classified as Green List (High Evidence).
Mendeliome v0.4169 RAB3GAP1 Zornitza Stark Phenotypes for gene: RAB3GAP1 were changed from to Warburg micro syndrome 1, MIM# 600118
Mendeliome v0.4168 RAB3GAP1 Zornitza Stark Publications for gene: RAB3GAP1 were set to
Mendeliome v0.4167 RAB3GAP1 Zornitza Stark Mode of inheritance for gene: RAB3GAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4166 RAB3GAP1 Zornitza Stark reviewed gene: RAB3GAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15696165, 20512159, 23420520; Phenotypes: Warburg micro syndrome 1, MIM# 600118; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.409 RAB3GAP1 Zornitza Stark Marked gene: RAB3GAP1 as ready
Microcephaly v0.409 RAB3GAP1 Zornitza Stark Gene: rab3gap1 has been classified as Green List (High Evidence).
Microcephaly v0.409 RAB3GAP1 Zornitza Stark Phenotypes for gene: RAB3GAP1 were changed from to Warburg micro syndrome 1, MIM# 600118
Microcephaly v0.408 RAB3GAP1 Zornitza Stark Publications for gene: RAB3GAP1 were set to
Microcephaly v0.407 RAB3GAP1 Zornitza Stark Mode of inheritance for gene: RAB3GAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.406 RAB3GAP1 Zornitza Stark reviewed gene: RAB3GAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15696165, 20512159, 23420520; Phenotypes: Warburg micro syndrome 1, MIM# 600118; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cataract v0.230 RAB18 Zornitza Stark Tag founder tag was added to gene: RAB18.
Cataract v0.230 RAB18 Zornitza Stark Marked gene: RAB18 as ready
Cataract v0.230 RAB18 Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence).
Cataract v0.230 RAB18 Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222
Cataract v0.229 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Cataract v0.228 RAB18 Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cataract v0.227 RAB18 Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Anophthalmia_Microphthalmia_Coloboma v0.69 RAB18 Zornitza Stark Tag founder tag was added to gene: RAB18.
Anophthalmia_Microphthalmia_Coloboma v0.69 RAB18 Zornitza Stark Marked gene: RAB18 as ready
Anophthalmia_Microphthalmia_Coloboma v0.69 RAB18 Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence).
Anophthalmia_Microphthalmia_Coloboma v0.69 RAB18 Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222
Anophthalmia_Microphthalmia_Coloboma v0.68 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Anophthalmia_Microphthalmia_Coloboma v0.67 RAB18 Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Anophthalmia_Microphthalmia_Coloboma v0.66 RAB18 Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4166 RAB18 Zornitza Stark Tag founder tag was added to gene: RAB18.
Mendeliome v0.4166 RAB18 Zornitza Stark Marked gene: RAB18 as ready
Mendeliome v0.4166 RAB18 Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence).
Mendeliome v0.4166 RAB18 Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222
Mendeliome v0.4165 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Mendeliome v0.4164 RAB18 Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4163 RAB18 Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.406 RAB18 Zornitza Stark Marked gene: RAB18 as ready
Microcephaly v0.406 RAB18 Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence).
Microcephaly v0.406 RAB18 Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222
Microcephaly v0.405 RAB18 Zornitza Stark Tag founder tag was added to gene: RAB18.
Microcephaly v0.405 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Microcephaly v0.404 RAB18 Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.403 RAB18 Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mackenzie's Mission_Reproductive Carrier Screening v0.11 PTPN23 Zornitza Stark gene: PTPN23 was added
gene: PTPN23 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list
Mode of inheritance for gene: PTPN23 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PTPN23 were set to 31395947; 29899372; 29090338; 27848944; 25558065
Phenotypes for gene: PTPN23 were set to Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890
Review for gene: PTPN23 was set to GREEN
Added comment: Over 10 families reported with an autosomal recessive neurologic disorder characterised by global developmental delay apparent from early infancy, poor overall growth often with microcephaly (6/10), impaired intellectual development with delayed or absent speech, axial hypotonia, and peripheral spasticity. Additional common but variable features include early-onset seizures, optic atrophy with poor visual fixation, and dysmorphic facial features. Brain imaging shows cerebral atrophy, poor or absent myelination with loss of white matter volume, and often hypoplasia of the corpus callosum and/or cerebellum.
Sources: Expert list
Mackenzie's Mission_Reproductive Carrier Screening v0.10 PUS7 Zornitza Stark gene: PUS7 was added
gene: PUS7 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list
Mode of inheritance for gene: PUS7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PUS7 were set to 30526862; 30778726; 31583274
Phenotypes for gene: PUS7 were set to Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature; OMIM #618342
Review for gene: PUS7 was set to GREEN
Added comment: 11 individuals from 6 families with ID, speech delay, short stature, microcephaly, and aggressive behavior, with homozygous PUS7 mutations, which segregated with disease.
Sources: Expert list
Microcephaly v0.403 PUS7 Zornitza Stark edited their review of gene: PUS7: Changed rating: GREEN
Microcephaly v0.403 PUF60 Zornitza Stark Marked gene: PUF60 as ready
Microcephaly v0.403 PUF60 Zornitza Stark Gene: puf60 has been classified as Green List (High Evidence).
Microcephaly v0.403 PUF60 Zornitza Stark Phenotypes for gene: PUF60 were changed from to Verheij syndrome, MIM# 615583
Microcephaly v0.402 PUF60 Zornitza Stark Publications for gene: PUF60 were set to
Microcephaly v0.401 PUF60 Zornitza Stark Mode of inheritance for gene: PUF60 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.400 PUF60 Zornitza Stark reviewed gene: PUF60: Rating: GREEN; Mode of pathogenicity: None; Publications: 28327570; Phenotypes: Verheij syndrome, MIM# 615583; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Deafness_IsolatedAndComplex v0.386 COL9A1 Teresa Zhao Deleted their review
Deafness_IsolatedAndComplex v0.386 COL9A1 Teresa Zhao reviewed gene: COL9A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 16909383, 2142186, 11565064; Phenotypes: Stickler syndrome, type IV (MIM#614134) AR, ?Multiple epiphyseal dysplasia 6 (MIM#614135) AD; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4163 PTPN23 Zornitza Stark Marked gene: PTPN23 as ready
Mendeliome v0.4163 PTPN23 Zornitza Stark Gene: ptpn23 has been classified as Green List (High Evidence).
Mendeliome v0.4163 PTPN23 Zornitza Stark Phenotypes for gene: PTPN23 were changed from to Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890
Mendeliome v0.4162 PTPN23 Zornitza Stark Publications for gene: PTPN23 were set to
Mendeliome v0.4161 PTPN23 Zornitza Stark Mode of inheritance for gene: PTPN23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4160 PTPN23 Zornitza Stark reviewed gene: PTPN23: Rating: GREEN; Mode of pathogenicity: None; Publications: 31395947, 29899372, 29090338, 27848944, 25558065; Phenotypes: Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.400 PTPN23 Zornitza Stark Marked gene: PTPN23 as ready
Microcephaly v0.400 PTPN23 Zornitza Stark Gene: ptpn23 has been classified as Green List (High Evidence).
Microcephaly v0.400 PTPN23 Zornitza Stark Phenotypes for gene: PTPN23 were changed from to Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890
Microcephaly v0.399 PTPN23 Zornitza Stark Publications for gene: PTPN23 were set to
Microcephaly v0.398 PTPN23 Zornitza Stark Mode of inheritance for gene: PTPN23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.397 PTPN23 Zornitza Stark reviewed gene: PTPN23: Rating: GREEN; Mode of pathogenicity: None; Publications: 31395947, 29899372, 29090338, 27848944, 25558065; Phenotypes: Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4160 PRUNE1 Zornitza Stark Marked gene: PRUNE1 as ready
Mendeliome v0.4160 PRUNE1 Zornitza Stark Gene: prune1 has been classified as Green List (High Evidence).
Mendeliome v0.4160 PRUNE1 Zornitza Stark Phenotypes for gene: PRUNE1 were changed from to Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481
Mendeliome v0.4159 PRUNE1 Zornitza Stark Publications for gene: PRUNE1 were set to
Mendeliome v0.4158 PRUNE1 Zornitza Stark Mode of inheritance for gene: PRUNE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4157 PRUNE1 Zornitza Stark reviewed gene: PRUNE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26539891, 28334956; Phenotypes: Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.397 PRUNE1 Zornitza Stark Marked gene: PRUNE1 as ready
Microcephaly v0.397 PRUNE1 Zornitza Stark Gene: prune1 has been classified as Green List (High Evidence).
Microcephaly v0.397 PRUNE1 Zornitza Stark Classified gene: PRUNE1 as Green List (high evidence)
Microcephaly v0.397 PRUNE1 Zornitza Stark Gene: prune1 has been classified as Green List (High Evidence).
Microcephaly v0.396 PRUNE1 Zornitza Stark gene: PRUNE1 was added
gene: PRUNE1 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: PRUNE1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PRUNE1 were set to 26539891; 28334956
Phenotypes for gene: PRUNE1 were set to Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481
Review for gene: PRUNE1 was set to GREEN
Added comment: 8 unrelated families reported with an autosomal recessive neurodevelopmental, and neurodegenerative disorder characterised by global developmental delay apparent from infancy and profound intellectual disability. Affected individuals have microcephaly with accompanying dysmorphic features, truncal hypotonia, peripheral spasticity, and lack of independent ambulation or speech acquisition. Brain imaging shows variable abnormalities, including cortical atrophy, thin corpus callosum, cerebellar hypoplasia, and delayed myelination
Sources: Expert list
Microcephaly v0.395 PPP1R15B Zornitza Stark Marked gene: PPP1R15B as ready
Microcephaly v0.395 PPP1R15B Zornitza Stark Gene: ppp1r15b has been classified as Amber List (Moderate Evidence).
Microcephaly v0.395 PPP1R15B Zornitza Stark Phenotypes for gene: PPP1R15B were changed from to Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817
Microcephaly v0.394 PPP1R15B Zornitza Stark Publications for gene: PPP1R15B were set to
Microcephaly v0.393 PPP1R15B Zornitza Stark Mode of inheritance for gene: PPP1R15B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.392 PPP1R15B Zornitza Stark Classified gene: PPP1R15B as Amber List (moderate evidence)
Microcephaly v0.392 PPP1R15B Zornitza Stark Gene: ppp1r15b has been classified as Amber List (Moderate Evidence).
Microcephaly v0.391 PPP1R15B Zornitza Stark reviewed gene: PPP1R15B: Rating: AMBER; Mode of pathogenicity: None; Publications: 26159176, 26307080, 27640355; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.391 POMT1 Zornitza Stark Marked gene: POMT1 as ready
Microcephaly v0.391 POMT1 Zornitza Stark Gene: pomt1 has been classified as Green List (High Evidence).
Microcephaly v0.391 POMT1 Zornitza Stark Phenotypes for gene: POMT1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, MIM# 236670
Microcephaly v0.390 POMT1 Zornitza Stark Mode of inheritance for gene: POMT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.389 POMT1 Zornitza Stark reviewed gene: POMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, MIM# 236670; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4157 POGZ Zornitza Stark Marked gene: POGZ as ready
Mendeliome v0.4157 POGZ Zornitza Stark Gene: pogz has been classified as Green List (High Evidence).
Mendeliome v0.4157 POGZ Zornitza Stark Phenotypes for gene: POGZ were changed from to White-Sutton syndrome, MIM# 616364
Mendeliome v0.4156 POGZ Zornitza Stark Publications for gene: POGZ were set to
Mendeliome v0.4155 POGZ Zornitza Stark Mode of inheritance for gene: POGZ was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4154 POGZ Zornitza Stark reviewed gene: POGZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 26942287, 26739615; Phenotypes: White-Sutton syndrome, MIM# 616364; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.389 POGZ Zornitza Stark Marked gene: POGZ as ready
Microcephaly v0.389 POGZ Zornitza Stark Gene: pogz has been classified as Green List (High Evidence).
Microcephaly v0.389 POGZ Zornitza Stark Phenotypes for gene: POGZ were changed from to White-Sutton syndrome, MIM# 616364
Microcephaly v0.388 POGZ Zornitza Stark Publications for gene: POGZ were set to
Microcephaly v0.387 POGZ Zornitza Stark Mode of inheritance for gene: POGZ was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.386 POGZ Zornitza Stark reviewed gene: POGZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 26942287; Phenotypes: White-Sutton syndrome, MIM# 616364; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4154 POC1A Zornitza Stark Marked gene: POC1A as ready
Mendeliome v0.4154 POC1A Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence).
Mendeliome v0.4154 POC1A Zornitza Stark Phenotypes for gene: POC1A were changed from to Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813
Mendeliome v0.4153 POC1A Zornitza Stark Publications for gene: POC1A were set to
Mendeliome v0.4152 POC1A Zornitza Stark Mode of inheritance for gene: POC1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4151 POC1A Zornitza Stark reviewed gene: POC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22840364, 22840363, 26374189, 26162852, 26791357; Phenotypes: Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.386 POC1A Zornitza Stark Marked gene: POC1A as ready
Microcephaly v0.386 POC1A Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence).
Microcephaly v0.386 POC1A Zornitza Stark Phenotypes for gene: POC1A were changed from to Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813
Microcephaly v0.385 POC1A Zornitza Stark Classified gene: POC1A as Green List (high evidence)
Microcephaly v0.385 POC1A Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence).
Microcephaly v0.384 POC1A Zornitza Stark edited their review of gene: POC1A: Changed rating: GREEN
Microcephaly v0.384 POC1A Zornitza Stark edited their review of gene: POC1A: Changed phenotypes: Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813
Microcephaly v0.384 POC1A Zornitza Stark gene: POC1A was added
gene: POC1A was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: POC1A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POC1A were set to 22840364; 22840363; 26374189; 26162852; 26791357
Added comment: SOFT syndrome is characterized by severely short long bones, peculiar facies associated with paucity of hair, and nail anomalies. Growth retardation is evident on prenatal ultrasound as early as the second trimester of pregnancy, and affected individuals reach a final stature consistent with a height age of 6 years to 8 years. Relative macrocephaly is present during early childhood but head circumference is markedly low by adulthood. Over 5 unrelated families reported.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2943 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Intellectual disability syndromic and non-syndromic v0.2943 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2943 PLK4 Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171
Intellectual disability syndromic and non-syndromic v0.2942 PLK4 Zornitza Stark Publications for gene: PLK4 were set to
Intellectual disability syndromic and non-syndromic v0.2941 PLK4 Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2940 PLK4 Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Syndromic Retinopathy v0.75 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Syndromic Retinopathy v0.75 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Syndromic Retinopathy v0.75 PLK4 Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171
Syndromic Retinopathy v0.74 PLK4 Zornitza Stark Publications for gene: PLK4 were set to
Syndromic Retinopathy v0.73 PLK4 Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Syndromic Retinopathy v0.72 PLK4 Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4151 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Mendeliome v0.4151 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Mendeliome v0.4151 PLK4 Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171
Mendeliome v0.4150 PLK4 Zornitza Stark Publications for gene: PLK4 were set to
Mendeliome v0.4149 PLK4 Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4148 PLK4 Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.383 PLK4 Zornitza Stark Marked gene: PLK4 as ready
Microcephaly v0.383 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Microcephaly v0.383 PLK4 Zornitza Stark Classified gene: PLK4 as Green List (high evidence)
Microcephaly v0.383 PLK4 Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence).
Microcephaly v0.382 PLK4 Zornitza Stark gene: PLK4 was added
gene: PLK4 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: PLK4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PLK4 were set to 25344692; 25320347; 27650967
Phenotypes for gene: PLK4 were set to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171
Review for gene: PLK4 was set to GREEN
Added comment: At least 3 unrelated families reported with autosomal recessive developmental disorder characterised by delayed psychomotor development, visual impairment, and microcephaly.
Sources: Expert list
Mendeliome v0.4148 PIGH Zornitza Stark Marked gene: PIGH as ready
Mendeliome v0.4148 PIGH Zornitza Stark Gene: pigh has been classified as Green List (High Evidence).
Mendeliome v0.4148 PIGH Zornitza Stark Phenotypes for gene: PIGH were changed from to Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010
Mendeliome v0.4147 PIGH Zornitza Stark Publications for gene: PIGH were set to
Mendeliome v0.4146 PIGH Zornitza Stark Mode of inheritance for gene: PIGH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4145 PIGH Zornitza Stark reviewed gene: PIGH: Rating: GREEN; Mode of pathogenicity: None; Publications: 29573052, 29603516; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.381 PIGH Zornitza Stark Marked gene: PIGH as ready
Microcephaly v0.381 PIGH Zornitza Stark Gene: pigh has been classified as Amber List (Moderate Evidence).
Microcephaly v0.381 PIGH Zornitza Stark Phenotypes for gene: PIGH were changed from to Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010
Microcephaly v0.380 PIGH Zornitza Stark Publications for gene: PIGH were set to
Microcephaly v0.379 PIGH Zornitza Stark Mode of inheritance for gene: PIGH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.378 PIGH Zornitza Stark Classified gene: PIGH as Amber List (moderate evidence)
Microcephaly v0.378 PIGH Zornitza Stark Gene: pigh has been classified as Amber List (Moderate Evidence).
Microcephaly v0.377 PIGH Zornitza Stark reviewed gene: PIGH: Rating: AMBER; Mode of pathogenicity: None; Publications: 29573052; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.377 PDHA1 Zornitza Stark Marked gene: PDHA1 as ready
Microcephaly v0.377 PDHA1 Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence).
Microcephaly v0.377 PDHA1 Zornitza Stark Classified gene: PDHA1 as Green List (high evidence)
Microcephaly v0.377 PDHA1 Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence).
Microcephaly v0.376 PDHA1 Zornitza Stark gene: PDHA1 was added
gene: PDHA1 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: PDHA1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: PDHA1 were set to 8032855
Phenotypes for gene: PDHA1 were set to Pyruvate dehydrogenase E1-alpha deficiency, MIM# 312170
Review for gene: PDHA1 was set to GREEN
Added comment: Well established gene-disease association. Variable phenotype, but microcephaly is a feature.
Sources: Expert list
Cerebral Palsy v0.27 PCYT2 Zornitza Stark Marked gene: PCYT2 as ready
Cerebral Palsy v0.27 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Green List (High Evidence).
Cerebral Palsy v0.27 PCYT2 Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770
Cerebral Palsy v0.26 PCYT2 Zornitza Stark Publications for gene: PCYT2 were set to
Cerebral Palsy v0.25 PCYT2 Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.24 PCYT2 Zornitza Stark reviewed gene: PCYT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4145 PCYT2 Zornitza Stark Marked gene: PCYT2 as ready
Mendeliome v0.4145 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Green List (High Evidence).
Mendeliome v0.4145 PCYT2 Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770; global developmental delay; regression; spastic parapesis or tetraparesis; epilepsy; progressive cerebral and cerebellar atrophy
Mendeliome v0.4144 PCYT2 Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4143 PCYT2 Zornitza Stark reviewed gene: PCYT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.375 PCYT2 Zornitza Stark Marked gene: PCYT2 as ready
Microcephaly v0.375 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Red List (Low Evidence).
Microcephaly v0.375 PCYT2 Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770
Microcephaly v0.374 PCYT2 Zornitza Stark Publications for gene: PCYT2 were set to
Microcephaly v0.373 PCYT2 Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.372 PCYT2 Zornitza Stark Classified gene: PCYT2 as Red List (low evidence)
Microcephaly v0.372 PCYT2 Zornitza Stark Gene: pcyt2 has been classified as Red List (Low Evidence).
Microcephaly v0.371 PCYT2 Zornitza Stark reviewed gene: PCYT2: Rating: RED; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark Tag founder tag was added to gene: TRAPPC2L.
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Tag founder tag was added to gene: TRAPPC2L.
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Classified gene: TRAPPC2L as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2940 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2939 TRAPPC2L Zornitza Stark Tag founder tag was added to gene: TRAPPC2L.
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Red List (Low Evidence).
Rhabdomyolysis and Metabolic Myopathy v0.59 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Rhabdomyolysis RMH. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to RED
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Red on this panel as rhabdomyolysis not reported in all families. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2939 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark changed review comment from: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature; to: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Red on this panel as seizures not reported in all families. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark edited their review of gene: TRAPPC2L: Changed rating: RED
Genetic Epilepsy v0.831 TRAPPC2L Zornitza Stark gene: TRAPPC2L was added
gene: TRAPPC2L was added to Genetic Epilepsy. Sources: Literature
founder tags were added to gene: TRAPPC2L.
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Marked gene: TRAPPC2L as ready
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Classified gene: TRAPPC2L as Amber List (moderate evidence)
Mendeliome v0.4143 TRAPPC2L Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence).
Dystonia and Chorea v0.75 TIMM8A Zornitza Stark Marked gene: TIMM8A as ready
Dystonia and Chorea v0.75 TIMM8A Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence).
Dystonia and Chorea v0.75 TIMM8A Zornitza Stark Phenotypes for gene: TIMM8A were changed from Deafness-Dystonia-Optic Neuronopathy Syndrome to Deafness-Dystonia-Optic Neuronopathy Syndrome; Mohr-Tranebjaerg syndrome, MIM# 304700
Dystonia and Chorea v0.74 TIMM8A Zornitza Stark Publications for gene: TIMM8A were set to
Dystonia and Chorea v0.73 TIMM8A Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Dystonia and Chorea v0.72 TIMM8A Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816, 32820032; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4142 TIMM8A Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Deafness_IsolatedAndComplex v0.386 TIMM8A Zornitza Stark Marked gene: TIMM8A as ready
Deafness_IsolatedAndComplex v0.386 TIMM8A Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v0.386 TIMM8A Zornitza Stark Phenotypes for gene: TIMM8A were changed from to Mohr-Tranebjaerg syndrome, MIM# 304700
Deafness_IsolatedAndComplex v0.385 TIMM8A Zornitza Stark Publications for gene: TIMM8A were set to
Deafness_IsolatedAndComplex v0.384 TIMM8A Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Deafness_IsolatedAndComplex v0.383 TIMM8A Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816, 32820032; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4141 TIMM8A Zornitza Stark Marked gene: TIMM8A as ready
Mendeliome v0.4141 TIMM8A Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence).
Mendeliome v0.4141 TIMM8A Zornitza Stark Phenotypes for gene: TIMM8A were changed from to Mohr-Tranebjaerg syndrome, MIM# 304700
Mendeliome v0.4140 TIMM8A Zornitza Stark Publications for gene: TIMM8A were set to
Mendeliome v0.4139 TIMM8A Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Hydrocephalus_Ventriculomegaly v0.56 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Hydrocephalus_Ventriculomegaly v0.56 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Hydrocephalus_Ventriculomegaly v0.56 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Hydrocephalus_Ventriculomegaly. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Ciliopathies v0.206 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Ciliopathies v0.206 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Ciliopathies v0.206 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Ciliopathies. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Anophthalmia_Microphthalmia_Coloboma v0.66 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Anophthalmia_Microphthalmia_Coloboma v0.66 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Microcephaly v0.371 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Microcephaly v0.371 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Anophthalmia_Microphthalmia_Coloboma v0.66 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Anophthalmia_Microphthalmia_Coloboma. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Marked gene: TOGARAM1 as ready
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Microcephaly v0.371 TOGARAM1 Zornitza Stark gene: TOGARAM1 was added
gene: TOGARAM1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Review for gene: TOGARAM1 was set to RED
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Classified gene: TOGARAM1 as Red List (low evidence)
Mendeliome v0.4139 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2938 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Intellectual disability syndromic and non-syndromic v0.2938 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2938 DPP6 Zornitza Stark Phenotypes for gene: DPP6 were changed from to Mental retardation, autosomal dominant 33 (MIM#616311)
Intellectual disability syndromic and non-syndromic v0.2937 DPP6 Zornitza Stark Publications for gene: DPP6 were set to
Intellectual disability syndromic and non-syndromic v0.2936 DPP6 Zornitza Stark Mode of inheritance for gene: DPP6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2935 DPP6 Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2935 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2934 DPP6 Zornitza Stark reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4138 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Mendeliome v0.4138 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4138 DPP6 Zornitza Stark Phenotypes for gene: DPP6 were changed from to Mental retardation, autosomal dominant 33 (MIM#616311)
Mendeliome v0.4137 DPP6 Zornitza Stark Publications for gene: DPP6 were set to
Mendeliome v0.4136 DPP6 Zornitza Stark Mode of inheritance for gene: DPP6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4135 DPP6 Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence)
Mendeliome v0.4135 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4134 DPP6 Zornitza Stark Tag SV/CNV tag was added to gene: DPP6.
Mendeliome v0.4134 DPP6 Zornitza Stark reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.370 DPP6 Zornitza Stark changed review comment from: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013.; to: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013. Association studies with dementia, and suggested role in tardive dyskinesia.
Microcephaly v0.370 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Microcephaly v0.370 DPP6 Zornitza Stark Added comment: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013.
Microcephaly v0.370 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.370 DPP6 Zornitza Stark Marked gene: DPP6 as ready
Microcephaly v0.370 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.370 DPP6 Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence)
Microcephaly v0.370 DPP6 Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.369 DPP6 Zornitza Stark Tag SV/CNV tag was added to gene: DPP6.
Mendeliome v0.4134 TRAPPC2L Arina Puzriakova changed review comment from: Gene is associated with Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis in OMIM, but not in G2P.

PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect.

The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11.


PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family.

Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature; to: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship.

PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect.

The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11.


PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family.

Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.

Sources: Literature
Mendeliome v0.4134 TRAPPC2L Arina Puzriakova gene: TRAPPC2L was added
gene: TRAPPC2L was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRAPPC2L were set to 30120216; 32843486
Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331
Review for gene: TRAPPC2L was set to AMBER
Added comment: Gene is associated with Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis in OMIM, but not in G2P.

PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect.

The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11.


PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family.

Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a.
Sources: Literature
Mendeliome v0.4134 TIMM8A Arina Puzriakova reviewed gene: TIMM8A: Rating: ; Mode of pathogenicity: None; Publications: 32820032; Phenotypes: ; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4134 TOGARAM1 Arina Puzriakova gene: TOGARAM1 was added
gene: TOGARAM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TOGARAM1 were set to 32747439
Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus
Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene.

Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2934 DPP6 Ain Roesley edited their review of gene: DPP6: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4134 DPP6 Ain Roesley reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Intellectual disability syndromic and non-syndromic v0.2934 DPP6 Ain Roesley reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: None
Microcephaly v0.369 DPP6 Ain Roesley gene: DPP6 was added
gene: DPP6 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: DPP6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: DPP6 were set to 23832105
Phenotypes for gene: DPP6 were set to Mental retardation, autosomal dominant 33 (MIM#616311)
Penetrance for gene: DPP6 were set to unknown
Review for gene: DPP6 was set to AMBER
Added comment: PMID: 23832105
- 1x proband (OFC < -3 SD) with a missense which segregated in 3 other family members
- 2x probands with 336kb deletion. Both OFCs < -3 SD
- mouse KO model with significantly smaller brain weight

*unable to find new reports since
Sources: Literature
Microcephaly v0.369 CTU2 Zornitza Stark Marked gene: CTU2 as ready
Microcephaly v0.369 CTU2 Zornitza Stark Gene: ctu2 has been classified as Green List (High Evidence).
Microcephaly v0.369 CTU2 Zornitza Stark Phenotypes for gene: CTU2 were changed from to Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome (MIM#618142)
Microcephaly v0.368 CTU2 Zornitza Stark Publications for gene: CTU2 were set to
Microcephaly v0.367 CTU2 Zornitza Stark Mode of inheritance for gene: CTU2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2934 PCGF2 Zornitza Stark Marked gene: PCGF2 as ready
Intellectual disability syndromic and non-syndromic v0.2934 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2934 PCGF2 Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371
Intellectual disability syndromic and non-syndromic v0.2933 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Microcephaly v0.366 CTU2 Ain Roesley reviewed gene: CTU2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26633546; Phenotypes: Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome (MIM#618142); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2932 PCGF2 Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2931 PCGF2 Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4134 PCGF2 Zornitza Stark Marked gene: PCGF2 as ready
Mendeliome v0.4134 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Green List (High Evidence).
Mendeliome v0.4134 PCGF2 Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371
Mendeliome v0.4133 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Mendeliome v0.4132 PCGF2 Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4131 PCGF2 Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.366 PCGF2 Zornitza Stark Marked gene: PCGF2 as ready
Microcephaly v0.366 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.366 PCGF2 Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371
Microcephaly v0.365 PCGF2 Zornitza Stark Publications for gene: PCGF2 were set to
Microcephaly v0.364 PCGF2 Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.363 PCGF2 Zornitza Stark Classified gene: PCGF2 as Amber List (moderate evidence)
Microcephaly v0.363 PCGF2 Zornitza Stark Gene: pcgf2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.362 PCGF2 Zornitza Stark changed review comment from: developmental delay, impaired intellectual development, impaired growth, and recognizable facial features that include frontal bossing, sparse hair, malar hypoplasia, small palpebral fissures and oral stoma, and dysplastic 'satyr' ears. Other common findings include feeding problems, constipation, and a range of brain, cardiac, vascular, and skeletal malformations. Head size is variable, with some patients showing relative macrocephaly and others showing microcephaly. Over 10 affected individuals reported to date, all variants affect residue p.Pro65; to: Key features include developmental delay, impaired intellectual development, impaired growth, and recognizable facial features (frontal bossing, sparse hair, malar hypoplasia, small palpebral fissures and oral stoma, and dysplastic 'satyr' ears). Other common findings include feeding problems, constipation, and a range of brain, cardiac, vascular, and skeletal malformations. Head size is variable, with some patients showing relative macrocephaly and others showing microcephaly. Over 10 affected individuals reported to date, all variants affect residue p.Pro65
Microcephaly v0.362 PCGF2 Zornitza Stark edited their review of gene: PCGF2: Changed rating: AMBER
Microcephaly v0.362 PCGF2 Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.362 CTNNB1 Zornitza Stark Marked gene: CTNNB1 as ready
Microcephaly v0.362 CTNNB1 Zornitza Stark Gene: ctnnb1 has been classified as Green List (High Evidence).
Microcephaly v0.362 CTNNB1 Zornitza Stark Classified gene: CTNNB1 as Green List (high evidence)
Microcephaly v0.362 CTNNB1 Zornitza Stark Gene: ctnnb1 has been classified as Green List (High Evidence).
Microcephaly v0.361 CTNNB1 Ain Roesley gene: CTNNB1 was added
gene: CTNNB1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CTNNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CTNNB1 were set to 25326669; 32039639
Phenotypes for gene: CTNNB1 were set to Neurodevelopmental disorder with spastic diplegia and visual defects (MIM#615075); Exudative vitreoretinopathy 7 (MIM#617572)
Penetrance for gene: CTNNB1 were set to unknown
Review for gene: CTNNB1 was set to GREEN
Added comment: PMID: 32039639;
-1x proband with familial exudative vitreoretinopathy (FEVR) and microcephaly. Head circumference <1st centile

PMID: 25326669
- 15 families with 16 affecteds. de novo PTVs
- included 5 patients from published literature
- 10 out of 20 presented with microcephaly, head circumference < -3 SD
Sources: Literature
Microcephaly v0.361 PCDH12 Zornitza Stark Phenotypes for gene: PCDH12 were changed from DIENCEPHALIC-MESENCEPHALIC JUNCTION DYSPLASIA SYNDROME 1 to Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280
Microcephaly v0.360 PCDH12 Zornitza Stark Publications for gene: PCDH12 were set to 27164683; 22822038
Microcephaly v0.359 PCDH12 Zornitza Stark reviewed gene: PCDH12: Rating: GREEN; Mode of pathogenicity: None; Publications: 27164683, 30178464; Phenotypes: Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2931 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Intellectual disability syndromic and non-syndromic v0.2931 TRIT1 Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2931 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873
Intellectual disability syndromic and non-syndromic v0.2930 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Intellectual disability syndromic and non-syndromic v0.2929 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2928 TRIT1 Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.478 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873
Mitochondrial disease v0.477 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Mitochondrial disease v0.476 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.475 TRIT1 Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4131 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Mendeliome v0.4131 TRIT1 Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence).
Mendeliome v0.4131 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873
Mendeliome v0.4130 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Mendeliome v0.4129 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4128 TRIT1 Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.359 TRIT1 Zornitza Stark Marked gene: TRIT1 as ready
Microcephaly v0.359 TRIT1 Zornitza Stark Gene: trit1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.359 TRIT1 Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35 MIM#617873
Microcephaly v0.358 TRIT1 Zornitza Stark Publications for gene: TRIT1 were set to
Microcephaly v0.357 TRIT1 Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.356 TRIT1 Zornitza Stark Classified gene: TRIT1 as Amber List (moderate evidence)
Microcephaly v0.356 TRIT1 Zornitza Stark Gene: trit1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.355 TRIT1 Paul De Fazio reviewed gene: TRIT1: Rating: AMBER; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35 MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.355 CTCF Zornitza Stark Marked gene: CTCF as ready
Microcephaly v0.355 CTCF Zornitza Stark Gene: ctcf has been classified as Green List (High Evidence).
Microcephaly v0.355 CTCF Zornitza Stark Phenotypes for gene: CTCF were changed from to Mental retardation, autosomal dominant 21 (MIM#615502)
Microcephaly v0.354 CTCF Zornitza Stark Publications for gene: CTCF were set to
Microcephaly v0.353 CTCF Zornitza Stark Mode of inheritance for gene: CTCF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Arthrogryposis v0.207 TBCD Zornitza Stark Tag umccr was removed from gene: TBCD.
Microcephaly v0.352 TBCD Zornitza Stark Marked gene: TBCD as ready
Microcephaly v0.352 TBCD Zornitza Stark Gene: tbcd has been classified as Green List (High Evidence).
Microcephaly v0.352 TBCD Zornitza Stark Phenotypes for gene: TBCD were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193
Microcephaly v0.351 TBCD Zornitza Stark Publications for gene: TBCD were set to
Microcephaly v0.350 TBCD Zornitza Stark Mode of inheritance for gene: TBCD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.349 TBCD Zornitza Stark changed review comment from: 15 children from 9 unrelated families with bi-allelic variants in this gene and a progressive neurodegenerative encephalopathy.
Sources: Expert Review; to: 15 children from 9 unrelated families with bi-allelic variants in this gene and a progressive neurodegenerative encephalopathy including progressive microcephaly.
Sources: Expert Review
Microcephaly v0.349 TSEN15 Zornitza Stark Marked gene: TSEN15 as ready
Microcephaly v0.349 TSEN15 Zornitza Stark Gene: tsen15 has been classified as Green List (High Evidence).
Microcephaly v0.349 TSEN15 Zornitza Stark Classified gene: TSEN15 as Green List (high evidence)
Microcephaly v0.349 TSEN15 Zornitza Stark Gene: tsen15 has been classified as Green List (High Evidence).
Microcephaly v0.348 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Microcephaly v0.347 TSEN2 Zornitza Stark Marked gene: TSEN2 as ready
Microcephaly v0.347 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.347 TSEN2 Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B (MIM#612389)
Microcephaly v0.346 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Microcephaly v0.345 TSEN2 Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.344 TSEN15 Paul De Fazio gene: TSEN15 was added
gene: TSEN15 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TSEN15 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TSEN15 were set to 27392077
Phenotypes for gene: TSEN15 were set to Pontocerebellar hypoplasia, type 2F MIM#617026
Review for gene: TSEN15 was set to GREEN
gene: TSEN15 was marked as current diagnostic
Added comment: PMID 27392077 Reports four individuals from three families with PCH type 2 and different homozygous missense variants, all had progressive microcephaly (between -3SD and -9.7SD). Functional studies indicated that all variants resulted in almost complete lack of in vitro tRNA cleavage activity.
Sources: Literature
Microcephaly v0.344 TSEN2 Zornitza Stark Classified gene: TSEN2 as Amber List (moderate evidence)
Microcephaly v0.344 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.343 TSEN54 Zornitza Stark Marked gene: TSEN54 as ready
Microcephaly v0.343 TSEN54 Zornitza Stark Gene: tsen54 has been classified as Green List (High Evidence).
Microcephaly v0.343 TSEN54 Zornitza Stark Phenotypes for gene: TSEN54 were changed from to Pontocerebellar hypoplasia type 2A (MIM#277470) and type 4 (MIM#225753)
Microcephaly v0.342 TSEN54 Zornitza Stark Publications for gene: TSEN54 were set to
Microcephaly v0.341 TSEN54 Zornitza Stark Mode of inheritance for gene: TSEN54 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.340 TUBB2B Zornitza Stark Marked gene: TUBB2B as ready
Microcephaly v0.340 TUBB2B Zornitza Stark Gene: tubb2b has been classified as Green List (High Evidence).
Microcephaly v0.340 TUBB2B Zornitza Stark Phenotypes for gene: TUBB2B were changed from to Cortical dysplasia, complex, with other brain malformations 7 MIM#610031
Microcephaly v0.339 TUBB2B Zornitza Stark Publications for gene: TUBB2B were set to
Microcephaly v0.338 TUBB2B Zornitza Stark Mode of inheritance for gene: TUBB2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.337 COASY Zornitza Stark Marked gene: COASY as ready
Microcephaly v0.337 COASY Zornitza Stark Gene: coasy has been classified as Green List (High Evidence).
Microcephaly v0.337 COASY Zornitza Stark Classified gene: COASY as Green List (high evidence)
Microcephaly v0.337 COASY Zornitza Stark Gene: coasy has been classified as Green List (High Evidence).
Microcephaly v0.336 VPS51 Zornitza Stark Marked gene: VPS51 as ready
Microcephaly v0.336 VPS51 Zornitza Stark Gene: vps51 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.336 VPS51 Zornitza Stark Classified gene: VPS51 as Amber List (moderate evidence)
Microcephaly v0.336 VPS51 Zornitza Stark Gene: vps51 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.335 TSEN2 Paul De Fazio reviewed gene: TSEN2: Rating: AMBER; Mode of pathogenicity: None; Publications: 23562994, 20952379, 27392077; Phenotypes: Pontocerebellar hypoplasia type 2B (MIM#612389); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v0.4128 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Mendeliome v0.4128 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4128 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Mendeliome v0.4128 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Microcephaly v0.335 CRIPT Zornitza Stark Marked gene: CRIPT as ready
Microcephaly v0.335 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Microcephaly v0.335 CRIPT Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence)
Microcephaly v0.335 CRIPT Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2928 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Intellectual disability syndromic and non-syndromic v0.2928 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2928 CREBBP Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332
Intellectual disability syndromic and non-syndromic v0.2927 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Intellectual disability syndromic and non-syndromic v0.2926 CREBBP Zornitza Stark Mode of inheritance for gene: CREBBP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2925 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4127 CREBBP Zornitza Stark Publications for gene: CREBBP were set to
Mendeliome v0.4126 CREBBP Zornitza Stark Mode of inheritance for gene: CREBBP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4125 CREBBP Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.334 CREBBP Zornitza Stark Marked gene: CREBBP as ready
Microcephaly v0.334 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Microcephaly v0.334 CREBBP Zornitza Stark Classified gene: CREBBP as Green List (high evidence)
Microcephaly v0.334 CREBBP Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence).
Microcephaly v0.333 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to 32052936
Microcephaly v0.332 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to 32052936; 32052936
Microcephaly v0.331 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Microcephaly v0.331 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.331 ERCC5 Zornitza Stark Classified gene: ERCC5 as Amber List (moderate evidence)
Microcephaly v0.331 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.330 TTC5 Zornitza Stark Marked gene: TTC5 as ready
Microcephaly v0.330 TTC5 Zornitza Stark Gene: ttc5 has been classified as Green List (High Evidence).
Microcephaly v0.330 TTC5 Zornitza Stark Classified gene: TTC5 as Green List (high evidence)
Microcephaly v0.330 TTC5 Zornitza Stark Gene: ttc5 has been classified as Green List (High Evidence).
Microcephaly v0.329 CKAP2L Zornitza Stark Marked gene: CKAP2L as ready
Microcephaly v0.329 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Microcephaly v0.329 CKAP2L Zornitza Stark Classified gene: CKAP2L as Green List (high evidence)
Microcephaly v0.329 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Microcephaly v0.328 TSEN54 Paul De Fazio reviewed gene: TSEN54: Rating: GREEN; Mode of pathogenicity: None; Publications: 20952379, 20301773; Phenotypes: Pontocerebellar hypoplasia type 2A (MIM#277470) and type 4 (MIM#225753); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.328 TTC5 Paul De Fazio gene: TTC5 was added
gene: TTC5 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC5 were set to 29302074; 32439809
Phenotypes for gene: TTC5 were set to Intellectual disability; microcephaly
Review for gene: TTC5 was set to GREEN
gene: TTC5 was marked as current diagnostic
Added comment: PMID 29302074: 3 affected individuals from 2 consaguinous families described. All had head circumference < -3SD

PMID 32439809: Report another 8 affected individuals from 5 families but only 3 individuals from 2 families were microcephalic (OFCs 31cm (unsure age), 32cm (12yo), 31cm (5yo)).
Sources: Literature
Microcephaly v0.328 CTCF Ain Roesley reviewed gene: CTCF: Rating: GREEN; Mode of pathogenicity: None; Publications: 23746550, 30893510, 28619046; Phenotypes: Mental retardation, autosomal dominant 21 (MIM#615502); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4125 CRIPT Ain Roesley gene: CRIPT was added
gene: CRIPT was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRIPT were set to 24389050; 27250922
Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789)
Penetrance for gene: CRIPT were set to unknown
Review for gene: CRIPT was set to AMBER
Added comment: PMID: 24389050
- 2 unrelated probands homozygous for PTVs. However 1 was deceased and DNA was unavailable therefore parents were sequenced

PMID: 27250922
- 1x proband
- het for a missense which was maternally inherited. Because the father was negative for SNVs, they did CMA and found a small heterozygous deletion 1.6kb in size encompassing exon 1 of CRIPT. This deletion was paternally inherited

*did not find new reports since
Sources: Literature
Microcephaly v0.328 CRIPT Ain Roesley gene: CRIPT was added
gene: CRIPT was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CRIPT were set to 24389050; 27250922
Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789)
Penetrance for gene: CRIPT were set to unknown
Review for gene: CRIPT was set to AMBER
Added comment: PMID: 24389050
- 2 unrelated probands homozygous for PTVs. However 1 was deceased and DNA was unavailable therefore parents were sequenced
- OFCs -2.5 and -2.7SD

PMID: 27250922
- 1x proband with a head circumference of Z= -2.7.
- het for a missense which was maternally inherited. Because the father was negative for SNVs, they did CMA and found a small heterozygous deletion 1.6kb in size encompassing exon 1 of CRIPT. This deletion was paternally inherited

*did not find new reports since
Sources: Literature
Microcephaly v0.328 CREBBP Ain Roesley gene: CREBBP was added
gene: CREBBP was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CREBBP were set to 27311832; 29460469; 24989455
Phenotypes for gene: CREBBP were set to Menke-Hennekam syndrome 1(MIM#618332); Rubinstein-Taybi syndrome 1(MIM#180849)
Penetrance for gene: CREBBP were set to unknown
Review for gene: CREBBP was set to GREEN
Added comment: Microcephaly is a feature of both syndromes (OMIM, GeneReviews)

Variants causing Menke-Hennekam syndrome occur in 3' end of exon 30 and 5' end of exon 31 and are de novo missense versus Rubinstein-Taybi which are LoF variants.


PMID: 27311832
7 out of 11 Menke-Hennekam probands with microcephaly (<3rd centile)

PMID: 29460469
13 new Menke-Hennekam probands with 3 having OFCs of <-3 SD

PMID: 24989455 provides growth charts of 92 molecularly diagnosed Rubinstein-Taybi patients. Mean of -1.89 SD for males and -2.71 SD for females
Sources: Literature
Microcephaly v0.328 COASY Seb Lunke gene: COASY was added
gene: COASY was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: COASY was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: COASY were set to 30089828; 28489334
Phenotypes for gene: COASY were set to Pontocerebellar hypoplasia, type 12, MIM#618266
Review for gene: COASY was set to GREEN
Added comment: 6 patients from 3 families published with microcephaly. One paper (2018, 30089828) describes two families, one consanguineous with hom splice region variant c.1486-3 C>G, the other family with a compound heterozygous c.[1549_1550delAG]; [1486-3 C>G] genotype. An earlier paper (2017, 28489334) describes an additional family with two affected siblings compound het c.1495C > T; p.(R499C) and c.C641T; p(A214V) variants.
Sources: Literature
Microcephaly v0.327 CLTC Ain Roesley reviewed gene: CLTC: Rating: AMBER; Mode of pathogenicity: None; Publications: 31776469; Phenotypes: Mental retardation, autosomal dominant 56 (MIM#617854); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.327 ERCC5 Paul De Fazio gene: ERCC5 was added
gene: ERCC5 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC5 were set to 32052936; 32052936
Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3 MIM#616570
Review for gene: ERCC5 was set to AMBER
gene: ERCC5 was marked as current diagnostic
Added comment: PMID 9096355 identified a homozygous LoF variant in a boy with microcephaly but this publication was later retracted over data in Figure 6.

PMID 24700531 describes 4 fetuses from a large consanguineous Pakistani kindred with a homozygous LoF variant. All were said to be microcephalic with no measurements given.

PMID 32052936 describes another 3 microcephalic fetuses from 2 families with homozygous LoF variants, again no measurements given.

3 families described in total but head circumference measurements of affected fetuses not provided so rated Amber.
Sources: Literature
Deafness_IsolatedAndComplex v0.383 DIAPH1 Dean Phelan reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 24781755, 27707755, 27808407, 28003573, 28815995; Phenotypes: Deafness, autosomal dominant 1, with or without thrombocytopenia 124900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.327 ERCC8 Seb Lunke Marked gene: ERCC8 as ready
Microcephaly v0.327 ERCC8 Seb Lunke Gene: ercc8 has been classified as Green List (High Evidence).
Microcephaly v0.327 ERCC8 Seb Lunke Classified gene: ERCC8 as Green List (high evidence)
Microcephaly v0.327 ERCC8 Seb Lunke Gene: ercc8 has been classified as Green List (High Evidence).
Microcephaly v0.326 DIAPH1 Seb Lunke Marked gene: DIAPH1 as ready
Microcephaly v0.326 DIAPH1 Seb Lunke Gene: diaph1 has been classified as Green List (High Evidence).
Microcephaly v0.326 DIAPH1 Seb Lunke Classified gene: DIAPH1 as Green List (high evidence)
Microcephaly v0.326 DIAPH1 Seb Lunke Gene: diaph1 has been classified as Green List (High Evidence).
Microcephaly v0.325 ERCC8 Belinda Chong gene: ERCC8 was added
gene: ERCC8 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC8 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC8 were set to 14661080; 21108394
Phenotypes for gene: ERCC8 were set to Cockayne syndrome, type A, MIM# 216400
Review for gene: ERCC8 was set to GREEN
gene: ERCC8 was marked as current diagnostic
Added comment: Well established gene-disease association, with microcephaly a reported feature.
(https://www.ncbi.nlm.nih.gov/books/NBK1342/)
Sources: Literature
Microcephaly v0.325 DIAPH1 Dean Phelan gene: DIAPH1 was added
gene: DIAPH1 was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: DIAPH1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DIAPH1 were set to PMID: 24781755; 26463574
Phenotypes for gene: DIAPH1 were set to Seizures, cortical blindness, microcephaly syndrome 616632
Review for gene: DIAPH1 was set to GREEN
Added comment: PMID: 24781755 (2015) - five individuals from a consanguineous family with severe microcephaly >2SD below the mean for age with homozygous nonsense variant in DIAPH1

PMID: 26463574 (2016) - two different homozygous LOF variants identified in two unrelated consanguineous families. The affected individuals were diagnosed with postnatal microcephaly (>2SD), early-onset epilepsy, severe vision impairment, and pulmonary symptoms including bronchiectasis and recurrent respiratory infections.
Sources: Expert Review
Microcephaly v0.325 ERCC6 Seb Lunke Marked gene: ERCC6 as ready
Microcephaly v0.325 ERCC6 Seb Lunke Gene: ercc6 has been classified as Green List (High Evidence).
Microcephaly v0.325 ERCC6 Seb Lunke Classified gene: ERCC6 as Green List (high evidence)
Microcephaly v0.325 ERCC6 Seb Lunke Gene: ercc6 has been classified as Green List (High Evidence).
Microcephaly v0.324 ERCC4 Seb Lunke Marked gene: ERCC4 as ready
Microcephaly v0.324 ERCC4 Seb Lunke Gene: ercc4 has been classified as Green List (High Evidence).
Microcephaly v0.324 ERCC6 Naomi Baker gene: ERCC6 was added
gene: ERCC6 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ERCC6 were set to PMID: 20301516
Phenotypes for gene: ERCC6 were set to Cockayne syndrome, type B, MIM#133540; Cerebrooculofacioskeletal syndrome 1, MIM#214150; De Sanctis-Cacchione syndrome, MIM#278800
Penetrance for gene: ERCC6 were set to Complete
Review for gene: ERCC6 was set to GREEN
Added comment: Well established gene-disease association, with microcephaly a reported feature.
Sources: Literature
Microcephaly v0.324 CKAP2L Zornitza Stark Classified gene: CKAP2L as Green List (high evidence)
Microcephaly v0.324 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Microcephaly v0.324 FANCF Zornitza Stark Marked gene: FANCF as ready
Microcephaly v0.324 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Microcephaly v0.324 ERCC4 Seb Lunke Classified gene: ERCC4 as Green List (high evidence)
Microcephaly v0.324 ERCC4 Seb Lunke Gene: ercc4 has been classified as Green List (High Evidence).
Microcephaly v0.323 BRIP1 Zornitza Stark Marked gene: BRIP1 as ready
Microcephaly v0.323 BRIP1 Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence).
Microcephaly v0.323 FANCD2 Seb Lunke Marked gene: FANCD2 as ready
Microcephaly v0.323 FANCD2 Seb Lunke Gene: fancd2 has been classified as Green List (High Evidence).
Microcephaly v0.323 FANCD2 Seb Lunke Classified gene: FANCD2 as Green List (high evidence)
Microcephaly v0.323 FANCD2 Seb Lunke Gene: fancd2 has been classified as Green List (High Evidence).
Microcephaly v0.323 BRIP1 Zornitza Stark Publications for gene: BRIP1 were set to
Microcephaly v0.322 BRIP1 Zornitza Stark Classified gene: BRIP1 as Green List (high evidence)
Microcephaly v0.322 BRIP1 Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence).
Microcephaly v0.321 FANCD2 Dean Phelan gene: FANCD2 was added
gene: FANCD2 was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: FANCD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCD2 were set to PMID:20301575
Phenotypes for gene: FANCD2 were set to Fanconi anemia 227646
Review for gene: FANCD2 was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert Review
Microcephaly v0.321 FANCG Seb Lunke Marked gene: FANCG as ready
Microcephaly v0.321 FANCG Seb Lunke Gene: fancg has been classified as Green List (High Evidence).
Microcephaly v0.321 FANCG Seb Lunke Classified gene: FANCG as Green List (high evidence)
Microcephaly v0.321 FANCG Seb Lunke Gene: fancg has been classified as Green List (High Evidence).
Microcephaly v0.320 FANCF Zornitza Stark Classified gene: FANCF as Green List (high evidence)
Microcephaly v0.320 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Microcephaly v0.319 ERCC4 Ain Roesley gene: ERCC4 was added
gene: ERCC4 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC4 were set to Fanconi anemia, complementation group Q (MIM#615272); Cockayne syndrome (MIM#278760)
Penetrance for gene: ERCC4 were set to unknown
Review for gene: ERCC4 was set to GREEN
Added comment: Microcephaly is a well established feature in Cockayne syndrome
Sources: Literature
Microcephaly v0.319 FANCE Seb Lunke Marked gene: FANCE as ready
Microcephaly v0.319 FANCE Seb Lunke Gene: fance has been classified as Green List (High Evidence).
Microcephaly v0.319 FANCE Seb Lunke Classified gene: FANCE as Green List (high evidence)
Microcephaly v0.319 FANCE Seb Lunke Gene: fance has been classified as Green List (High Evidence).
Microcephaly v0.318 FANCI Zornitza Stark Marked gene: FANCI as ready
Microcephaly v0.318 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Microcephaly v0.318 FANCI Zornitza Stark Classified gene: FANCI as Green List (high evidence)
Microcephaly v0.318 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Microcephaly v0.317 FANCF Belinda Chong gene: FANCF was added
gene: FANCF was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCF were set to 20301575
Phenotypes for gene: FANCF were set to Fanconi anemia, complementation group F, MIM# 603467
Review for gene: FANCF was set to GREEN
Added comment: Well established gene disease association
Sources: https://www.ncbi.nlm.nih.gov/books/NBK1401/
Sources: Literature
Microcephaly v0.317 FANCG Paul De Fazio gene: FANCG was added
gene: FANCG was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCG were set to 20301575
Phenotypes for gene: FANCG were set to Fanconi anemia, complementation group G MIM#614082
Review for gene: FANCG was set to GREEN
gene: FANCG was marked as current diagnostic
Added comment: Well-established gene-disease association, microcephaly is a feature.
Sources: Literature
Microcephaly v0.317 FANCL Zornitza Stark Marked gene: FANCL as ready
Microcephaly v0.317 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Microcephaly v0.317 FANCL Zornitza Stark Classified gene: FANCL as Green List (high evidence)
Microcephaly v0.317 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Microcephaly v0.316 FANCL Zornitza Stark gene: FANCL was added
gene: FANCL was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCL were set to 20301575
Phenotypes for gene: FANCL were set to Fanconi anemia, complementation group L, MIM# 614083
Review for gene: FANCL was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert list
Microcephaly v0.316 FANCC Seb Lunke Marked gene: FANCC as ready
Microcephaly v0.316 FANCC Seb Lunke Gene: fancc has been classified as Green List (High Evidence).
Microcephaly v0.316 FANCC Seb Lunke Classified gene: FANCC as Green List (high evidence)
Microcephaly v0.316 FANCC Seb Lunke Gene: fancc has been classified as Green List (High Evidence).
Microcephaly v0.315 FANCI Ain Roesley gene: FANCI was added
gene: FANCI was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCI was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCI were set to 20301575
Phenotypes for gene: FANCI were set to Fanconi anemia, complementation group I (MIM#609053)
Penetrance for gene: FANCI were set to unknown
Review for gene: FANCI was set to GREEN
Added comment: 75% of Fanconi Anemia (FA) patients have microcephaly and approx 1% cases is caused by FANCI
Sources: Literature
Microcephaly v0.315 FANCA Seb Lunke Marked gene: FANCA as ready
Microcephaly v0.315 FANCA Seb Lunke Gene: fanca has been classified as Green List (High Evidence).
Mendeliome v0.4125 FANCD2 Dean Phelan reviewed gene: FANCD2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:20301575; Phenotypes: Fanconi anemia 227646; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.315 FANCA Seb Lunke Classified gene: FANCA as Green List (high evidence)
Microcephaly v0.315 FANCA Seb Lunke Gene: fanca has been classified as Green List (High Evidence).
Microcephaly v0.314 FANCE Naomi Baker gene: FANCE was added
gene: FANCE was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCE were set to PMID: 20301575
Phenotypes for gene: FANCE were set to Fanconi anemia, complementation group E, MIM#600901
Penetrance for gene: FANCE were set to Complete
Review for gene: FANCE was set to GREEN
Added comment: Well established gene-disease association, with microcephaly a reported feature.
Sources: Literature
Microcephaly v0.314 FANCA Seb Lunke gene: FANCA was added
gene: FANCA was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: FANCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCA were set to 20301575
Phenotypes for gene: FANCA were set to Fanconi anemia, complementation group A (MIM#227650)
Review for gene: FANCA was set to GREEN
gene: FANCA was marked as current diagnostic
Added comment: Well established gene disease association
Sources: Expert Review
Microcephaly v0.314 FANCB Zornitza Stark Marked gene: FANCB as ready
Microcephaly v0.314 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Microcephaly v0.314 FANCB Zornitza Stark Classified gene: FANCB as Green List (high evidence)
Microcephaly v0.314 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Microcephaly v0.313 FANCB Zornitza Stark gene: FANCB was added
gene: FANCB was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: FANCB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: FANCB were set to 20301575
Phenotypes for gene: FANCB were set to Fanconi anemia, complementation group B, MIM# 300514
Review for gene: FANCB was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert list
Microcephaly v0.312 FANCC Ain Roesley gene: FANCC was added
gene: FANCC was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: FANCC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FANCC were set to 20301575
Phenotypes for gene: FANCC were set to Fanconi anemia, complementation group C (MIM#227645)
Penetrance for gene: FANCC were set to unknown
Review for gene: FANCC was set to GREEN
Added comment: 75% of Fanconi Anemia (FA) patients have microcephaly and approx 14% cases is caused by FANCC
Sources: Literature
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Marked gene: CHD4 as ready
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Gene: chd4 has been classified as Green List (High Evidence).
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Classified gene: CHD4 as Green List (high evidence)
Macrocephaly_Megalencephaly v0.46 CHD4 Seb Lunke Gene: chd4 has been classified as Green List (High Evidence).
Mendeliome v0.4125 DIAPH1 Zornitza Stark Marked gene: DIAPH1 as ready
Mendeliome v0.4125 DIAPH1 Zornitza Stark Gene: diaph1 has been classified as Green List (High Evidence).
Mendeliome v0.4125 DIAPH1 Zornitza Stark Phenotypes for gene: DIAPH1 were changed from to Deafness; thrombocytopenia 124900; Seizures; cortical blindness; microcephaly 616632
Macrocephaly_Megalencephaly v0.45 CHD4 Ain Roesley gene: CHD4 was added
gene: CHD4 was added to Macrocephaly_Megalencephaly. Sources: Literature
Mode of inheritance for gene: CHD4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CHD4 were set to 31388190; 27616479
Phenotypes for gene: CHD4 were set to Sifrim-Hitz-Weiss syndrome (MIM#617159)
Penetrance for gene: CHD4 were set to unknown
Review for gene: CHD4 was set to GREEN
Added comment: PMID: 31388190
Out of 32 probands, 5 had OFC of > 3 SD

PMID: 27616479
Out of 5 patients, 3 had OFC of >98th percentiles and 1x 90th

* all de novo variants
Sources: Literature
Mendeliome v0.4124 DIAPH1 Zornitza Stark Publications for gene: DIAPH1 were set to
Mendeliome v0.4123 UFC1 Seb Lunke Marked gene: UFC1 as ready
Mendeliome v0.4123 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Mendeliome v0.4123 DIAPH1 Zornitza Stark Mode of inheritance for gene: DIAPH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4122 UFC1 Seb Lunke Classified gene: UFC1 as Green List (high evidence)
Mendeliome v0.4122 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Microcephaly v0.312 UFC1 Seb Lunke Marked gene: UFC1 as ready
Microcephaly v0.312 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Microcephaly v0.312 UFC1 Seb Lunke Publications for gene: UFC1 were set to 29868776
Mendeliome v0.4121 UFC1 Paul De Fazio gene: UFC1 was added
gene: UFC1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFC1 were set to 29868776; 30552426
Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth (MIM#618076)
Review for gene: UFC1 was set to GREEN
gene: UFC1 was marked as current diagnostic
Added comment: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.

In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1. Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and the authors suggested that complete loss of function would be embryonic lethal.

PMID 30552426: 1 more individual with epileptic encephalopathy reported with a different homozygous missense variant in UFC1. The patient had microcephaly <3rd percentile.
Sources: Literature
Microcephaly v0.311 UFC1 Seb Lunke Classified gene: UFC1 as Green List (high evidence)
Microcephaly v0.311 UFC1 Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence).
Microcephaly v0.310 CHD4 Seb Lunke Marked gene: CHD4 as ready
Microcephaly v0.310 CHD4 Seb Lunke Gene: chd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.310 CHD4 Seb Lunke Phenotypes for gene: CHD4 were changed from to Sifrim-Hitz-Weiss syndrome (MIM#617159)
Microcephaly v0.309 UFC1 Paul De Fazio edited their review of gene: UFC1: Changed rating: GREEN
Microcephaly v0.309 TUBGCP4 Zornitza Stark Marked gene: TUBGCP4 as ready
Microcephaly v0.309 TUBGCP4 Zornitza Stark Gene: tubgcp4 has been classified as Green List (High Evidence).
Microcephaly v0.309 UFC1 Paul De Fazio changed review comment from: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.
Sources: Literature; to: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.

In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1. Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and the authors suggested that complete loss of function would be embryonic lethal.

PMID 30552426: 1 more individual with epileptic encephalopathy reported with a different homozygous missense variant in UFC1. The patient had microcephaly <3rd percentile.

Sources: Literature
Microcephaly v0.309 TUBGCP4 Zornitza Stark Classified gene: TUBGCP4 as Green List (high evidence)
Microcephaly v0.309 TUBGCP4 Zornitza Stark Gene: tubgcp4 has been classified as Green List (High Evidence).
Microcephaly v0.309 CHD4 Seb Lunke Publications for gene: CHD4 were set to
Microcephaly v0.308 CHD4 Seb Lunke Mode of inheritance for gene: CHD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.308 UBA5 Zornitza Stark Marked gene: UBA5 as ready
Microcephaly v0.308 UBA5 Zornitza Stark Gene: uba5 has been classified as Green List (High Evidence).
Microcephaly v0.308 UBA5 Zornitza Stark Classified gene: UBA5 as Green List (high evidence)
Microcephaly v0.308 UBA5 Zornitza Stark Gene: uba5 has been classified as Green List (High Evidence).
Microcephaly v0.307 CHD4 Seb Lunke Classified gene: CHD4 as Amber List (moderate evidence)
Microcephaly v0.307 CHD4 Seb Lunke Added comment: Comment on list classification: Unclear what would differentiate Macro- from micro-cephaly in this gene, or if micro-cephaly is actually a feature of the condition
Microcephaly v0.307 CHD4 Seb Lunke Gene: chd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.306 DNM1L Zornitza Stark Marked gene: DNM1L as ready
Microcephaly v0.306 DNM1L Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green, but overall a small proportion of individuals have microcephaly.
Microcephaly v0.306 DNM1L Zornitza Stark Gene: dnm1l has been classified as Amber List (Moderate Evidence).
Microcephaly v0.306 DNM1L Zornitza Stark Phenotypes for gene: DNM1L were changed from to Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388
Microcephaly v0.305 UFC1 Paul De Fazio edited their review of gene: UFC1: Changed publications: 29868776, 30552426
Microcephaly v0.305 DNM1L Zornitza Stark Classified gene: DNM1L as Amber List (moderate evidence)
Microcephaly v0.305 DNM1L Zornitza Stark Gene: dnm1l has been classified as Amber List (Moderate Evidence).
Microcephaly v0.305 DNM1L Zornitza Stark Publications for gene: DNM1L were set to
Microcephaly v0.304 DNM1L Zornitza Stark Mode of inheritance for gene: DNM1L was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.303 CENPF Zornitza Stark Marked gene: CENPF as ready
Microcephaly v0.303 CENPF Zornitza Stark Gene: cenpf has been classified as Green List (High Evidence).
Microcephaly v0.303 CIT Zornitza Stark Marked gene: CIT as ready
Microcephaly v0.303 CIT Zornitza Stark Gene: cit has been classified as Green List (High Evidence).
Microcephaly v0.303 CIT Zornitza Stark Classified gene: CIT as Green List (high evidence)
Microcephaly v0.303 CIT Zornitza Stark Gene: cit has been classified as Green List (High Evidence).
Microcephaly v0.302 UBE3A Zornitza Stark Marked gene: UBE3A as ready
Microcephaly v0.302 UBE3A Zornitza Stark Gene: ube3a has been classified as Green List (High Evidence).
Microcephaly v0.302 UBE3A Zornitza Stark Phenotypes for gene: UBE3A were changed from to Angelman syndrome MIM#105830
Microcephaly v0.301 UBE3A Zornitza Stark Mode of inheritance for gene: UBE3A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.300 CHAMP1 Zornitza Stark Marked gene: CHAMP1 as ready
Microcephaly v0.300 CHAMP1 Zornitza Stark Gene: champ1 has been classified as Green List (High Evidence).
Microcephaly v0.300 CHAMP1 Zornitza Stark Publications for gene: CHAMP1 were set to
Microcephaly v0.299 CHAMP1 Zornitza Stark Mode of inheritance for gene: CHAMP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.298 CHAMP1 Zornitza Stark Phenotypes for gene: CHAMP1 were changed from to Mental retardation, autosomal dominant 40 (MIM#616579)
Microcephaly v0.297 CDKL5 Zornitza Stark Marked gene: CDKL5 as ready
Microcephaly v0.297 CDKL5 Zornitza Stark Gene: cdkl5 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.297 CENPF Zornitza Stark Classified gene: CENPF as Green List (high evidence)
Microcephaly v0.297 CENPF Zornitza Stark Gene: cenpf has been classified as Green List (High Evidence).
Mendeliome v0.4121 CENPE Seb Lunke Marked gene: CENPE as ready
Mendeliome v0.4121 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Mendeliome v0.4121 CENPE Seb Lunke Phenotypes for gene: CENPE were changed from to Microcephaly 13, primary, autosomal recessive (MIM#616051)
Microcephaly v0.296 CDKL5 Zornitza Stark Phenotypes for gene: CDKL5 were changed from to Epileptic encephalopathy, early infantile, 2 (MIM#300672)
Mendeliome v0.4120 CENPE Seb Lunke Publications for gene: CENPE were set to
Microcephaly v0.295 UFM1 Zornitza Stark Tag founder tag was added to gene: UFM1.
Microcephaly v0.295 UFM1 Zornitza Stark Marked gene: UFM1 as ready
Microcephaly v0.295 UFM1 Zornitza Stark Added comment: Comment when marking as ready: Green rating in view of the marked microcephaly, and large number of individuals reported with the founder variant. Rating is borderline but consistent across panels.
Microcephaly v0.295 UFM1 Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence).
Mendeliome v0.4119 CENPE Seb Lunke Mode of inheritance for gene: CENPE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.295 CENPE Seb Lunke Marked gene: CENPE as ready
Microcephaly v0.295 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Mendeliome v0.4118 CENPE Seb Lunke Classified gene: CENPE as Red List (low evidence)
Mendeliome v0.4118 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Microcephaly v0.295 UFM1 Zornitza Stark Classified gene: UFM1 as Green List (high evidence)
Microcephaly v0.295 UFM1 Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence).
Microcephaly v0.295 CENPE Seb Lunke Phenotypes for gene: CENPE were changed from to Microcephaly 13, primary, autosomal recessive (MIM#616051)
Mendeliome v0.4117 CENPE Ain Roesley reviewed gene: CENPE: Rating: RED; Mode of pathogenicity: None; Publications: 24748105, 30086807; Phenotypes: Microcephaly 13, primary, autosomal recessive (MIM#616051); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.294 CENPE Seb Lunke Publications for gene: CENPE were set to
Microcephaly v0.293 CENPE Seb Lunke Mode of inheritance for gene: CENPE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.292 CENPE Seb Lunke Classified gene: CENPE as Red List (low evidence)
Microcephaly v0.292 CENPE Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence).
Mendeliome v0.4117 CDC6 Seb Lunke Marked gene: CDC6 as ready
Mendeliome v0.4117 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.291 CKAP2L Ain Roesley gene: CKAP2L was added
gene: CKAP2L was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CKAP2L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CKAP2L were set to 29473684; 25439729
Phenotypes for gene: CKAP2L were set to Filippi syndrome (MIM#272440)
Penetrance for gene: CKAP2L were set to unknown
Review for gene: CKAP2L was set to GREEN
Added comment: PMID: 29473684
- 1x proband with head circumference -3SD

PMID: 25439729
- 11 patients, 7 have OFCs <= -3SD
Sources: Literature
Microcephaly v0.291 TUBB2B Paul De Fazio reviewed gene: TUBB2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 19465910, 22333901; Phenotypes: Cortical dysplasia, complex, with other brain malformations 7 MIM#610031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Mendeliome v0.4117 CDC6 Seb Lunke Phenotypes for gene: CDC6 were changed from to Meier-Gorlin syndrome 5 (MIM#613805)
Microcephaly v0.291 CDKL5 Zornitza Stark Publications for gene: CDKL5 were set to
Intellectual disability syndromic and non-syndromic v0.2925 CDC6 Seb Lunke Marked gene: CDC6 as ready
Intellectual disability syndromic and non-syndromic v0.2925 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2925 CDC6 Seb Lunke Phenotypes for gene: CDC6 were changed from to Meier-Gorlin syndrome 5 (MIM#613805)
Microcephaly v0.290 CDKL5 Zornitza Stark Mode of inheritance for gene: CDKL5 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.4116 CDC6 Seb Lunke Publications for gene: CDC6 were set to
Microcephaly v0.289 CDKL5 Zornitza Stark Classified gene: CDKL5 as Amber List (moderate evidence)
Microcephaly v0.289 CDKL5 Zornitza Stark Gene: cdkl5 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4115 CDC6 Seb Lunke Mode of inheritance for gene: CDC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2924 CDC6 Seb Lunke Publications for gene: CDC6 were set to
Mendeliome v0.4114 DIAPH1 Dean Phelan reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24781755, 26463574, 24781755, 27808407, 28003573, 28815995; Phenotypes: Deafness, thrombocytopenia, Seizures, cortical blindness, microcephaly; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4114 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Mendeliome v0.4114 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2923 CDC6 Seb Lunke Mode of inheritance for gene: CDC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2922 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Intellectual disability syndromic and non-syndromic v0.2922 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.288 CDK13 Seb Lunke Marked gene: CDK13 as ready
Microcephaly v0.288 CDK13 Seb Lunke Gene: cdk13 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.288 CDK13 Seb Lunke Phenotypes for gene: CDK13 were changed from to Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder (MIM#617360)
Microcephaly v0.287 UNC80 Zornitza Stark Marked gene: UNC80 as ready
Microcephaly v0.287 UNC80 Zornitza Stark Gene: unc80 has been classified as Green List (High Evidence).
Microcephaly v0.287 CDK13 Seb Lunke Publications for gene: CDK13 were set to
Microcephaly v0.287 UNC80 Zornitza Stark Phenotypes for gene: UNC80 were changed from to Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 MIM#616801
Microcephaly v0.286 CDK13 Seb Lunke Mode of inheritance for gene: CDK13 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.286 UNC80 Zornitza Stark Publications for gene: UNC80 were set to
Microcephaly v0.285 UNC80 Zornitza Stark Mode of inheritance for gene: UNC80 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4113 CDC6 Ain Roesley reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.284 CDK13 Seb Lunke Classified gene: CDK13 as Amber List (moderate evidence)
Microcephaly v0.284 CDK13 Seb Lunke Gene: cdk13 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2921 CDC6 Ain Roesley reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.283 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Microcephaly v0.283 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Microcephaly v0.283 DDX11 Zornitza Stark Classified gene: DDX11 as Green List (high evidence)
Microcephaly v0.283 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Microcephaly v0.282 TUBGCP4 Paul De Fazio gene: TUBGCP4 was added
gene: TUBGCP4 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: TUBGCP4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TUBGCP4 were set to 25817018
Phenotypes for gene: TUBGCP4 were set to Microcephaly and chorioretinopathy, autosomal recessive, MIM#616335
Review for gene: TUBGCP4 was set to GREEN
gene: TUBGCP4 was marked as current diagnostic
Added comment: 4 patients from 3 families with biallelic variants reported, all with microcephaly < -3SD. All had a synonymous splice variant on one allele.
Sources: Literature
Microcephaly v0.282 USP18 Zornitza Stark Marked gene: USP18 as ready
Microcephaly v0.282 USP18 Zornitza Stark Gene: usp18 has been classified as Red List (Low Evidence).
Microcephaly v0.282 USP18 Zornitza Stark Phenotypes for gene: USP18 were changed from to Pseudo-TORCH syndrome 2 MIM#617397
Microcephaly v0.281 USP18 Zornitza Stark Publications for gene: USP18 were set to
Microcephaly v0.280 CDC6 Seb Lunke Marked gene: CDC6 as ready
Microcephaly v0.280 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.280 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Microcephaly v0.280 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.280 USP18 Zornitza Stark Mode of inheritance for gene: USP18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.279 CDC6 Seb Lunke Classified gene: CDC6 as Red List (low evidence)
Microcephaly v0.279 CDC6 Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence).
Microcephaly v0.279 USP18 Zornitza Stark Classified gene: USP18 as Red List (low evidence)
Microcephaly v0.279 USP18 Zornitza Stark Gene: usp18 has been classified as Red List (Low Evidence).
Microcephaly v0.278 CCDC88A Zornitza Stark Classified gene: CCDC88A as Green List (high evidence)
Microcephaly v0.278 CCDC88A Zornitza Stark Gene: ccdc88a has been classified as Green List (High Evidence).
Microcephaly v0.277 CCDC88A Ain Roesley edited their review of gene: CCDC88A: Changed rating: GREEN; Changed phenotypes: PEHO syndrome-like (MIM#617507)
Microcephaly v0.277 BUB1B Seb Lunke Marked gene: BUB1B as ready
Microcephaly v0.277 BUB1B Seb Lunke Gene: bub1b has been classified as Green List (High Evidence).
Microcephaly v0.277 BUB1B Seb Lunke Phenotypes for gene: BUB1B were changed from to Mosaic variegated aneuploidy syndrome 1 (MIM#257300)
Microcephaly v0.276 CCDC88A Zornitza Stark Marked gene: CCDC88A as ready
Microcephaly v0.276 CCDC88A Zornitza Stark Gene: ccdc88a has been classified as Amber List (Moderate Evidence).
Microcephaly v0.276 BUB1B Seb Lunke Publications for gene: BUB1B were set to
Microcephaly v0.276 CCDC88A Zornitza Stark Classified gene: CCDC88A as Amber List (moderate evidence)
Microcephaly v0.276 CCDC88A Zornitza Stark Gene: ccdc88a has been classified as Amber List (Moderate Evidence).
Microcephaly v0.275 BUB1B Seb Lunke Mode of inheritance for gene: BUB1B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.274 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Microcephaly v0.274 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Microcephaly v0.274 DHCR7 Zornitza Stark Classified gene: DHCR7 as Green List (high evidence)
Microcephaly v0.274 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Microcephaly v0.273 UBA5 Paul De Fazio gene: UBA5 was added
gene: UBA5 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UBA5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UBA5 were set to 27545674; 27545681
Phenotypes for gene: UBA5 were set to Epileptic encephalopathy, early infantile, 44 (MIM#617132)
Review for gene: UBA5 was set to GREEN
gene: UBA5 was marked as current diagnostic
Added comment: PMID 27545674: 8 patients from 5 unrelated families with biallelic variants reported. All had the same missense variant on one allele (517hets in gnomAD), which they referred to as a hypomorphic allele. 7 of the 8 were microcephalic (they used < -3SD as diagnostic criteria).

PMID 27545681: 5 patients from 4 families with biallelic variants reported. Head circumferences were cited as: -3.5SD, -2SD, 4th centile, -2.5SD, -2.4SD.
Sources: Literature
Microcephaly v0.273 DHCR7 Belinda Chong changed review comment from: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/)

More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7)
Sources: Literature; to: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/, ClinVar)

More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7)
Sources: Literature
Microcephaly v0.273 DNM1L Naomi Baker changed review comment from: Most individuals reported with variants in DNM1L do not have microcephaly listed as a phenotype.

PMID: 17460227 - Reports a newborn girl with microcephaly (head circumference below the 0.4 percentile), abnormal brain development, optic atrophy and hypoplasia, persistent lactic acidemia, and a mildly elevated plasma concentration of very-long-chain fatty acids. She died suddenly at the age of 37 days. A monoallelic missense variant was identified.

PMID: 26992161 - A monoallelic missense variant reported in a 2 year old boy with a chronic neurological disorder, characterized by postnatal microcephaly (OFC 45.5 cm (<3rd centile)), developmental delay, and pain insensitivity.

PMID: 30801875 - Five patients presenting with severe epileptic encephalopathy; microcephaly (<3rd percentile) reported in one patient. Five de novo dominant DNM1L variants were identified.
Loss-of-function and dominant negative; to: Most individuals reported with variants in DNM1L do not have microcephaly listed as a phenotype.

PMID: 17460227 - Reports a newborn girl with microcephaly (head circumference below the 0.4 percentile), abnormal brain development, optic atrophy and hypoplasia, persistent lactic acidemia, and a mildly elevated plasma concentration of very-long-chain fatty acids. She died suddenly at the age of 37 days. A monoallelic missense variant was identified.

PMID: 26992161 - A monoallelic missense variant reported in a 2 year old boy with a chronic neurological disorder, characterized by postnatal microcephaly (OFC 45.5 cm (<3rd centile)), developmental delay, and pain insensitivity.

PMID: 30801875 - Five patients presenting with severe epileptic encephalopathy; microcephaly (<3rd percentile) reported in one patient. Five de novo dominant DNM1L variants were identified.

Both loss-of-function (variants within the GTPase domain) and dominant negative (variants within the middle domain) mechanisms have been reported.
Microcephaly v0.273 DNM1L Naomi Baker reviewed gene: DNM1L: Rating: AMBER; Mode of pathogenicity: Other; Publications: PMID: 17460227, 26992161, 30801875; Phenotypes: Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.273 CIT Ain Roesley gene: CIT was added
gene: CIT was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CIT was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CIT were set to 27453578; 27503289; 27453579
Phenotypes for gene: CIT were set to Microcephaly 17, primary, autosomal recessive (MIM#617090)
Penetrance for gene: CIT were set to unknown
Review for gene: CIT was set to GREEN
Added comment: PMID: 27453578
- 3 consanguineous families with 7 affecteds and head circumferences ranging from -5.6 SD to -8.4 SD

PMID: 27503289
- 2 consanguineous families with 2 affecteds and OFCs of -9 and -10 SDs

PMID: 27453579
- 3 families (2 consanguineous) with 6 affecteds
- only 3 had OFCs records:: birth and last examined ranged from -3.5 to -12 SDs

*mix of missense and PTVs
Sources: Literature
Microcephaly v0.273 CHD4 Ain Roesley reviewed gene: CHD4: Rating: AMBER; Mode of pathogenicity: None; Publications: 31388190; Phenotypes: Sifrim-Hitz-Weiss syndrome (MIM#617159); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.273 UBE3A Paul De Fazio reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Angelman syndrome MIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed); Current diagnostic: yes
Microcephaly v0.273 CHAMP1 Ain Roesley reviewed gene: CHAMP1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27148580, 26340335; Phenotypes: Mental retardation, autosomal dominant 40 (MIM#616579); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.273 UFC1 Paul De Fazio gene: UFC1 was added
gene: UFC1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFC1 were set to 29868776
Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth (MIM#618076)
Review for gene: UFC1 was set to AMBER
gene: UFC1 was marked as current diagnostic
Added comment: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided.

The following head circumference measurements were provided for 6 of the affecteds:

51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo.

3 of the families were consanguineous Saudi families with the same homozygous missense variant.
Sources: Literature
Microcephaly v0.273 CENPF Ain Roesley gene: CENPF was added
gene: CENPF was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CENPF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CENPF were set to 25564561; 28407396; 27300082; 31953238
Phenotypes for gene: CENPF were set to Stromme syndrome (MIM#243605)
Penetrance for gene: CENPF were set to unknown
Review for gene: CENPF was set to GREEN
Added comment: *Several Stromme syndrome patients reported with microcephaly however only the following were genetically confirmed.

PMID: 31953238
- 2 siblings from a consanguineous Saudi family
- Patient 1: head circumference -3.33 SD (44cm) at 3 years and -4.4 SD (45.5cm) at 6 years
- Patient 2: +5.07 SD (39.5cm) at birth and +8.99 SD (49cm) at 2 months
- homozygous splice variant

PMID: 28407396
- 1x proband with head circumference -6.29 SD (at birth) and -7.57 SD at 18 months
- homozygous fs variant

PMID: 25564561;
- 1x proband with OFC <0.4 centile (29.5cm) at birth and adult OFC of <0.4 centile (45.5cm)
- cHet for 2x nonsense variants

PMID: 27300082 ;
- 1x proband with OFC <3rd centile
- chet for PTVs
Sources: Literature
Microcephaly v0.273 UFM1 Paul De Fazio gene: UFM1 was added
gene: UFM1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UFM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UFM1 were set to 28931644; 29868776; 31914610
Phenotypes for gene: UFM1 were set to Leukodystrophy, hypomyelinating, 14 MIM#617899
Review for gene: UFM1 was set to AMBER
gene: UFM1 was marked as current diagnostic
Added comment: Summary: Only 2 variants reported in this gene, one a founder promoter variant and one a missense variant found in 2 Sudanese families (3 hets in gnomAD). All affected individuals were reported with microcephaly but measurements only provided for two. A Drosophila model supports an association of this gene with microcephaly, but it's Drosophila.

PMID 28931644: Found a 3bp deletion in the promoter region of UFM1 in 16 Roma individuals with hypomyelination with atrophy of the basal ganglia and cerebellum who were negative for TUBB4A mutations. Functional studies showed an effect on gene expressin in neuronal cell lines but not other cell lines. All affected individuals had microcephaly but no measurements were provided.

PMID 29868776: 4 affected individuals from 2 Sudanese families reported with the same missense variant. All four were said to have microcephaly but measurments only provided for two: Proband from family 1 had a head circumference of 40cm at 2yo; proband from family 2 had head circumference of < -4SD at 13mo.

PMID 31914610: Used Drosophila embryos to show that UFM1 knockdown was associated with developmental processes that lead to microcephaly.
Sources: Literature
Microcephaly v0.273 CENPE Ain Roesley reviewed gene: CENPE: Rating: RED; Mode of pathogenicity: None; Publications: 24748105, 30086807; Phenotypes: Microcephaly 13, primary, autosomal recessive (MIM#616051); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.273 CDKL5 Ain Roesley reviewed gene: CDKL5: Rating: AMBER; Mode of pathogenicity: None; Publications: 15689447, 19396824, 22678952, 31122804, 30928302; Phenotypes: Epileptic encephalopathy, early infantile, 2 (MIM#300672); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Microcephaly v0.273 UNC80 Paul De Fazio reviewed gene: UNC80: Rating: GREEN; Mode of pathogenicity: None; Publications: 26708751, 26708753, 26545877, 29572195; Phenotypes: Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 MIM#616801; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.273 DDX11 Naomi Baker gene: DDX11 was added
gene: DDX11 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DDX11 were set to PMID: 31824187; 20137776; 23033317.
Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM#613398
Penetrance for gene: DDX11 were set to Complete
Review for gene: DDX11 was set to GREEN
Added comment: The cardinal clinical features observed in Warsaw breakage syndrome (WABS) patients include severe pre- and post-natal growth retardation, microcephaly, sensorineural hearing loss, cochlear anomalies, facial dysmorphia and sister chromatid cohesion defects (PMID: 31824187).

A male patient with biallelic DDX11 variants (splice site and in-frame deletion) presented with several congenital abnormalities, including microcephaly, facial dysmorphy, high arched palate, coloboma of the right optic disc, deafness, small ventricular septal defect, bilateral clinodactyly of the fifth fingers, syndactyly of the second and third toes, cutis marmorata, and one hypo- and three hyperpigmented patches on the skin. Authors proposed to name the syndrome associated with defective DDX11 “Warsaw breakage syndrome” (WABS) (PMID: 20137776).

Three siblings carrying a biallelic DDX11 missense variant with clinical presentation of WABS: ID, growth retardation, and severe congenital abnormalities including microcephaly, facial dysmorphism, deafness due to cochlear abnormalities (in two of the sibs), and cardiac malformations (in one of the sibs) (PMID: 23033317).
Sources: Literature
Microcephaly v0.273 CDK13 Ain Roesley changed review comment from: Mild microcephaly in some patients (OMIM)

PMID: 29021403;
- 15 patients, all de novo missense
- OFC ranges from 50th to <0.4th centile. Only 4 patients have <0.4 centiles
(includes patients reported in PMID: 27479907)

PMID: 31238879;
- 7 patients with likely path variants in CDK13 (ACMG was used in classifications)
- 2 with microcephaly but measurements not provided; to: Mild microcephaly in some patients (OMIM)

PMID: 29021403;
- 15 patients, all de novo missense
- OFC ranges from 50th to <0.4th centile. Only 4 patients have <0.4 centiles and 2 with 1st centile
(includes patients reported in PMID: 27479907)

PMID: 31238879;
- 7 patients with likely path variants in CDK13 (ACMG was used in classifications)
- 2 with microcephaly but measurements not provided
Microcephaly v0.273 CDK13 Ain Roesley reviewed gene: CDK13: Rating: AMBER; Mode of pathogenicity: None; Publications: 27479907, 29021403, 31238879; Phenotypes: Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder (MIM#617360); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.273 USP18 Paul De Fazio reviewed gene: USP18: Rating: RED; Mode of pathogenicity: None; Publications: 27325888, 31940699; Phenotypes: Pseudo-TORCH syndrome 2 MIM#617397; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.273 CDC6 Ain Roesley gene: CDC6 was added
gene: CDC6 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CDC6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CDC6 were set to 21358632
Phenotypes for gene: CDC6 were set to Meier-Gorlin syndrome 5 (MIM#613805)
Penetrance for gene: CDC6 were set to unknown
Review for gene: CDC6 was set to RED
Added comment: PMID: 21358632;
- 1x proband with OFC -3.3SD
- homozygous for a missense

*no new reports since
Sources: Literature
Microcephaly v0.273 CCDC88A Ain Roesley gene: CCDC88A was added
gene: CCDC88A was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: CCDC88A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC88A were set to 30392057; 26917597
Phenotypes for gene: CCDC88A were set to PEHO syndrome-like (MIM#617507)
Penetrance for gene: CCDC88A were set to unknown
Review for gene: CCDC88A was set to AMBER
Added comment: PMID: 30392057
- consanguineous Saudi family with 2 affecteds. Homozygous for a nonsense variant
- microcephaly, dev delay, ID, epilepsy, dysmorphism and brain atropy
- no measurements provided

PMID: 26917597
- consanguineous family with 3 affecteds. Homozygous fs variant
- infantile hypotonia, dev delay, optic and brain atrophy, seizures and microcephaly (measurements not provided)
- functional studies on KO mice
Sources: Literature
Mendeliome v0.4113 GMNN Zornitza Stark changed review comment from: Three unrelated individuals reported.; to: Three unrelated individuals reported, all variants in exon 2 (first coding exon).
Microcephaly v0.273 GMNN Zornitza Stark Marked gene: GMNN as ready
Microcephaly v0.273 GMNN Zornitza Stark Gene: gmnn has been classified as Green List (High Evidence).
Microcephaly v0.273 GMNN Zornitza Stark Mode of inheritance for gene: GMNN was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.272 GMNN Zornitza Stark Classified gene: GMNN as Green List (high evidence)
Microcephaly v0.272 GMNN Zornitza Stark Gene: gmnn has been classified as Green List (High Evidence).
Microcephaly v0.271 GMNN Zornitza Stark edited their review of gene: GMNN: Changed phenotypes: Meier-Gorlin syndrome 6, MIM# 616835; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.271 GMNN Zornitza Stark gene: GMNN was added
gene: GMNN was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: GMNN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GMNN were set to 26637980
Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, MIM# 616835
Review for gene: GMNN was set to GREEN
Added comment: Three unrelated individuals reported with variants in exon 2 (first coding exon) and primordial dwarfism (including microcephaly), microtia, and absent patellae.
Sources: Expert list
Microcephaly v0.270 BUB1B Ain Roesley reviewed gene: BUB1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 18548531; Phenotypes: Mosaic variegated aneuploidy syndrome 1 (MIM#257300); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.270 KIF21B Zornitza Stark Marked gene: KIF21B as ready
Microcephaly v0.270 KIF21B Zornitza Stark Gene: kif21b has been classified as Green List (High Evidence).
Microcephaly v0.270 KIF21B Zornitza Stark Classified gene: KIF21B as Green List (high evidence)
Microcephaly v0.270 KIF21B Zornitza Stark Gene: kif21b has been classified as Green List (High Evidence).
Microcephaly v0.269 KIF21B Zornitza Stark gene: KIF21B was added
gene: KIF21B was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF21B were set to 32415109
Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly
Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: KIF21B was set to GREEN
Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors).
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Marked gene: CTNND1 as ready
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Classified gene: CTNND1 as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2921 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2920 CTNND1 Zornitza Stark gene: CTNND1 was added
gene: CTNND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CTNND1 were set to 28301459; 32196547
Phenotypes for gene: CTNND1 were set to Blepharocheilodontic syndrome 2, MIM# 617681
Review for gene: CTNND1 was set to AMBER
Added comment: 4 individuals from 3 unrelated families with blepharocheilodontic syndrome and mutations in the CTNND1 gene reported originally in PMID 28301459. All had eyelid anomalies, including ectropion of the lower lids, euryblepharon, lagophthalmia, and distichiasis. In addition, all 4 showed typical facial dysmorphism with hypertelorism, flat face, and high forehead, and all had conical teeth and tooth agenesis. Three had cleft lip and palate, 3 had hair anomalies, and 1 had hypothyroidism due to hypoplasia or aplasia of the thyroid gland. None of the patients exhibited anal atresia or neural tube defects.

PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).

This more recent publication suggests a broader phenotype associated with CTNND1 variants including dev delay, ADHD/ASD, behavioural issues. Unclear from description whether significant ID present.
Sources: Literature
Mendeliome v0.4113 CTNND1 Zornitza Stark Marked gene: CTNND1 as ready
Mendeliome v0.4113 CTNND1 Zornitza Stark Gene: ctnnd1 has been classified as Green List (High Evidence).
Mendeliome v0.4113 CTNND1 Zornitza Stark Publications for gene: CTNND1 were set to
Mendeliome v0.4112 CTNND1 Zornitza Stark reviewed gene: CTNND1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28301459; Phenotypes: Blepharocheilodontic syndrome 2, MIM# 617681; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.268 DHCR7 Belinda Chong edited their review of gene: DHCR7: Changed rating: GREEN; Changed phenotypes: Smith-Lemli-Opitz syndrome 270400
Microcephaly v0.268 DHCR7 Belinda Chong gene: DHCR7 was added
gene: DHCR7 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DHCR7 were set to 9634533; 12949967; 15670717; 14981719
Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400
Added comment: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/)

More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7)
Sources: Literature
Mendeliome v0.4112 CTNND1 Zornitza Stark Phenotypes for gene: CTNND1 were changed from to Blepharocheilodontic syndrome 2, MIM# 617681
Mendeliome v0.4111 CTNND1 Zornitza Stark Mode of inheritance for gene: CTNND1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Deafness_IsolatedAndComplex v0.383 DNMT1 Zornitza Stark Marked gene: DNMT1 as ready
Deafness_IsolatedAndComplex v0.383 DNMT1 Zornitza Stark Gene: dnmt1 has been classified as Green List (High Evidence).
Deafness_IsolatedAndComplex v0.383 DNMT1 Zornitza Stark Phenotypes for gene: DNMT1 were changed from to Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121; Neuropathy, hereditary sensory, type IE, 614116
Deafness_IsolatedAndComplex v0.382 DNMT1 Zornitza Stark Publications for gene: DNMT1 were set to
Deafness_IsolatedAndComplex v0.381 DNMT1 Zornitza Stark Mode of inheritance for gene: DNMT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Deafness_IsolatedAndComplex v0.380 DNMT1 Zornitza Stark reviewed gene: DNMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22328086, 21532572, 31984424; Phenotypes: Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121, Neuropathy, hereditary sensory, type IE, 614116; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4110 DNMT1 Zornitza Stark Publications for gene: DNMT1 were set to 22328086; 21532572
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Marked gene: RIPOR2 as ready
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Added comment: Comment when marking as ready: Insufficient evidence for Green rating for either MOI.
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Gene: ripor2 has been classified as Amber List (Moderate Evidence).
Deafness_IsolatedAndComplex v0.380 RIPOR2 Zornitza Stark Mode of inheritance for gene: RIPOR2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v0.379 RIPOR2 Zornitza Stark Phenotypes for gene: RIPOR2 were changed from Deafness, autosomal recessive 104, MIM# 616515 to Deafness, autosomal recessive 104, MIM# 616515; Deafness, autosomal dominant
Mendeliome v0.4109 RIPOR2 Zornitza Stark Phenotypes for gene: RIPOR2 were changed from Deafness, autosomal recessive 104, MIM# 616515 to Deafness, autosomal recessive 104, MIM# 616515; Deafness, autosomal dominant
Deafness_IsolatedAndComplex v0.378 RIPOR2 Zornitza Stark Publications for gene: RIPOR2 were set to 24958875
Deafness_IsolatedAndComplex v0.377 RIPOR2 Zornitza Stark Tag founder tag was added to gene: RIPOR2.
Deafness_IsolatedAndComplex v0.377 RIPOR2 Zornitza Stark changed review comment from: Single family and animal model data.
Sources: Expert list; to: Single family with bi-allelic variants and animal model data.
Sources: Expert list
Deafness_IsolatedAndComplex v0.377 RIPOR2 Zornitza Stark edited their review of gene: RIPOR2: Added comment: PMID: 32631815 (2020) - A heterozygous 12 nucleotide in-frame deletion (c.1696_1707del, p.Gln566_Lys569del) in RIPOR2 was detected in 12 families of Dutch origin with non-syndromic hearing loss.

In total, the variant was detected in 59/63 affected participants, but also in five unaffected subjects from three family. Age of onset was highly variable, from congenital to 70 years (mean age: 30.6 years) - unaffected family members who harboured the variant were aged 23, 40, 49, 50, and 51 years, respectively. The authors speculate that the four affected subjects without the variant represent phenocopies. The presence of an identical variant in 12 families of common origin, as well as haplotype analysis, indicates a founder effect.

Functional analysis of the variant showed aberrant localisation of mutant-RIPOR2 in early postnatal mouse hair cells, ex vivo; and failure to rescue the stereocilia defects of Ripor2 knockout mice, in contrast to the rescue effect observed in cells expressing wild-type RIPOR2.; Changed publications: 24958875, 32631815; Changed phenotypes: Deafness, autosomal recessive 104, MIM# 616515, Deafness, autosomal dominant
Mendeliome v0.4108 RIPOR2 Zornitza Stark changed review comment from: Single family and animal model data.
Sources: Expert list; to: Single family with bi-allelic variants and animal model data.
Sources: Expert list
Mendeliome v0.4108 RIPOR2 Zornitza Stark Marked gene: RIPOR2 as ready
Mendeliome v0.4108 RIPOR2 Zornitza Stark Added comment: Comment when marking as ready: Insufficient evidence for Green rating for either MOI.
Mendeliome v0.4108 RIPOR2 Zornitza Stark Gene: ripor2 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4108 RIPOR2 Zornitza Stark Publications for gene: RIPOR2 were set to 24958875
Mendeliome v0.4107 RIPOR2 Zornitza Stark Mode of inheritance for gene: RIPOR2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4106 RIPOR2 Zornitza Stark Tag founder tag was added to gene: RIPOR2.
Mendeliome v0.4106 NOTCH3 Zornitza Stark Classified gene: NOTCH3 as No list
Mendeliome v0.4106 NOTCH3 Zornitza Stark Gene: notch3 has been removed from the panel.
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Marked gene: NOTCH3 as ready
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence).
Microcephaly v0.268 BRIP1 Ain Roesley gene: BRIP1 was added
gene: BRIP1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BRIP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BRIP1 were set to Fanconi anemia, complementation group J (MIM#609054)
Penetrance for gene: BRIP1 were set to unknown
Review for gene: BRIP1 was set to GREEN
Added comment: 75% of Fanconi anemia (FA) patients present with microcephaly and BRIP1 contributes to approx 2% of FA diagnosis (gene reviews)
Sources: Literature
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Phenotypes for gene: NOTCH3 were changed from to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310
Early-onset Dementia v0.75 NOTCH3 Zornitza Stark Publications for gene: NOTCH3 were set to
Early-onset Dementia v0.74 NOTCH3 Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.73 NOTCH3 Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Stroke v0.55 NOTCH3 Zornitza Stark Marked gene: NOTCH3 as ready
Stroke v0.55 NOTCH3 Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence).
Stroke v0.55 NOTCH3 Zornitza Stark Publications for gene: NOTCH3 were set to
Stroke v0.54 NOTCH3 Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4105 TET2 Zornitza Stark Phenotypes for gene: TET2 were changed from to Dementia; Lymphoma/myeloid malignancy
Mendeliome v0.4104 TET2 Zornitza Stark Mode of inheritance for gene: TET2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4103 TET2 Zornitza Stark Publications for gene: TET2 were set to
Early-onset Dementia v0.73 TET2 Zornitza Stark Marked gene: TET2 as ready
Early-onset Dementia v0.73 TET2 Zornitza Stark Gene: tet2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.73 TET2 Zornitza Stark gene: TET2 was added
gene: TET2 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: TET2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TET2 were set to 32330418; 31943063
Phenotypes for gene: TET2 were set to Dementia
Review for gene: TET2 was set to RED
Added comment: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution. PMID: 31943063 - Li et al 2020 - functional studies in mice show that Tet2 depletion in the hippocampus exacerbates Alzheimer disease pathology and cognitive dysfunction at early disease stages.
Sources: Literature
Mendeliome v0.4102 TET2 Zornitza Stark edited their review of gene: TET2: Changed phenotypes: Dementia, Lymphoma/myeloid malignancy; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cholestasis v0.179 ZFYVE19 Zornitza Stark Marked gene: ZFYVE19 as ready
Cholestasis v0.179 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Cholestasis v0.179 ZFYVE19 Zornitza Stark Classified gene: ZFYVE19 as Green List (high evidence)
Cholestasis v0.179 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Cholestasis v0.178 ZFYVE19 Zornitza Stark gene: ZFYVE19 was added
gene: ZFYVE19 was added to Cholestasis. Sources: Literature
Mode of inheritance for gene: ZFYVE19 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFYVE19 were set to 32737136
Phenotypes for gene: ZFYVE19 were set to Cholestasis
Review for gene: ZFYVE19 was set to GREEN
Added comment: PMID: 32737136 (2020) - Nine Han Chinese children from seven families with biallelic, predicted complete LoF variants in ZFYVE19. All patients had high-GGT intrahepatic cholestasis, portal hypertension, and histopathological features of the ductal plate malformation/congenital hepatic fibrosis. ZFYVE19 depletion in cultured cells from one patient yielded centriolar and axonemal abnormalities, and immunostaining for two ciliary proteins DCDC2 and ACALT showed abnormal localisation in patient cholangiocytes, indicating this as a novel ciliopathy disorder.
Sources: Literature
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Marked gene: ZFYVE19 as ready
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Classified gene: ZFYVE19 as Green List (high evidence)
Mendeliome v0.4102 ZFYVE19 Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence).
Mendeliome v0.4101 TRPM7 Zornitza Stark Phenotypes for gene: TRPM7 were changed from {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500 to {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500; Cardiac arrhythmia, stillbirth
Mendeliome v0.4100 TRPM7 Zornitza Stark Publications for gene: TRPM7 were set to
Mendeliome v0.4099 TRPM7 Zornitza Stark Mode of inheritance for gene: TRPM7 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4098 TRPM7 Zornitza Stark Classified gene: TRPM7 as Amber List (moderate evidence)
Mendeliome v0.4098 TRPM7 Zornitza Stark Gene: trpm7 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4097 TRPM7 Zornitza Stark edited their review of gene: TRPM7: Added comment: Ion channel expressed in the nervous and cardiac systems. The variant associated with ALS/dementia in the Guam population, p.Thr1482Ile is present in >23,000 hets in gnomad, which is out of keeping for a rare Mendelian disorder. Note recent publication associating missense variants with cardiac arrhythmia and stillbirth, with some functional data provided to substantiate effect of variant on protein function but not necessarily establish gene-disease association.; Changed rating: AMBER; Changed publications: 32503408, 31423533; Changed phenotypes: {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500, Cardiac arrhythmia, stillbirth; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mitochondrial disease v0.475 CHCHD10 Zornitza Stark Marked gene: CHCHD10 as ready
Mitochondrial disease v0.475 CHCHD10 Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence).
Mitochondrial disease v0.475 CHCHD10 Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911; Spinal muscular atrophy, Jokela type 615048; Myopathy, isolated mitochondrial, autosomal dominant 616209
Mitochondrial disease v0.474 CHCHD10 Zornitza Stark Publications for gene: CHCHD10 were set to
Mitochondrial disease v0.473 CHCHD10 Zornitza Stark Mode of pathogenicity for gene: CHCHD10 was changed from to Other
Mitochondrial disease v0.472 CHCHD10 Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mitochondrial disease v0.471 CHCHD10 Zornitza Stark Tag founder tag was added to gene: CHCHD10.
Mitochondrial disease v0.471 CHCHD10 Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: Other; Publications: 24934289, 25428574, 25193783, 32042922, 31690696, 30877432, 30874923, 31261376; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911, Spinal muscular atrophy, Jokela type 615048, Myopathy, isolated mitochondrial, autosomal dominant 616209; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4097 CHCHD10 Zornitza Stark Marked gene: CHCHD10 as ready
Mendeliome v0.4097 CHCHD10 Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence).
Mendeliome v0.4097 CHCHD10 Zornitza Stark Tag founder tag was added to gene: CHCHD10.
Mendeliome v0.4097 CHCHD10 Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911; Spinal muscular atrophy, Jokela type 615048; Myopathy, isolated mitochondrial, autosomal dominant 616209
Mendeliome v0.4096 CHCHD10 Zornitza Stark Publications for gene: CHCHD10 were set to
Mendeliome v0.4095 CHCHD10 Zornitza Stark Mode of pathogenicity for gene: CHCHD10 was changed from to Other
Mendeliome v0.4094 CHCHD10 Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4093 CHCHD10 Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: Other; Publications: 24934289, 25428574, 25193783, 32042922, 31690696, 30877432, 30874923; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911, Spinal muscular atrophy, Jokela type 615048, Myopathy, isolated mitochondrial, autosomal dominant 616209; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2919 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Intellectual disability syndromic and non-syndromic v0.2918 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Genetic Epilepsy v0.830 ADARB1 Zornitza Stark Marked gene: ADARB1 as ready
Genetic Epilepsy v0.830 ADARB1 Zornitza Stark Gene: adarb1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.830 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Genetic Epilepsy v0.829 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Mendeliome v0.4093 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Mendeliome v0.4092 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Microcephaly v0.268 ADARB1 Zornitza Stark Marked gene: ADARB1 as ready
Microcephaly v0.268 ADARB1 Zornitza Stark Gene: adarb1 has been classified as Green List (High Evidence).
Microcephaly v0.268 ADARB1 Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures
Microcephaly v0.267 ADARB1 Zornitza Stark Publications for gene: ADARB1 were set to 32220291
Mendeliome v0.4091 CTNND1 Eleanor Williams changed review comment from: PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).; to: PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).
Mendeliome v0.4091 CTNND1 Eleanor Williams reviewed gene: CTNND1: Rating: ; Mode of pathogenicity: None; Publications: 32196547; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.4091 DNMT1 Eleanor Williams reviewed gene: DNMT1: Rating: ; Mode of pathogenicity: None; Publications: 31984424; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.4091 RIPOR2 Arina Puzriakova reviewed gene: RIPOR2: Rating: AMBER; Mode of pathogenicity: None; Publications: 32631815; Phenotypes: Sensorineural hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)
Mendeliome v0.4091 NOTCH3 Eleanor Williams gene: NOTCH3 was added
gene: NOTCH3 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: NOTCH3 were set to 31960911
Phenotypes for gene: NOTCH3 were set to CADASIL
Review for gene: NOTCH3 was set to AMBER
Added comment: PMID: 31960911 - Gravesteijn et al 2020 - describe a family with a unique cysteine-altering NOTCH3 variant in exon 9 in 5 individuals, which is predicted to cause natural exon 9 skipping. This mimics the therapeutic NOTCH3 cysteine correction approach and allows the effect of cysteine corrective exon skipping on NOTCH3 protein aggregation and disease severity in humans to be studied. In this family the CADASIL phenotype was mild.

Note this gene is rated green on the Neurodegenerative disorders - adult onset panel in the Genomics England instance of PanelApp https://panelapp.genomicsengland.co.uk/panels/474/gene/NOTCH3/
Sources: Literature
Mendeliome v0.4091 TET2 Eleanor Williams commented on gene: TET2
Mendeliome v0.4091 TRPM7 Eleanor Williams commented on gene: TRPM7: PMID: 31423533 - Cartwright et al 2020 - functional studies on four heterozygous nonsynonymous variants that were observed in TRPM7 in four individual cases of unexplained still birth which were screened for variants in 35 candidate genes in PMID: 29874177 (Munroe et al 2018). TRPM7 is a ubiquitously expressed ion channel known to regulate cardiac development and repolarization in mice. They found two variants in TRPM7, p.G179V and p.T860M, reduce ion channel current expression, which in the case of p.T860M is likely due to rapid degradation mediated by the proteasome. In addition, the p.R494Q TRPM7 variant significantly increases TRPM7 ion channel current, in a cell-type specific manner. They believe that TRPM7 may play a key role in ensuring correct cardiac development of the fetus.
Mendeliome v0.4091 ZFYVE19 Arina Puzriakova gene: ZFYVE19 was added
gene: ZFYVE19 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ZFYVE19 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFYVE19 were set to 32737136
Phenotypes for gene: ZFYVE19 were set to Cholestasis
Review for gene: ZFYVE19 was set to GREEN
Added comment: PMID: 32737136 (2020) - Nine Han Chinese children from seven families with biallelic, predicted complete LoF variants in ZFYVE19. All patients had high-GGT intrahepatic cholestasis, portal hypertension, and histopathological features of the ductal plate malformation/congenital hepatic fibrosis.

ZFYVE19 depletion in cultured cells from one patient yielded centriolar and axonemal abnormalities, and immunostaining for two ciliary proteins DCDC2 and ACALT showed abnormal localisation in patient cholangiocytes, indicating this as a novel ciliopathy disorder.
Sources: Literature
Mendeliome v0.4091 TRPM7 Eleanor Williams reviewed gene: TRPM7: Rating: AMBER; Mode of pathogenicity: None; Publications: 31423533, 29874177; Phenotypes: still birth, cardiac development; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4091 CHCHD10 Eleanor Williams reviewed gene: CHCHD10: Rating: ; Mode of pathogenicity: None; Publications: 31261376; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.4091 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2917 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.828 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.266 ADARB1 Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.266 HDAC8 Zornitza Stark Marked gene: HDAC8 as ready
Microcephaly v0.266 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Microcephaly v0.266 HDAC8 Zornitza Stark Classified gene: HDAC8 as Green List (high evidence)
Microcephaly v0.266 HDAC8 Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence).
Microcephaly v0.265 HDAC8 Zornitza Stark gene: HDAC8 was added
gene: HDAC8 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: HDAC8 were set to 24403048
Phenotypes for gene: HDAC8 were set to Cornelia de Lange syndrome 5, MIM# 300882
Review for gene: HDAC8 was set to GREEN
Added comment: Over 35 individuals reported, ~30% had microcephaly.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v0.2917 IARS Zornitza Stark Tag new gene name tag was added to gene: IARS.
Mendeliome v0.4091 IARS Zornitza Stark Tag new gene name tag was added to gene: IARS.
Microcephaly v0.264 IARS Zornitza Stark Marked gene: IARS as ready
Microcephaly v0.264 IARS Zornitza Stark Gene: iars has been classified as Green List (High Evidence).
Microcephaly v0.264 IARS Zornitza Stark Tag new gene name tag was added to gene: IARS.
Microcephaly v0.264 IARS Zornitza Stark Classified gene: IARS as Green List (high evidence)
Microcephaly v0.264 IARS Zornitza Stark Gene: iars has been classified as Green List (High Evidence).
Microcephaly v0.263 IARS Zornitza Stark gene: IARS was added
gene: IARS was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: IARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IARS were set to 27426735; 27891590
Phenotypes for gene: IARS were set to Growth retardation, impaired intellectual development, hypotonia, and hepatopathy, MIM# 617093
Review for gene: IARS was set to GREEN
Added comment: Microcephaly -3 to -5SD is part of the phenotype of this autosomal recessive multisystem disorder characterised by poor overall growth, impaired intellectual development, hypotonia, and variable liver dysfunction. Additional features, such as seizures and hearing loss, may also be present. At least 4 families reported. Note HGNC approved name is IARS1.
Sources: Expert list
Microcephaly v0.262 IGF1 Zornitza Stark Marked gene: IGF1 as ready
Microcephaly v0.262 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Microcephaly v0.262 IGF1 Zornitza Stark Classified gene: IGF1 as Green List (high evidence)
Microcephaly v0.262 IGF1 Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence).
Microcephaly v0.261 IGF1 Zornitza Stark gene: IGF1 was added
gene: IGF1 was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: IGF1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IGF1 were set to 15769976; 14684690; 8857020
Phenotypes for gene: IGF1 were set to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM# 608747
Review for gene: IGF1 was set to GREEN
Added comment: Severe growth retardation including significant microcephaly.
Sources: Expert list
Microcephaly v0.260 IGF1R Zornitza Stark Marked gene: IGF1R as ready
Microcephaly v0.260 IGF1R Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence).
Microcephaly v0.260 IGF1R Zornitza Stark Classified gene: IGF1R as Green List (high evidence)
Microcephaly v0.260 IGF1R Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence).
Microcephaly v0.259 IGF1R Zornitza Stark gene: IGF1R was added
gene: IGF1R was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: IGF1R was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: IGF1R were set to 14657428; 25040157; 23045302; 26252249; 15928254
Phenotypes for gene: IGF1R were set to Insulin-like growth factor I, resistance to, MIM# 270450
Review for gene: IGF1R was set to GREEN
Added comment: Severe IUGR including significant microcephaly, both mono-allelic and bi-allelic variants reported.
Sources: Expert list
Mendeliome v0.4091 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Mendeliome v0.4091 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence).
Mendeliome v0.4091 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM#612379; Kahrizi syndrome, MIM# 612713
Mendeliome v0.4090 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Mendeliome v0.4089 SRD5A3 Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4088 SRD5A3 Zornitza Stark Deleted their comment
Mendeliome v0.4088 SRD5A3 Zornitza Stark edited their review of gene: SRD5A3: Added comment: Over 25 families reported, well established gene-disease association for CDG. Allelic disorder Kahrizi syndrome has overlapping features, may not be distinct entity.; Changed publications: 32424323; Changed phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713
Congenital Disorders of Glycosylation v0.163 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Congenital Disorders of Glycosylation v0.163 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v0.163 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM# 612379; Kahrizi syndrome, MIM# 612713
Congenital Disorders of Glycosylation v0.162 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Congenital Disorders of Glycosylation v0.161 SRD5A3 Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Congenital Disorders of Glycosylation v0.160 SRD5A3 Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM# 612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2917 KIF14 Zornitza Stark Marked gene: KIF14 as ready
Intellectual disability syndromic and non-syndromic v0.2917 KIF14 Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2917 KIF14 Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914; Meckel syndrome 12, MIM# 616258
Intellectual disability syndromic and non-syndromic v0.2916 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Intellectual disability syndromic and non-syndromic v0.2915 KIF14 Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2914 KIF14 Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914, Meckel syndrome 12, MIM# 616258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4088 KIF14 Zornitza Stark Marked gene: KIF14 as ready
Mendeliome v0.4088 KIF14 Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence).
Mendeliome v0.4088 KIF14 Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914; Meckel syndrome 12, MIM# 616258
Mendeliome v0.4087 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Mendeliome v0.4086 KIF14 Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4085 KIF14 Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805, 24128419; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914, Meckel syndrome 12, MIM# 616258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.258 KIF14 Zornitza Stark Marked gene: KIF14 as ready
Microcephaly v0.258 KIF14 Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence).
Microcephaly v0.258 KIF14 Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914
Microcephaly v0.257 KIF14 Zornitza Stark Publications for gene: KIF14 were set to
Microcephaly v0.256 KIF14 Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.255 KIF14 Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4085 KIF1BP Zornitza Stark Marked gene: KIF1BP as ready
Mendeliome v0.4085 KIF1BP Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence).
Mendeliome v0.4085 KIF1BP Zornitza Stark Phenotypes for gene: KIF1BP were changed from to Goldberg-Shprintzen megacolon syndrome, MIM# 609460
Mendeliome v0.4084 KIF1BP Zornitza Stark Publications for gene: KIF1BP were set to
Mendeliome v0.4083 KIF1BP Zornitza Stark Mode of inheritance for gene: KIF1BP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4082 KIF1BP Zornitza Stark Tag new gene name tag was added to gene: KIF1BP.
Mendeliome v0.4082 KIF1BP Zornitza Stark reviewed gene: KIF1BP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23427148; Phenotypes: Goldberg-Shprintzen megacolon syndrome, MIM# 609460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.255 KIF1BP Zornitza Stark Marked gene: KIF1BP as ready
Microcephaly v0.255 KIF1BP Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence).
Microcephaly v0.255 KIF1BP Zornitza Stark Classified gene: KIF1BP as Green List (high evidence)
Microcephaly v0.255 KIF1BP Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence).
Microcephaly v0.254 KIF1BP Zornitza Stark Tag new gene name tag was added to gene: KIF1BP.
Microcephaly v0.254 KIF1BP Zornitza Stark gene: KIF1BP was added
gene: KIF1BP was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF1BP were set to 23427148
Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome, MIM# 609460
Review for gene: KIF1BP was set to GREEN
Added comment: Autosomal recessive multiple congenital anomaly syndrome characterised by intellectual disability, microcephaly, and dysmorphic facial features. Most individuals also have Hirschsprung disease and/or gyral abnormalities of the brain, consistent with defects in migration of neural crest cells and neurons. Other features, such as megalocornea or urogenital anomalies, may also be present. Well established gene-disease association, multiple families reported. Note HGNC approved name is KIAA1279.
Sources: Expert list
Microcephaly v0.253 KLHL7 Zornitza Stark Marked gene: KLHL7 as ready
Microcephaly v0.253 KLHL7 Zornitza Stark Gene: klhl7 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.253 KLHL7 Zornitza Stark Phenotypes for gene: KLHL7 were changed from to PERCHING syndrome, MIM# 617055
Microcephaly v0.252 KLHL7 Zornitza Stark Publications for gene: KLHL7 were set to
Microcephaly v0.251 KLHL7 Zornitza Stark Mode of inheritance for gene: KLHL7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.250 KLHL7 Zornitza Stark Classified gene: KLHL7 as Amber List (moderate evidence)
Microcephaly v0.250 KLHL7 Zornitza Stark Gene: klhl7 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.249 KLHL7 Zornitza Stark reviewed gene: KLHL7: Rating: AMBER; Mode of pathogenicity: None; Publications: 27392078, 29074562; Phenotypes: PERCHING syndrome, MIM# 617055; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Skeletal Dysplasia_Fetal v0.31 TRIP11 Zornitza Stark Marked gene: TRIP11 as ready
Skeletal Dysplasia_Fetal v0.31 TRIP11 Zornitza Stark Gene: trip11 has been classified as Green List (High Evidence).
Skeletal Dysplasia_Fetal v0.31 TRIP11 Zornitza Stark Phenotypes for gene: TRIP11 were changed from to Achondrogenesis, type IA, MIM# 200600
Skeletal Dysplasia_Fetal v0.30 TRIP11 Zornitza Stark Publications for gene: TRIP11 were set to
Skeletal Dysplasia_Fetal v0.29 TRIP11 Zornitza Stark Mode of inheritance for gene: TRIP11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Skeletal Dysplasia_Fetal v0.28 TRIP11 Zornitza Stark reviewed gene: TRIP11: Rating: GREEN; Mode of pathogenicity: None; Publications: 20089971; Phenotypes: Achondrogenesis, type IA, MIM# 200600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4082 TRIP11 Zornitza Stark Marked gene: TRIP11 as ready
Mendeliome v0.4082 TRIP11 Zornitza Stark Gene: trip11 has been classified as Green List (High Evidence).
Mendeliome v0.4082 TRIP11 Zornitza Stark Phenotypes for gene: TRIP11 were changed from to Osteochondrodysplasia, 184260; Achondrogenesis, type IA, 200600
Mendeliome v0.4081 TRIP11 Zornitza Stark Publications for gene: TRIP11 were set to
Mendeliome v0.4080 TRIP11 Zornitza Stark Mode of inheritance for gene: TRIP11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4079 PRF1 Zornitza Stark Marked gene: PRF1 as ready
Mendeliome v0.4079 PRF1 Zornitza Stark Added comment: Comment when marking as ready: Principal association is between bi-allelic variants and HLH.
Mendeliome v0.4079 PRF1 Zornitza Stark Gene: prf1 has been classified as Green List (High Evidence).
Mendeliome v0.4079 PRF1 Zornitza Stark Phenotypes for gene: PRF1 were changed from to Aplastic anemia 609135; Hemophagocytic lymphohistiocytosis, familial, 2 603553; Lymphoma, non-Hodgkin 605027
Mendeliome v0.4078 PRF1 Zornitza Stark Publications for gene: PRF1 were set to
Mendeliome v0.4077 PRF1 Zornitza Stark Mode of inheritance for gene: PRF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4076 HLCS Zornitza Stark Marked gene: HLCS as ready
Mendeliome v0.4076 HLCS Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence).
Mendeliome v0.4076 HLCS Zornitza Stark Phenotypes for gene: HLCS were changed from to Holocarboxylase synthetase deficiency, MIM# 253270
Mendeliome v0.4075 HLCS Zornitza Stark Publications for gene: HLCS were set to
Mendeliome v0.4074 HLCS Zornitza Stark Mode of inheritance for gene: HLCS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4073 HLCS Zornitza Stark reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holocarboxylase synthetase deficiency, MIM# 253270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4073 CA5A Zornitza Stark reviewed gene: CA5A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperammonemia due to carbonic anhydrase VA deficiency, 615751; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.471 CA5A Zornitza Stark Tag SV/CNV tag was added to gene: CA5A.
Mendeliome v0.4073 CA5A Zornitza Stark Marked gene: CA5A as ready
Mendeliome v0.4073 CA5A Zornitza Stark Gene: ca5a has been classified as Green List (High Evidence).
Mendeliome v0.4073 CA5A Zornitza Stark Phenotypes for gene: CA5A were changed from to Hyperammonemia due to carbonic anhydrase VA deficiency, 615751
Mendeliome v0.4072 CA5A Zornitza Stark Publications for gene: CA5A were set to
Mendeliome v0.4071 CA5A Zornitza Stark Mode of inheritance for gene: CA5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4070 CA5A Zornitza Stark Tag SV/CNV tag was added to gene: CA5A.
Intellectual disability syndromic and non-syndromic v0.2914 MOCS1 Zornitza Stark Marked gene: MOCS1 as ready
Intellectual disability syndromic and non-syndromic v0.2914 MOCS1 Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2914 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150
Intellectual disability syndromic and non-syndromic v0.2913 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Intellectual disability syndromic and non-syndromic v0.2912 MOCS1 Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2911 MOCS1 Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701, 21031595; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.828 MOCS1 Zornitza Stark Marked gene: MOCS1 as ready
Genetic Epilepsy v0.828 MOCS1 Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.828 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150
Genetic Epilepsy v0.827 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Genetic Epilepsy v0.826 MOCS1 Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.825 MOCS1 Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701, 21031595; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4070 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150
Mendeliome v0.4069 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Mendeliome v0.4068 MOCS1 Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4068 MOCS1 Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4067 OSR1 Zornitza Stark Marked gene: OSR1 as ready
Mendeliome v0.4067 OSR1 Zornitza Stark Gene: osr1 has been classified as Red List (Low Evidence).
Mendeliome v0.4067 OSR1 Zornitza Stark Classified gene: OSR1 as Red List (low evidence)
Mendeliome v0.4067 OSR1 Zornitza Stark Gene: osr1 has been classified as Red List (Low Evidence).
Mendeliome v0.4066 OSR1 Zornitza Stark reviewed gene: OSR1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Intellectual disability syndromic and non-syndromic v0.2911 KDM1A Zornitza Stark Marked gene: KDM1A as ready
Intellectual disability syndromic and non-syndromic v0.2911 KDM1A Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2911 KDM1A Zornitza Stark Phenotypes for gene: KDM1A were changed from to Cleft palate, psychomotor retardation, and distinctive facial features 616728
Intellectual disability syndromic and non-syndromic v0.2910 KDM1A Zornitza Stark Publications for gene: KDM1A were set to
Intellectual disability syndromic and non-syndromic v0.2909 KDM1A Zornitza Stark Mode of inheritance for gene: KDM1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2908 KDM1A Zornitza Stark reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4066 KDM1A Zornitza Stark reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4066 KDM1A Zornitza Stark Marked gene: KDM1A as ready
Mendeliome v0.4066 KDM1A Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence).
Mendeliome v0.4066 KDM1A Zornitza Stark Phenotypes for gene: KDM1A were changed from to Cleft palate, psychomotor retardation, and distinctive facial features 616728; Multiple myeloma
Mendeliome v0.4065 KDM1A Zornitza Stark Mode of inheritance for gene: KDM1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4064 KDM1A Zornitza Stark Publications for gene: KDM1A were set to
Mendeliome v0.4063 TRIP11 Elena Savva reviewed gene: TRIP11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31903676, 30728324; Phenotypes: Osteochondrodysplasia, 184260, Achondrogenesis, type IA, 200600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4063 COL11A1 Zornitza Stark Marked gene: COL11A1 as ready
Mendeliome v0.4063 COL11A1 Zornitza Stark Gene: col11a1 has been classified as Green List (High Evidence).
Mendeliome v0.4063 COL11A1 Zornitza Stark Phenotypes for gene: COL11A1 were changed from to Fibrochondrogenesis 1 (MIM#228520); Marshall syndrome (MIM#154780); Stickler syndrome, type II (MIM#604841)
Mendeliome v0.4062 COL11A1 Zornitza Stark Publications for gene: COL11A1 were set to
Mendeliome v0.4061 PRF1 Elena Savva reviewed gene: PRF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19487666; Phenotypes: Aplastic anemia 609135, Hemophagocytic lymphohistiocytosis, familial, 2 603553, Lymphoma, non-Hodgkin 605027; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4061 COL11A1 Zornitza Stark Mode of pathogenicity for gene: COL11A1 was changed from to Other
Mendeliome v0.4060 COL11A1 Zornitza Stark Mode of inheritance for gene: COL11A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v0.4059 HLCS Elena Savva reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10190325; Phenotypes: Holocarboxylase synthetase deficiency, 253270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4059 CA5A Elena Savva reviewed gene: CA5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26913920, 32381389; Phenotypes: Hyperammonemia due to carbonic anhydrase VA deficiency, 615751; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4059 MOCS1 Elena Savva reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21031595; Phenotypes: Molybdenum cofactor deficiency A 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4059 KDM1A Elena Savva reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29559475, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728, Multiple myeloma; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v0.4059 COL11A1 Elena Savva reviewed gene: COL11A1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID 25073711, 30245514, 32427345, 27081569, 21035103; Phenotypes: Fibrochondrogenesis 1 (MIM#228520), Marshall syndrome (MIM#154780), Stickler syndrome, type II (MIM#604841), {Lumbar disc herniation, susceptibility to}, (MIM#603932), ?Deafness, autosomal dominant 37, (MIM#618533); Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Ciliary Dyskinesia v0.123 GAS2L2 Zornitza Stark Classified gene: GAS2L2 as Amber List (moderate evidence)
Ciliary Dyskinesia v0.123 GAS2L2 Zornitza Stark Gene: gas2l2 has been classified as Amber List (Moderate Evidence).
Proteinuria v0.130 GON7 Zornitza Stark Tag founder tag was added to gene: GON7.
Microcephaly v0.249 GON7 Zornitza Stark Tag founder tag was added to gene: GON7.
Mendeliome v0.4059 GON7 Zornitza Stark Tag founder tag was added to gene: GON7.
Microcephaly v0.249 YRDC Zornitza Stark Marked gene: YRDC as ready
Microcephaly v0.249 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Microcephaly v0.249 YRDC Zornitza Stark Classified gene: YRDC as Green List (high evidence)
Microcephaly v0.249 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Proteinuria v0.130 YRDC Zornitza Stark Marked gene: YRDC as ready
Proteinuria v0.130 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Proteinuria v0.130 YRDC Zornitza Stark Classified gene: YRDC as Green List (high evidence)
Proteinuria v0.130 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Mendeliome v0.4059 YRDC Zornitza Stark Marked gene: YRDC as ready
Mendeliome v0.4059 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Microcephaly v0.248 YRDC Zornitza Stark gene: YRDC was added
gene: YRDC was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YRDC were set to 31481669
Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome
Review for gene: YRDC was set to GREEN
Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data.
Sources: Literature
Mendeliome v0.4059 YRDC Zornitza Stark Classified gene: YRDC as Green List (high evidence)
Mendeliome v0.4059 YRDC Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence).
Proteinuria v0.129 YRDC Zornitza Stark gene: YRDC was added
gene: YRDC was added to Proteinuria. Sources: Literature
Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YRDC were set to 31481669
Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome
Review for gene: YRDC was set to GREEN
Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data.
Sources: Literature
Mendeliome v0.4058 YRDC Zornitza Stark gene: YRDC was added
gene: YRDC was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: YRDC were set to 31481669
Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome
Review for gene: YRDC was set to GREEN
Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data.
Sources: Literature
Mendeliome v0.4057 GON7 Zornitza Stark Marked gene: GON7 as ready
Mendeliome v0.4057 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Mendeliome v0.4057 GON7 Zornitza Stark Classified gene: GON7 as Green List (high evidence)
Mendeliome v0.4057 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Mendeliome v0.4056 GON7 Zornitza Stark gene: GON7 was added
gene: GON7 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON7 were set to 31481669
Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome
Review for gene: GON7 was set to GREEN
Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data.
Sources: Literature
Microcephaly v0.247 GON7 Zornitza Stark Marked gene: GON7 as ready
Microcephaly v0.247 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Microcephaly v0.247 GON7 Zornitza Stark Classified gene: GON7 as Green List (high evidence)
Microcephaly v0.247 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Microcephaly v0.246 GON7 Zornitza Stark gene: GON7 was added
gene: GON7 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON7 were set to 31481669
Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome
Review for gene: GON7 was set to GREEN
Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data.
Sources: Literature
Proteinuria v0.128 GON7 Zornitza Stark Marked gene: GON7 as ready
Proteinuria v0.128 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Proteinuria v0.128 GON7 Zornitza Stark Classified gene: GON7 as Green List (high evidence)
Proteinuria v0.128 GON7 Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence).
Proteinuria v0.127 GON7 Zornitza Stark gene: GON7 was added
gene: GON7 was added to Proteinuria. Sources: Literature
Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GON7 were set to 31481669
Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome
Review for gene: GON7 was set to GREEN
Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data.
Sources: Literature
Proteinuria v0.126 LAGE3 Zornitza Stark Marked gene: LAGE3 as ready
Proteinuria v0.126 LAGE3 Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence).
Proteinuria v0.126 LAGE3 Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Proteinuria v0.125 LAGE3 Zornitza Stark Publications for gene: LAGE3 were set to
Proteinuria v0.124 LAGE3 Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Proteinuria v0.123 LAGE3 Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4055 LAGE3 Zornitza Stark Marked gene: LAGE3 as ready
Mendeliome v0.4055 LAGE3 Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence).
Mendeliome v0.4055 LAGE3 Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Mendeliome v0.4054 LAGE3 Zornitza Stark Publications for gene: LAGE3 were set to
Mendeliome v0.4053 LAGE3 Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4052 LAGE3 Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.245 LAGE3 Zornitza Stark Marked gene: LAGE3 as ready
Microcephaly v0.245 LAGE3 Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence).
Microcephaly v0.245 LAGE3 Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006
Microcephaly v0.244 LAGE3 Zornitza Stark Publications for gene: LAGE3 were set to
Microcephaly v0.243 LAGE3 Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Microcephaly v0.242 LAGE3 Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.4052 LINGO1 Zornitza Stark Marked gene: LINGO1 as ready
Mendeliome v0.4052 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4052 LINGO1 Zornitza Stark Phenotypes for gene: LINGO1 were changed from to Mental retardation, autosomal recessive 64, MIM# 618103
Mendeliome v0.4051 LINGO1 Zornitza Stark Publications for gene: LINGO1 were set to
Mendeliome v0.4050 LINGO1 Zornitza Stark Mode of inheritance for gene: LINGO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4049 LINGO1 Zornitza Stark Classified gene: LINGO1 as Amber List (moderate evidence)
Mendeliome v0.4049 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4048 LINGO1 Zornitza Stark reviewed gene: LINGO1: Rating: AMBER; Mode of pathogenicity: None; Publications: 31668702; Phenotypes: Mental retardation, autosomal recessive 64, MIM# 618103; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.242 LINGO1 Zornitza Stark Marked gene: LINGO1 as ready
Microcephaly v0.242 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.242 LINGO1 Zornitza Stark Phenotypes for gene: LINGO1 were changed from to Mental retardation, autosomal recessive 64, MIM# 618103
Microcephaly v0.241 LINGO1 Zornitza Stark Publications for gene: LINGO1 were set to
Microcephaly v0.240 LINGO1 Zornitza Stark Mode of inheritance for gene: LINGO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.239 LINGO1 Zornitza Stark Classified gene: LINGO1 as Amber List (moderate evidence)
Microcephaly v0.239 LINGO1 Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.238 LINGO1 Zornitza Stark edited their review of gene: LINGO1: Changed rating: AMBER
Microcephaly v0.238 LINGO1 Zornitza Stark reviewed gene: LINGO1: Rating: ; Mode of pathogenicity: None; Publications: 31668702; Phenotypes: Mental retardation, autosomal recessive 64, MIM# 618103; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.123 TRIM8 Tiong Tan Marked gene: TRIM8 as ready
Proteinuria v0.123 TRIM8 Tiong Tan Gene: trim8 has been classified as Green List (High Evidence).
Proteinuria v0.123 TRIM8 Tiong Tan Classified gene: TRIM8 as Green List (high evidence)
Proteinuria v0.123 TRIM8 Tiong Tan Gene: trim8 has been classified as Green List (High Evidence).
Proteinuria v0.122 TRIM8 Tiong Tan gene: TRIM8 was added
gene: TRIM8 was added to Proteinuria. Sources: Literature
Mode of inheritance for gene: TRIM8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TRIM8 were set to 30244534; 32193649
Phenotypes for gene: TRIM8 were set to intellectual disability; epileptic encephalopathy; nephrotic syndrome; proteinuria
Penetrance for gene: TRIM8 were set to Complete
Review for gene: TRIM8 was set to GREEN
Added comment: ~50% affected individuals have proteinuria, one confirmed with FSGS
Sources: Literature
Proteinuria v0.121 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Proteinuria v0.121 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Proteinuria v0.121 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729
Proteinuria v0.120 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Proteinuria v0.119 OSGEP Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.118 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.238 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Microcephaly v0.238 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Mendeliome v0.4048 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Mendeliome v0.4048 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Mendeliome v0.4048 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729
Mendeliome v0.4047 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Mendeliome v0.4046 OSGEP Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4045 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.238 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729
Microcephaly v0.237 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Microcephaly v0.236 OSGEP Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.235 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4045 NUP107 Zornitza Stark Tag founder tag was added to gene: NUP107.
Proteinuria v0.118 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Proteinuria v0.118 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Proteinuria v0.118 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348
Proteinuria v0.117 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Proteinuria v0.116 NUP107 Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Proteinuria v0.115 NUP107 Zornitza Stark Tag founder tag was added to gene: NUP107.
Proteinuria v0.115 NUP107 Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4045 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Mendeliome v0.4045 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Mendeliome v0.4045 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348
Mendeliome v0.4044 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Mendeliome v0.4043 NUP107 Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4042 NUP107 Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.235 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Microcephaly v0.235 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Microcephaly v0.235 NUP107 Zornitza Stark Tag founder tag was added to gene: NUP107.
Microcephaly v0.235 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348
Microcephaly v0.234 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Microcephaly v0.233 NUP107 Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.232 NUP107 Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.232 VRK1 Zornitza Stark Marked gene: VRK1 as ready
Microcephaly v0.232 VRK1 Zornitza Stark Gene: vrk1 has been classified as Green List (High Evidence).
Microcephaly v0.232 VRK1 Zornitza Stark Phenotypes for gene: VRK1 were changed from to Pontocerebellar hypoplasia type 1A MIM#607596
Microcephaly v0.231 VRK1 Zornitza Stark Publications for gene: VRK1 were set to
Microcephaly v0.230 VRK1 Zornitza Stark Mode of inheritance for gene: VRK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.229 BRD4 Zornitza Stark Marked gene: BRD4 as ready
Microcephaly v0.229 BRD4 Zornitza Stark Gene: brd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.229 BRD4 Zornitza Stark Tag SV/CNV tag was added to gene: BRD4.
Microcephaly v0.229 BRD4 Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange-like syndrome
Microcephaly v0.228 BRD4 Zornitza Stark Publications for gene: BRD4 were set to
Microcephaly v0.227 BRD4 Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.226 BRD4 Zornitza Stark Classified gene: BRD4 as Amber List (moderate evidence)
Microcephaly v0.226 BRD4 Zornitza Stark Gene: brd4 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.225 WDR4 Zornitza Stark Marked gene: WDR4 as ready
Microcephaly v0.225 WDR4 Zornitza Stark Gene: wdr4 has been classified as Green List (High Evidence).
Microcephaly v0.225 WDR4 Zornitza Stark Phenotypes for gene: WDR4 were changed from to Galloway-Mowat syndrome 6 MIM#618347
Microcephaly v0.224 WDR4 Zornitza Stark Publications for gene: WDR4 were set to
Microcephaly v0.223 WDR4 Zornitza Stark Mode of inheritance for gene: WDR4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Marked gene: NSD2 as ready
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2908 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Intellectual disability syndromic and non-syndromic v0.2907 NSD2 Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability
Microcephaly v0.222 NSD2 Zornitza Stark Marked gene: NSD2 as ready
Microcephaly v0.222 NSD2 Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2906 NSD2 Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2905 NSD2 Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4042 NSD2 Zornitza Stark Marked gene: NSD2 as ready
Mendeliome v0.4042 NSD2 Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence).
Mendeliome v0.4042 NSD2 Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability
Mendeliome v0.4041 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Mendeliome v0.4040 NSD2 Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4039 NSD2 Zornitza Stark changed review comment from: Microcephaly reported in 6 of 7 individuals with LOF variants in this gene.; to: 7 individuals with LOF variants in this gene, gene thought to be responsible for key features of Wolf-Hirschorn syndrome.
Mendeliome v0.4039 NSD2 Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.222 NSD2 Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability
Microcephaly v0.221 NSD2 Zornitza Stark Publications for gene: NSD2 were set to
Microcephaly v0.220 NSD2 Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.219 NSD2 Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.219 NIPBL Zornitza Stark Marked gene: NIPBL as ready
Microcephaly v0.219 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Microcephaly v0.219 NIPBL Zornitza Stark Classified gene: NIPBL as Green List (high evidence)
Microcephaly v0.219 NIPBL Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence).
Microcephaly v0.218 VRK1 Paul De Fazio reviewed gene: VRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19646678, 24126608, 27281532, 31560180; Phenotypes: Pontocerebellar hypoplasia type 1A MIM#607596; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.218 NIPBL Zornitza Stark gene: NIPBL was added
gene: NIPBL was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome 1, MIM# 122470
Review for gene: NIPBL was set to GREEN
Added comment: Well established gene-disease association, microcephaly is a prominent feature of the phenotype.
Sources: Expert list
Mendeliome v0.4039 NCAPH Zornitza Stark Marked gene: NCAPH as ready
Mendeliome v0.4039 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Mendeliome v0.4039 NCAPH Zornitza Stark Phenotypes for gene: NCAPH were changed from to Microcephaly 23, primary, autosomal recessive 617985
Mendeliome v0.4038 NCAPH Zornitza Stark Publications for gene: NCAPH were set to
Mendeliome v0.4037 NCAPH Zornitza Stark Mode of inheritance for gene: NCAPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4036 NCAPH Zornitza Stark Classified gene: NCAPH as Red List (low evidence)
Mendeliome v0.4036 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Mendeliome v0.4035 NCAPH Zornitza Stark reviewed gene: NCAPH: Rating: RED; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 23, primary, autosomal recessive 617985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.217 NCAPH Zornitza Stark Marked gene: NCAPH as ready
Microcephaly v0.217 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Microcephaly v0.217 NCAPH Zornitza Stark Phenotypes for gene: NCAPH were changed from to Microcephaly 23, primary, autosomal recessive 617985
Microcephaly v0.216 NCAPH Zornitza Stark Publications for gene: NCAPH were set to
Microcephaly v0.215 NCAPH Zornitza Stark Mode of inheritance for gene: NCAPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.214 NCAPH Zornitza Stark Classified gene: NCAPH as Red List (low evidence)
Microcephaly v0.214 NCAPH Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence).
Microcephaly v0.213 NCAPH Zornitza Stark reviewed gene: NCAPH: Rating: RED; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 23, primary, autosomal recessive 617985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.213 BRD4 Ain Roesley reviewed gene: BRD4: Rating: AMBER; Mode of pathogenicity: None; Publications: 29379197, 30302754; Phenotypes: Cornelia de Lange-like syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.213 WDR4 Paul De Fazio reviewed gene: WDR4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26416026, 28617965, 30079490, 29597095; Phenotypes: Galloway-Mowat syndrome 6 MIM#618347; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.213 NCAPD3 Zornitza Stark Marked gene: NCAPD3 as ready
Microcephaly v0.213 NCAPD3 Zornitza Stark Gene: ncapd3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.213 NCAPD3 Zornitza Stark Phenotypes for gene: NCAPD3 were changed from to Microcephaly 22, primary, autosomal recessive, MIM# 617984
Microcephaly v0.212 NCAPD3 Zornitza Stark Publications for gene: NCAPD3 were set to 27737959
Microcephaly v0.211 BRCA2 Zornitza Stark Marked gene: BRCA2 as ready
Microcephaly v0.211 BRCA2 Zornitza Stark Gene: brca2 has been classified as Green List (High Evidence).
Microcephaly v0.211 BRCA2 Zornitza Stark Classified gene: BRCA2 as Green List (high evidence)
Microcephaly v0.211 BRCA2 Zornitza Stark Gene: brca2 has been classified as Green List (High Evidence).
Microcephaly v0.210 BRCA2 Ain Roesley gene: BRCA2 was added
gene: BRCA2 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BRCA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BRCA2 were set to Fanconi anemia, complementation group D1 (MIM#605724)
Penetrance for gene: BRCA2 were set to unknown
Review for gene: BRCA2 was set to GREEN
Added comment: Approx 75% of FA patients present with microcephaly and approx 3% of FA patients have variants in BRCA2 (GeneReviews)
Sources: Literature
Mendeliome v0.4035 ATRIP Zornitza Stark Marked gene: ATRIP as ready
Mendeliome v0.4035 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Mendeliome v0.4035 ATRIP Zornitza Stark Classified gene: ATRIP as Red List (low evidence)
Mendeliome v0.4035 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Microcephaly v0.210 WDR73 Zornitza Stark Marked gene: WDR73 as ready
Microcephaly v0.210 WDR73 Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence).
Microcephaly v0.210 WDR73 Zornitza Stark Classified gene: WDR73 as Green List (high evidence)
Microcephaly v0.210 WDR73 Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence).
Microcephaly v0.209 BLM Zornitza Stark Marked gene: BLM as ready
Microcephaly v0.209 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Microcephaly v0.209 BLM Zornitza Stark Publications for gene: BLM were set to 30214071
Microcephaly v0.208 BLM Zornitza Stark Classified gene: BLM as Green List (high evidence)
Microcephaly v0.208 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Microcephaly v0.207 WDR37 Zornitza Stark Marked gene: WDR37 as ready
Microcephaly v0.207 WDR37 Zornitza Stark Gene: wdr37 has been classified as Green List (High Evidence).
Microcephaly v0.207 WDR37 Zornitza Stark Phenotypes for gene: WDR37 were changed from to Neurooculocardiogenitourinary syndrome MIM#618652
Microcephaly v0.206 WDR37 Zornitza Stark Publications for gene: WDR37 were set to
Microcephaly v0.205 WDR37 Zornitza Stark Mode of inheritance for gene: WDR37 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.204 ZNF335 Zornitza Stark Marked gene: ZNF335 as ready
Microcephaly v0.204 ZNF335 Zornitza Stark Gene: znf335 has been classified as Green List (High Evidence).
Microcephaly v0.204 ZNF335 Zornitza Stark Phenotypes for gene: ZNF335 were changed from to Microcephaly 10, primary, autosomal recessive (MIM#615095)
Microcephaly v0.204 WDR37 Paul De Fazio reviewed gene: WDR37: Rating: GREEN; Mode of pathogenicity: None; Publications: 31327508, 31327510; Phenotypes: Neurooculocardiogenitourinary syndrome MIM#618652; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Microcephaly v0.204 ZNF335 Zornitza Stark Publications for gene: ZNF335 were set to 23178126; 27540107; 29652087
Microcephaly v0.203 BLM Ain Roesley edited their review of gene: BLM: Added comment: Microcephaly is a feature of Bloom Syndrome

PMID: 30214071;
- in a cohort of microcephalic patients (<=-2SD), 1 family with 2 affecteds are homozygous for a nonsense variant

PMID: 29056561
- 1x proband. At 36 yrs of age her head circumference was 47.8cm (-6.2SD)

PMID: 23928670;
- 1x patient of a consanguineous Dutch family. At 4 years of age: head circumference 45.9 cm (3.2 SDS). Homozygous nonsense
- 1x patient of a consanguineous Turkish family. At 5 years of age: head circumference 46.3 cm (2.7 SDS). Homozygous nonsense

PMID: 25129257;
- 1 family with 3 affecteds. 1 had a head circumference of -4SD. Homozygous fs; Changed rating: GREEN; Changed publications: 30214071, 29056561, 23928670; Changed phenotypes: Bloom syndrome (MIM#210900)
Microcephaly v0.203 ZNF335 Zornitza Stark Publications for gene: ZNF335 were set to
Microcephaly v0.203 NCAPD3 Zornitza Stark Publications for gene: NCAPD3 were set to
Microcephaly v0.202 ZNF335 Zornitza Stark Mode of inheritance for gene: ZNF335 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.201 NCAPD3 Zornitza Stark Mode of inheritance for gene: NCAPD3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.200 NCAPD3 Zornitza Stark Classified gene: NCAPD3 as Amber List (moderate evidence)
Microcephaly v0.200 NCAPD3 Zornitza Stark Gene: ncapd3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.199 NCAPD3 Zornitza Stark reviewed gene: NCAPD3: Rating: AMBER; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 22, primary, autosomal recessive, MIM# 617984; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.199 NACC1 Zornitza Stark Marked gene: NACC1 as ready
Microcephaly v0.199 NACC1 Zornitza Stark Gene: nacc1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.199 NACC1 Zornitza Stark Phenotypes for gene: NACC1 were changed from to Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination , MIM#617393
Microcephaly v0.198 NACC1 Zornitza Stark Publications for gene: NACC1 were set to
Microcephaly v0.197 NACC1 Zornitza Stark Mode of inheritance for gene: NACC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.196 NACC1 Zornitza Stark Classified gene: NACC1 as Amber List (moderate evidence)
Microcephaly v0.196 NACC1 Zornitza Stark Gene: nacc1 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.195 NACC1 Zornitza Stark reviewed gene: NACC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 28132692; Phenotypes: Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination , MIM#617393; Mode of inheritance: None
Microcephaly v0.195 MYCN Zornitza Stark edited their review of gene: MYCN: Changed rating: GREEN; Changed phenotypes: Feingold syndrome 1, MIM# 164280
Microcephaly v0.195 MYCN Zornitza Stark Marked gene: MYCN as ready
Microcephaly v0.195 MYCN Zornitza Stark Gene: mycn has been classified as Green List (High Evidence).
Microcephaly v0.195 MYCN Zornitza Stark Classified gene: MYCN as Green List (high evidence)
Microcephaly v0.195 MYCN Zornitza Stark Gene: mycn has been classified as Green List (High Evidence).
Microcephaly v0.194 MYCN Zornitza Stark gene: MYCN was added
gene: MYCN was added to Microcephaly. Sources: Expert list
Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MYCN were set to 18470948
Phenotypes for gene: MYCN were set to Feingold syndrome 1, MIM# 164280
Added comment: Well established gene-disease association, microcephaly is a key feature.
Sources: Expert list
Microcephaly v0.193 MRE11 Zornitza Stark Marked gene: MRE11 as ready
Microcephaly v0.193 MRE11 Zornitza Stark Gene: mre11 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.193 MRE11 Zornitza Stark Phenotypes for gene: MRE11 were changed from to Nijmegen breakage syndrome-like severe microcephaly
Microcephaly v0.192 MRE11 Zornitza Stark Publications for gene: MRE11 were set to
Microcephaly v0.191 ZNF335 Paul De Fazio reviewed gene: ZNF335: Rating: GREEN; Mode of pathogenicity: None; Publications: 23178126, 27540107, 29652087; Phenotypes: Microcephaly 10, primary, autosomal recessive (MIM#615095); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Microcephaly v0.191 MRE11 Zornitza Stark Mode of inheritance for gene: MRE11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.190 MRE11 Zornitza Stark Classified gene: MRE11 as Amber List (moderate evidence)
Microcephaly v0.190 MRE11 Zornitza Stark Gene: mre11 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.189 MRE11 Zornitza Stark reviewed gene: MRE11: Rating: AMBER; Mode of pathogenicity: None; Publications: 21227757; Phenotypes: Nijmegen breakage syndrome-like severe microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.189 BLM Ain Roesley Deleted their comment
Microcephaly v0.189 MED17 Zornitza Stark Marked gene: MED17 as ready
Microcephaly v0.189 MED17 Zornitza Stark Gene: med17 has been classified as Green List (High Evidence).
Microcephaly v0.189 MED17 Zornitza Stark Phenotypes for gene: MED17 were changed from to Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM# 613668
Microcephaly v0.188 WDR73 Paul De Fazio gene: WDR73 was added
gene: WDR73 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: WDR73 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR73 were set to 25466283; 26123727; 25873735; 26070982; 30315938
Phenotypes for gene: WDR73 were set to Galloway-Mowat syndrome 1 MIM#251300
Review for gene: WDR73 was set to GREEN
gene: WDR73 was marked as current diagnostic
Added comment: Summary: many individuals with progressive microcephaly reported, though only a few (4
families) with head circumference -3SD.

PMID 25466283: Three affected children from two families with LoF variants. All had progressive microcephaly among other phenotypes (e.g. facial dysmorphisms, brain MRI anomalies). Head circumferences were -3SD at 5yo, -2.5SD at 2yo, -3SD at 10yo.

PMID 26123727: 9 individuals from 4 families with "Microcephaly (< 3rd centile)" and biallelic variants, ranging in age from 2.5yo to 31yo.

PMID 26070982: describes 30 Amish individuals with the same homozygous LoF variant, 80% of whom (24 individuals) had head circumference <-2SD.

PMID 25873735: 2 sibs with biallelic LoF variants and head circumference -1.8SD at 12yo and −1.15SD at 5yo respectively.

PMID 30315938: 2 families with homozygous missense variants. All had postnatal microcephaly: -2.5SD, -4,5SD, -3,8SD from 1 family and -3 SD from the other.
Sources: Literature
Microcephaly v0.188 MED17 Zornitza Stark Publications for gene: MED17 were set to
Microcephaly v0.187 MED17 Zornitza Stark Mode of inheritance for gene: MED17 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.186 MED17 Zornitza Stark reviewed gene: MED17: Rating: GREEN; Mode of pathogenicity: None; Publications: 20950787, 30345598, 26004231; Phenotypes: Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM# 613668; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.186 MECP2 Zornitza Stark Marked gene: MECP2 as ready
Microcephaly v0.186 MECP2 Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence).
Microcephaly v0.186 MECP2 Zornitza Stark Phenotypes for gene: MECP2 were changed from to Rett syndrome, MIM# 312750; Encephalopathy, neonatal severe 300673
Microcephaly v0.185 MECP2 Zornitza Stark Mode of inheritance for gene: MECP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Microcephaly v0.184 MECP2 Zornitza Stark reviewed gene: MECP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rett syndrome, MIM# 312750, Encephalopathy, neonatal severe 300673; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v0.4034 ATRIP Ain Roesley gene: ATRIP was added
gene: ATRIP was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: ATRIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATRIP were set to 23144622
Phenotypes for gene: ATRIP were set to Seckel Syndrome
Penetrance for gene: ATRIP were set to unknown
Review for gene: ATRIP was set to RED
Added comment: PMID: 23144622;
- 1x proband from a consanguineous family
- progressive severe microcephaly (-9 to -10SD)
- cHet for a nonsense and a splice
Sources: Literature
Microcephaly v0.184 ATRIP Zornitza Stark Marked gene: ATRIP as ready
Microcephaly v0.184 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Microcephaly v0.184 ATRIP Zornitza Stark Classified gene: ATRIP as Red List (low evidence)
Microcephaly v0.184 ATRIP Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence).
Microcephaly v0.183 ATP1A2 Zornitza Stark Marked gene: ATP1A2 as ready
Microcephaly v0.183 ATP1A2 Zornitza Stark Gene: atp1a2 has been classified as Green List (High Evidence).
Microcephaly v0.183 ATP1A2 Zornitza Stark Phenotypes for gene: ATP1A2 were changed from to hydrops fetalis, microcephaly, arthrogryposis and extensive cortical malformations
Microcephaly v0.182 ATP1A2 Zornitza Stark Publications for gene: ATP1A2 were set to
Microcephaly v0.181 ATP1A2 Zornitza Stark Mode of inheritance for gene: ATP1A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.180 ARCN1 Zornitza Stark Marked gene: ARCN1 as ready
Microcephaly v0.180 ARCN1 Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green. Microcephaly is a key part of the phenotype but few measurements actually reported.
Microcephaly v0.180 ARCN1 Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence).
Microcephaly v0.180 ARCN1 Zornitza Stark Phenotypes for gene: ARCN1 were changed from to Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164)
Microcephaly v0.179 ARCN1 Zornitza Stark Publications for gene: ARCN1 were set to
Microcephaly v0.178 ARCN1 Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.177 AP4S1 Zornitza Stark Marked gene: AP4S1 as ready
Microcephaly v0.177 AP4S1 Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green as only one affected individual <-3SD; however, part of same gene family as other spastic paraplegias with microcephaly.
Microcephaly v0.177 AP4S1 Zornitza Stark Gene: ap4s1 has been classified as Green List (High Evidence).
Microcephaly v0.177 AP4S1 Zornitza Stark Phenotypes for gene: AP4S1 were changed from to Spastic paraplegia 52, autosomal recessive (MIM#614067)
Microcephaly v0.176 AP4S1 Zornitza Stark Publications for gene: AP4S1 were set to
Microcephaly v0.175 AP4S1 Zornitza Stark Mode of inheritance for gene: AP4S1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.174 AP4M1 Zornitza Stark Marked gene: AP4M1 as ready
Microcephaly v0.174 AP4M1 Zornitza Stark Gene: ap4m1 has been classified as Green List (High Evidence).
Microcephaly v0.174 AP4M1 Zornitza Stark Phenotypes for gene: AP4M1 were changed from to Spastic paraplegia 50, autosomal recessive (MIM#612936)
Microcephaly v0.173 AP4M1 Zornitza Stark Publications for gene: AP4M1 were set to
Microcephaly v0.172 AP4M1 Zornitza Stark Mode of inheritance for gene: AP4M1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 BLM Ain Roesley gene: BLM was added
gene: BLM was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BLM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BLM were set to 30214071
Phenotypes for gene: BLM were set to Bloom syndrome (MIM#210900)
Penetrance for gene: BLM were set to unknown
Review for gene: BLM was set to RED
Added comment: Microcephaly is a feature of Bloom Syndrome, however there is limited evidence for the association of microcephaly with BLM gene specifically.

PMID: 30214071;
in a cohort of microcephalic patients (<=-2SD), 1 family with 2 affecteds are homozygous for a nonsense variant
Sources: Literature
Microcephaly v0.171 ATRIP Ain Roesley gene: ATRIP was added
gene: ATRIP was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: ATRIP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ATRIP were set to 23144622
Phenotypes for gene: ATRIP were set to Seckel Syndrome
Penetrance for gene: ATRIP were set to unknown
Review for gene: ATRIP was set to RED
Added comment: PMID: 23144622;
- 1x proband from a consanguineous family
- progressive severe microcephaly (-9 to -10SD)
- cHet for a nonsense and a splice
Sources: Literature
Microcephaly v0.171 ATP1A2 Ain Roesley reviewed gene: ATP1A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30690204, 31608932; Phenotypes: hydrops fetalis, microcephaly, arthrogryposis and extensive cortical malformations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 ARCN1 Ain Roesley reviewed gene: ARCN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27476655; Phenotypes: Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Microcephaly v0.171 AP4S1 Ain Roesley reviewed gene: AP4S1: Rating: AMBER; Mode of pathogenicity: None; Publications: 21620353, 25552650, 27444738; Phenotypes: Spastic paraplegia 52, autosomal recessive (MIM#614067); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 AP4M1 Ain Roesley edited their review of gene: AP4M1: Changed publications: 28464862, 24700674
Microcephaly v0.171 AP4M1 Ain Roesley changed review comment from: PMID: 28464862;
- 1x with severe progressive microcephaly (< - 4 SD)
- homozygous nonsense

PMID: 24700674;
- 2x unrelated patients (1 and 3) < -3 SD head circumference
- 2x homozygous nonsense

PMID: 21620353 ;
- 3 families with 4 affecteds ( < -3 SD)
- all PTVs; to: PMID: 28464862;
- 1x with severe progressive microcephaly (< - 4 SD)
- homozygous nonsense

PMID: 24700674;
- 2x unrelated patients (1 and 3) < -3 SD head circumference
- 2x homozygous nonsense
Microcephaly v0.171 AP4M1 Ain Roesley reviewed gene: AP4M1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28464862, 24700674, 21620353; Phenotypes: Spastic paraplegia 50, autosomal recessive (MIM#612936); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.171 AKT3 Zornitza Stark changed review comment from: Activating variants in AKT2 and micro duplications are associated with macrocephaly/megalencephaly. Note that deletions involving AKT3 have consistently been associated with microcephaly. However, most involve at least one other gene apart from AKT3. One family reported with only AKT3 deleted: deletion was inherited from a phenotypically normal parent, suggesting either additional effects in bigger deletions or incomplete penetrance.; to: Activating variants in AKT3 and micro duplications are associated with macrocephaly/megalencephaly. Note that deletions involving AKT3 have consistently been associated with microcephaly. However, most involve at least one other gene apart from AKT3. One family reported with only AKT3 deleted: deletion was inherited from a phenotypically normal parent, suggesting either additional effects in bigger deletions or incomplete penetrance.
Microcephaly v0.171 AKT3 Zornitza Stark Marked gene: AKT3 as ready
Microcephaly v0.171 AKT3 Zornitza Stark Gene: akt3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.171 AKT3 Zornitza Stark Phenotypes for gene: AKT3 were changed from to Microcephaly
Microcephaly v0.170 AKT3 Zornitza Stark Publications for gene: AKT3 were set to
Microcephaly v0.169 AKT3 Zornitza Stark Mode of inheritance for gene: AKT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.168 AKT3 Zornitza Stark Classified gene: AKT3 as Amber List (moderate evidence)
Microcephaly v0.168 AKT3 Zornitza Stark Gene: akt3 has been classified as Amber List (Moderate Evidence).
Microcephaly v0.167 AKT3 Zornitza Stark Tag SV/CNV tag was added to gene: AKT3.
Microcephaly v0.167 AKT3 Zornitza Stark reviewed gene: AKT3: Rating: AMBER; Mode of pathogenicity: None; Publications: 32827175, 31929334, 30853971, 30053339, 25424989; Phenotypes: Microcephaly; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2905 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Intellectual disability syndromic and non-syndromic v0.2905 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2905 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Intellectual disability syndromic and non-syndromic v0.2904 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Intellectual disability syndromic and non-syndromic v0.2903 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2902 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.24 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Cerebral Palsy v0.24 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.24 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Cerebral Palsy v0.23 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Cerebral Palsy v0.22 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.21 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4034 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Mendeliome v0.4034 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Mendeliome v0.4034 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Mendeliome v0.4033 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Mendeliome v0.4032 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4031 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.167 AP4E1 Zornitza Stark Marked gene: AP4E1 as ready
Microcephaly v0.167 AP4E1 Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence).
Microcephaly v0.167 AP4E1 Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744
Microcephaly v0.166 AP4E1 Zornitza Stark Publications for gene: AP4E1 were set to
Microcephaly v0.165 AP4E1 Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.164 AP4E1 Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.21 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Cerebral Palsy v0.21 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Cerebral Palsy v0.21 AP4B1 Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Cerebral Palsy v0.20 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Cerebral Palsy v0.19 AP4B1 Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebral Palsy v0.18 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4031 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Mendeliome v0.4031 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Mendeliome v0.4031 AP4B1 Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Mendeliome v0.4030 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Mendeliome v0.4029 AP4B1 Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.164 AP4B1 Zornitza Stark Marked gene: AP4B1 as ready
Microcephaly v0.164 AP4B1 Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence).
Microcephaly v0.164 AP4B1 Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066
Microcephaly v0.163 AP4B1 Zornitza Stark Publications for gene: AP4B1 were set to
Microcephaly v0.162 AP4B1 Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.161 AP4B1 Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 ANKLE2 Zornitza Stark reviewed gene: ANKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25259927, 30214071, 31735666; Phenotypes: Microcephaly 16, primary, autosomal recessive, MIM# 616681; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.161 ANKLE2 Zornitza Stark Marked gene: ANKLE2 as ready
Microcephaly v0.161 ANKLE2 Zornitza Stark Gene: ankle2 has been classified as Green List (High Evidence).
Microcephaly v0.161 ANKLE2 Zornitza Stark Phenotypes for gene: ANKLE2 were changed from to Microcephaly 16, primary, autosomal recessive, MIM# 616681
Microcephaly v0.160 ANKLE2 Zornitza Stark Publications for gene: ANKLE2 were set to
Microcephaly v0.159 ANKLE2 Zornitza Stark Mode of inheritance for gene: ANKLE2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.158 ANKLE2 Zornitza Stark reviewed gene: ANKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25259927, 30214071, 31735666; Phenotypes: Microcephaly 16, primary, autosomal recessive, MIM# 616681; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 TSEN2 Zornitza Stark Marked gene: TSEN2 as ready
Mendeliome v0.4028 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence).
Cerebellar and Pontocerebellar Hypoplasia v0.148 TSEN2 Zornitza Stark Marked gene: TSEN2 as ready
Cerebellar and Pontocerebellar Hypoplasia v0.148 TSEN2 Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence).
Cerebellar and Pontocerebellar Hypoplasia v0.148 TSEN2 Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389
Cerebellar and Pontocerebellar Hypoplasia v0.147 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Cerebellar and Pontocerebellar Hypoplasia v0.146 TSEN2 Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cerebellar and Pontocerebellar Hypoplasia v0.145 TSEN2 Zornitza Stark reviewed gene: TSEN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23562994, 20952379; Phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4028 TSEN2 Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389
Mendeliome v0.4027 TSEN2 Zornitza Stark Publications for gene: TSEN2 were set to
Mendeliome v0.4026 TSEN2 Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4025 TSEN2 Zornitza Stark edited their review of gene: TSEN2: Added comment: At least 3 unrelated families reported.; Changed rating: GREEN; Changed publications: 23562994, 20952379; Changed phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389
Mendeliome v0.4025 TSEN2 Zornitza Stark Deleted their comment
Frontonasal dysplasia v0.4 ZSWIM6 Zornitza Stark Marked gene: ZSWIM6 as ready
Frontonasal dysplasia v0.4 ZSWIM6 Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence).
Frontonasal dysplasia v0.4 ZSWIM6 Zornitza Stark Phenotypes for gene: ZSWIM6 were changed from to Acromelic frontonasal dysostosis, MIM# 603671
Frontonasal dysplasia v0.3 ZSWIM6 Zornitza Stark Publications for gene: ZSWIM6 were set to
Frontonasal dysplasia v0.2 ZSWIM6 Zornitza Stark Mode of inheritance for gene: ZSWIM6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Frontonasal dysplasia v0.1 ZSWIM6 Zornitza Stark reviewed gene: ZSWIM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25105228, 26706854; Phenotypes: Acromelic frontonasal dysostosis, MIM# 603671; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4025 ZSWIM6 Zornitza Stark Marked gene: ZSWIM6 as ready
Mendeliome v0.4025 ZSWIM6 Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence).
Mendeliome v0.4025 ZSWIM6 Zornitza Stark Phenotypes for gene: ZSWIM6 were changed from to Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865; Acromelic frontonasal dysostosis, MIM# 603671
Mendeliome v0.4024 ZSWIM6 Zornitza Stark Publications for gene: ZSWIM6 were set to
Mendeliome v0.4023 ZSWIM6 Zornitza Stark Mode of inheritance for gene: ZSWIM6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4022 ZSWIM6 Zornitza Stark reviewed gene: ZSWIM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 29198722, 25105228, 26706854; Phenotypes: Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865, Acromelic frontonasal dysostosis, MIM# 603671; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Cholestasis v0.177 ABCB11 Zornitza Stark Publications for gene: ABCB11 were set to 23141890
Cholestasis v0.176 ABCB11 Zornitza Stark reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4022 ABCB11 Zornitza Stark Marked gene: ABCB11 as ready
Mendeliome v0.4022 ABCB11 Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence).
Mendeliome v0.4022 ABCB11 Zornitza Stark Phenotypes for gene: ABCB11 were changed from to Cholestasis, progressive familial intrahepatic 2, MIM# 601847; Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479
Mendeliome v0.4021 ABCB11 Zornitza Stark Publications for gene: ABCB11 were set to
Mendeliome v0.4020 ABCB11 Zornitza Stark Mode of inheritance for gene: ABCB11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4019 ABCB11 Zornitza Stark reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4019 ABCB1 Zornitza Stark Marked gene: ABCB1 as ready
Mendeliome v0.4019 ABCB1 Zornitza Stark Gene: abcb1 has been classified as Red List (Low Evidence).
Mendeliome v0.4019 ABCB1 Zornitza Stark Phenotypes for gene: ABCB1 were changed from to {Inflammatory bowel disease 13} 612244
Mendeliome v0.4018 ABCB1 Zornitza Stark Publications for gene: ABCB1 were set to
Mendeliome v0.4017 ABCB1 Zornitza Stark Mode of inheritance for gene: ABCB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4016 ABCB1 Zornitza Stark Classified gene: ABCB1 as Red List (low evidence)
Mendeliome v0.4016 ABCB1 Zornitza Stark Gene: abcb1 has been classified as Red List (Low Evidence).
Mendeliome v0.4015 ABCB1 Zornitza Stark reviewed gene: ABCB1: Rating: RED; Mode of pathogenicity: None; Publications: 14610718; Phenotypes: {Inflammatory bowel disease 13} 612244; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.4015 AASS Zornitza Stark Tag disputed tag was added to gene: AASS.
Intellectual disability syndromic and non-syndromic v0.2902 AASS Zornitza Stark Tag disputed tag was added to gene: AASS.
Intellectual disability syndromic and non-syndromic v0.2902 AASS Zornitza Stark Mode of inheritance for gene: AASS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.9 ABCA3 Zornitza Stark Marked gene: ABCA3 as ready
Pulmonary Fibrosis_Interstitial Lung Disease v0.9 ABCA3 Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2901 AASS Zornitza Stark Mode of inheritance for gene: AASS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.9 ABCA3 Zornitza Stark Phenotypes for gene: ABCA3 were changed from to Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921
Mendeliome v0.4015 ABCA3 Zornitza Stark Marked gene: ABCA3 as ready
Mendeliome v0.4015 ABCA3 Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence).
Pulmonary Fibrosis_Interstitial Lung Disease v0.8 ABCA3 Zornitza Stark Publications for gene: ABCA3 were set to
Mendeliome v0.4015 ABCA3 Zornitza Stark Phenotypes for gene: ABCA3 were changed from to Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921
Mendeliome v0.4014 ABCA3 Zornitza Stark Publications for gene: ABCA3 were set to
Pulmonary Fibrosis_Interstitial Lung Disease v0.7 ABCA3 Zornitza Stark Mode of inheritance for gene: ABCA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Pulmonary Fibrosis_Interstitial Lung Disease v0.6 ABCA3 Zornitza Stark reviewed gene: ABCA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 15044640; Phenotypes: Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4013 ABCA3 Zornitza Stark Mode of inheritance for gene: ABCA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4012 ABCA3 Zornitza Stark reviewed gene: ABCA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 15044640; Phenotypes: Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ichthyosis and Porokeratosis v0.97 ABCA12 Zornitza Stark reviewed gene: ABCA12: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 4A (MIM#601277), Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4012 ABCA12 Zornitza Stark Marked gene: ABCA12 as ready
Mendeliome v0.4012 ABCA12 Zornitza Stark Gene: abca12 has been classified as Green List (High Evidence).
Mendeliome v0.4012 ABCA12 Zornitza Stark Phenotypes for gene: ABCA12 were changed from to Ichthyosis, congenital, autosomal recessive 4A (MIM#601277); Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500)
Mendeliome v0.4011 ABCA12 Zornitza Stark Publications for gene: ABCA12 were set to
Mendeliome v0.4010 ABCA12 Zornitza Stark Mode of inheritance for gene: ABCA12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4009 ABCA12 Zornitza Stark reviewed gene: ABCA12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31168818, 19664001, 31489029; Phenotypes: Ichthyosis, congenital, autosomal recessive 4A (MIM#601277), Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Dyslipidaemia v0.3 ABCA1 Zornitza Stark Marked gene: ABCA1 as ready
Dyslipidaemia v0.3 ABCA1 Zornitza Stark Gene: abca1 has been classified as Green List (High Evidence).
Dyslipidaemia v0.3 ABCA1 Zornitza Stark Phenotypes for gene: ABCA1 were changed from Tangier disease, ABCA1 deficiency, HDL deficiency, Familial hypoalphalipoproteinemia to Tangier disease, MIM# 205400; HDL deficiency, familial, 1, MIM# 604091
Dyslipidaemia v0.2 ABCA1 Zornitza Stark Publications for gene: ABCA1 were set to
Dyslipidaemia v0.1 ABCA1 Zornitza Stark reviewed gene: ABCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10431237, 10431236; Phenotypes: Tangier disease, MIM# 205400, HDL deficiency, familial, 1, MIM# 604091; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4009 ABCA1 Zornitza Stark Phenotypes for gene: ABCA1 were changed from to Tangier disease, MIM# 205400; HDL deficiency, familial, 1, MIM# 604091
Mendeliome v0.4008 ABCA1 Zornitza Stark Publications for gene: ABCA1 were set to
Mendeliome v0.4007 ABCA1 Zornitza Stark Mode of inheritance for gene: ABCA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.4006 ABCA1 Zornitza Stark reviewed gene: ABCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10431237, 10431236; Phenotypes: Tangier disease, MIM# 205400, HDL deficiency, familial, 1, MIM# 604091; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2900 AASS Zornitza Stark Phenotypes for gene: AASS were changed from to Hyperlysinemia, MIM# 238700
Mendeliome v0.4006 AASS Zornitza Stark Marked gene: AASS as ready
Mendeliome v0.4006 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2899 AASS Zornitza Stark Publications for gene: AASS were set to
Intellectual disability syndromic and non-syndromic v0.2898 AASS Zornitza Stark Classified gene: AASS as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2898 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4006 AASS Zornitza Stark Phenotypes for gene: AASS were changed from to Hyperlysinemia, MIM# 238700
Intellectual disability syndromic and non-syndromic v0.2897 AASS Zornitza Stark reviewed gene: AASS: Rating: AMBER; Mode of pathogenicity: None; Publications: 23570448; Phenotypes: Hyperlysinemia, MIM# 238700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4005 AASS Zornitza Stark Publications for gene: AASS were set to
Mendeliome v0.4004 AASS Zornitza Stark Mode of inheritance for gene: AASS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4003 AASS Zornitza Stark Classified gene: AASS as Amber List (moderate evidence)
Mendeliome v0.4003 AASS Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence).
Mendeliome v0.4002 AASS Zornitza Stark changed review comment from: Hyperlysinemia type I is an autosomal recessive metabolic condition with variable clinical features. Some patients who present in infancy with nonspecific seizures, hypotonia, or mildly delayed psychomotor development have been found to have increased serum lysine and pipecolic acid on laboratory analysis. However, about 50% of probands are reported to be asymptomatic. Given the broad range of clinical features and the presence of consanguinity in several families, there was not strong evidence for causality of symptoms. Hyperlysinemia is generally considered to be a benign metabolic variant rather than a disease entity.; to: Hyperlysinemia type I is an autosomal recessive metabolic condition with variable clinical features. Some patients who present in infancy with nonspecific seizures, hypotonia, or mildly delayed psychomotor development have been found to have increased serum lysine and pipecolic acid on laboratory analysis. However, about 50% of probands are reported to be asymptomatic. Given the broad range of clinical features and the presence of consanguinity in several families, there was not strong evidence for causality of symptoms. It has been suggested that hyperlysinemia is a benign metabolic variant rather than a disease entity.
Mendeliome v0.4002 AASS Zornitza Stark edited their review of gene: AASS: Changed rating: AMBER
Mendeliome v0.4002 AASS Zornitza Stark reviewed gene: AASS: Rating: RED; Mode of pathogenicity: None; Publications: 23570448; Phenotypes: Hyperlysinemia, MIM# 238700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.208 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Callosome v0.208 AARS2 Zornitza Stark Gene: aars2 has been classified as Red List (Low Evidence).
Callosome v0.208 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570
Callosome v0.207 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Callosome v0.206 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Callosome v0.205 AARS2 Zornitza Stark Classified gene: AARS2 as Red List (low evidence)
Callosome v0.205 AARS2 Zornitza Stark Gene: aars2 has been classified as Red List (Low Evidence).
Callosome v0.204 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: RED; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Regression v0.139 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Regression v0.139 AARS2 Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence).
Regression v0.139 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Leukoencephalopathy, progressive, with ovarian failure MIM#615889
Regression v0.138 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Regression v0.137 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Regression v0.136 AARS2 Zornitza Stark edited their review of gene: AARS2: Changed phenotypes: Leukoencephalopathy, progressive, with ovarian failure MIM#615889
Regression v0.136 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.471 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570
Mitochondrial disease v0.470 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Mitochondrial disease v0.469 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.468 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.4002 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Mendeliome v0.4002 AARS2 Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence).
Mendeliome v0.4002 AARS2 Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570
Mendeliome v0.4001 AARS2 Zornitza Stark Publications for gene: AARS2 were set to
Mendeliome v0.4000 AARS2 Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3999 AARS2 Zornitza Stark edited their review of gene: AARS2: Changed phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570
Mendeliome v0.3999 AARS2 Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3999 AARS Zornitza Stark Marked gene: AARS as ready
Mendeliome v0.3999 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Mendeliome v0.3999 AARS Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339; Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287
Mendeliome v0.3998 AARS Zornitza Stark Publications for gene: AARS were set to
Mendeliome v0.3997 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3996 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015, 20045102, 22009580, 22206013, 30373780, 26032230; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339, Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Microcephaly v0.158 AARS Zornitza Stark Marked gene: AARS as ready
Microcephaly v0.158 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Microcephaly v0.158 AARS Zornitza Stark Classified gene: AARS as Green List (high evidence)
Microcephaly v0.158 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Microcephaly v0.157 AARS Zornitza Stark gene: AARS was added
gene: AARS was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: AARS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AARS were set to 28493438; 25817015
Phenotypes for gene: AARS were set to Epileptic encephalopathy, early infantile, 29, MIM# 616339
Review for gene: AARS was set to GREEN
Added comment: Bi-allelic variants associated with a severe phenotype comprising leukodystrophy, epilepsy, microcephaly and neurodevelopmental delay reported in three families.
Sources: Expert Review
Intellectual disability syndromic and non-syndromic v0.2897 AARS Zornitza Stark Marked gene: AARS as ready
Intellectual disability syndromic and non-syndromic v0.2897 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2897 AARS Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339
Intellectual disability syndromic and non-syndromic v0.2896 AARS Zornitza Stark Publications for gene: AARS were set to
Intellectual disability syndromic and non-syndromic v0.2896 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2895 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2894 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy v0.171 AARS Zornitza Stark Marked gene: AARS as ready
Leukodystrophy v0.171 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Leukodystrophy v0.171 AARS Zornitza Stark Publications for gene: AARS were set to
Leukodystrophy v0.170 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.825 AARS Zornitza Stark Marked gene: AARS as ready
Genetic Epilepsy v0.825 AARS Zornitza Stark Gene: aars has been classified as Green List (High Evidence).
Genetic Epilepsy v0.825 AARS Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339
Genetic Epilepsy v0.824 AARS Zornitza Stark Publications for gene: AARS were set to
Genetic Epilepsy v0.823 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.823 AARS Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.822 AARS Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3996 AAGAB Zornitza Stark Marked gene: AAGAB as ready
Mendeliome v0.3996 AAGAB Zornitza Stark Gene: aagab has been classified as Green List (High Evidence).
Mendeliome v0.3996 AAGAB Zornitza Stark Phenotypes for gene: AAGAB were changed from to Keratoderma, palmoplantar, punctate type IA (MIM#148600)
Mendeliome v0.3995 AAGAB Zornitza Stark Publications for gene: AAGAB were set to
Mendeliome v0.3994 AAGAB Zornitza Stark Mode of inheritance for gene: AAGAB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3993 AAGAB Zornitza Stark reviewed gene: AAGAB: Rating: GREEN; Mode of pathogenicity: None; Publications: 30451279, 26608363; Phenotypes: Keratoderma, palmoplantar, punctate type IA (MIM#148600); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3993 A4GALT Zornitza Stark Marked gene: A4GALT as ready
Mendeliome v0.3993 A4GALT Zornitza Stark Gene: a4galt has been classified as Red List (Low Evidence).
Mendeliome v0.3993 A4GALT Zornitza Stark Phenotypes for gene: A4GALT were changed from to [Blood group, P1Pk system, p phenotype], MIM# 111400
Mendeliome v0.3992 A4GALT Zornitza Stark Classified gene: A4GALT as Red List (low evidence)
Mendeliome v0.3992 A4GALT Zornitza Stark Gene: a4galt has been classified as Red List (Low Evidence).
Mendeliome v0.3991 A4GALT Zornitza Stark reviewed gene: A4GALT: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Blood group, P1Pk system, p phenotype], MIM# 111400; Mode of inheritance: None
Genetic Epilepsy v0.822 RELN Zornitza Stark Marked gene: RELN as ready
Genetic Epilepsy v0.822 RELN Zornitza Stark Gene: reln has been classified as Green List (High Evidence).
Genetic Epilepsy v0.822 RELN Zornitza Stark Phenotypes for gene: RELN were changed from to {Epilepsy, familial temporal lobe, 7}, MIM# 616436; MONDO:0014639
Genetic Epilepsy v0.821 RELN Zornitza Stark Publications for gene: RELN were set to
Genetic Epilepsy v0.820 RELN Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.819 RELN Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28142128; Phenotypes: {Epilepsy, familial temporal lobe, 7}, MIM# 616436, MONDO:0014639; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.107 RELN Zornitza Stark Marked gene: RELN as ready
Lissencephaly and Band Heterotopia v0.107 RELN Zornitza Stark Gene: reln has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.107 RELN Zornitza Stark Phenotypes for gene: RELN were changed from to Lissencephaly 2 (Norman-Roberts type), MIM# 257320
Lissencephaly and Band Heterotopia v0.106 RELN Zornitza Stark Publications for gene: RELN were set to
Lissencephaly and Band Heterotopia v0.105 RELN Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.104 RELN Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10973257, 29671837, 31805691; Phenotypes: Lissencephaly 2 (Norman-Roberts type), MIM# 257320; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.104 LAMB1 Zornitza Stark Marked gene: LAMB1 as ready
Lissencephaly and Band Heterotopia v0.104 LAMB1 Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence).
Callosome v0.204 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Callosome v0.204 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Callosome v0.204 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Callosome v0.204 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Callosome v0.203 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Callosome v0.202 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.201 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.156 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Microcephaly v0.156 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Microcephaly v0.156 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Microcephaly v0.155 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Microcephaly v0.154 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.153 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Microcephaly v0.153 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2894 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Intellectual disability syndromic and non-syndromic v0.2894 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2894 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Intellectual disability syndromic and non-syndromic v0.2893 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Intellectual disability syndromic and non-syndromic v0.2892 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2891 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Intellectual disability syndromic and non-syndromic v0.2891 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Genetic Epilepsy v0.819 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Genetic Epilepsy v0.818 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Genetic Epilepsy v0.817 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.816 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Mendeliome v0.3991 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Mendeliome v0.3990 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Mendeliome v0.3989 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3988 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark changed review comment from: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia.; to: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia. Note deletions are common.
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Lissencephaly and Band Heterotopia v0.103 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Lissencephaly and Band Heterotopia v0.102 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.101 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Marked gene: LARGE1 as ready
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Gene: large1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840
Lissencephaly and Band Heterotopia v0.100 LARGE1 Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.99 LARGE1 Zornitza Stark reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3988 LAMB1 Zornitza Stark Marked gene: LAMB1 as ready
Mendeliome v0.3988 LAMB1 Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence).
Mendeliome v0.3988 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191; Cystic leukoencephalopathy
Mendeliome v0.3987 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Mendeliome v0.3986 LAMB1 Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3985 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467, 25925986, 32548278; Phenotypes: Lissencephaly 5, MIM# 615191, Cystic leukoencephalopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.99 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191
Lissencephaly and Band Heterotopia v0.98 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Lissencephaly and Band Heterotopia v0.97 LAMB1 Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.96 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467; Phenotypes: Lissencephaly 5, MIM# 615191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Muscular dystrophy and myopathy_Paediatric v0.72 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Muscular dystrophy and myopathy_Paediatric v0.71 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.70 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3985 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Mendeliome v0.3985 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Mendeliome v0.3985 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Mendeliome v0.3984 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Mendeliome v0.3983 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3982 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Cobblestone Malformations v0.11 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Cobblestone Malformations v0.10 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cobblestone Malformations v0.9 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Lissencephaly and Band Heterotopia v0.95 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Lissencephaly and Band Heterotopia v0.94 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.93 TMEM5 Zornitza Stark edited their review of gene: TMEM5: Changed publications: 23217329, 23519211
Lissencephaly and Band Heterotopia v0.93 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.201 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Callosome v0.201 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Callosome v0.201 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Callosome v0.200 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Callosome v0.199 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.198 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Intellectual disability syndromic and non-syndromic v0.2890 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2889 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Intellectual disability syndromic and non-syndromic v0.2888 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.815 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Genetic Epilepsy v0.814 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3982 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Mendeliome v0.3982 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Genetic Epilepsy v0.813 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3982 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Mendeliome v0.3981 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Mendeliome v0.3980 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Mendeliome v0.3979 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.141 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Polymicrogyria and Schizencephaly v0.140 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.139 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Lissencephaly and Band Heterotopia v0.92 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Lissencephaly and Band Heterotopia v0.91 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.198 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Callosome v0.198 KIF2A Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence).
Callosome v0.198 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Callosome v0.197 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Callosome v0.196 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.195 KIF2A Zornitza Stark Classified gene: KIF2A as Red List (low evidence)
Callosome v0.195 KIF2A Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence).
Callosome v0.194 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: RED; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.153 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Microcephaly v0.153 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Microcephaly v0.153 KIF2A Zornitza Stark Classified gene: KIF2A as Green List (high evidence)
Microcephaly v0.153 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Microcephaly v0.152 KIF2A Zornitza Stark gene: KIF2A was added
gene: KIF2A was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF2A were set to 23603762; 27896282; 27747449; 29077851; 31919497
Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Review for gene: KIF2A was set to GREEN
Added comment: At least five unrelated families reported, with various malformations of cortical development including lissencephaly, agyria, posterior or frontal pachygyria, subcortical band heterotopia, and thin corpus callosum; microcephaly, intellectual disability and seizures. Microcephaly is in the range of -2SD -4.5SD, described as progressive in at least one individual. Some normocephalic but lower end of normal range. Some recurrent missense at p.Ser317 and p.His321. Functional data supports gene-disease association.
Sources: Expert Review
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Genetic Epilepsy v0.812 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Genetic Epilepsy v0.811 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.810 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Mendeliome v0.3979 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Mendeliome v0.3979 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Mendeliome v0.3979 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Mendeliome v0.3978 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Mendeliome v0.3977 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3976 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Lissencephaly and Band Heterotopia v0.89 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Lissencephaly and Band Heterotopia v0.88 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.87 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.87 DCX Zornitza Stark Marked gene: DCX as ready
Lissencephaly and Band Heterotopia v0.87 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Marked gene: ISPD as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Publications for gene: ISPD were set to
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.52 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Marked gene: ISPD as ready
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Hydrocephalus_Ventriculomegaly v0.55 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643
Hydrocephalus_Ventriculomegaly v0.54 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Mendeliome v0.3976 ISPD Zornitza Stark Marked gene: ISPD as ready
Mendeliome v0.3976 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Mendeliome v0.3976 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Mendeliome v0.3975 ISPD Zornitza Stark Publications for gene: ISPD were set to
Mendeliome v0.3974 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.69 ISPD Zornitza Stark Publications for gene: ISPD were set to
Muscular dystrophy and myopathy_Paediatric v0.68 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.67 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.67 Zornitza Stark Panel name changed from Muscular dystrophy to Muscular dystrophy_Paediatric
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Marked gene: ISPD as ready
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Mendeliome v0.3973 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.87 ISPD Zornitza Stark edited their review of gene: ISPD: Changed publications: 22522421, 23217329
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Publications for gene: ISPD were set to
Hydrocephalus_Ventriculomegaly v0.52 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Hydrocephalus_Ventriculomegaly v0.51 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.87 ISPD Zornitza Stark Publications for gene: ISPD were set to 22522421
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Marked gene: ISPD as ready
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643
Lissencephaly and Band Heterotopia v0.85 ISPD Zornitza Stark Publications for gene: ISPD were set to
Lissencephaly and Band Heterotopia v0.84 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.83 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Marked gene: DYNC1H1 as ready
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to Mental retardation, autosomal dominant 13, MIM# 614563
Lissencephaly and Band Heterotopia v0.82 DYNC1H1 Zornitza Stark Publications for gene: DYNC1H1 were set to
Lissencephaly and Band Heterotopia v0.81 DYNC1H1 Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark changed review comment from: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, nodular heterotopias, and PMG.; to: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, lissencephaly, nodular heterotopias, and PMG.
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762, 29671837, 32570172, 27331017
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 13, MIM# 614563; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3973 DCX Zornitza Stark Marked gene: DCX as ready
Mendeliome v0.3973 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Mendeliome v0.3973 DCX Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067
Mendeliome v0.3972 DCX Zornitza Stark Publications for gene: DCX were set to
Mendeliome v0.3971 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.80 DCX Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067
Mendeliome v0.3970 DCX Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.79 DCX Zornitza Stark Publications for gene: DCX were set to
Lissencephaly and Band Heterotopia v0.78 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.77 DCX Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Marked gene: B3GALNT2 as ready
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Gene: b3galnt2 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Phenotypes for gene: B3GALNT2 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181
Lissencephaly and Band Heterotopia v0.76 B3GALNT2 Zornitza Stark Publications for gene: B3GALNT2 were set to
Lissencephaly and Band Heterotopia v0.75 B3GALNT2 Zornitza Stark Mode of inheritance for gene: B3GALNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.74 B3GALNT2 Zornitza Stark reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Marked gene: ARX as ready
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Phenotypes for gene: ARX were changed from to Lissencephaly, X-linked 2, MIM# 300215
Lissencephaly and Band Heterotopia v0.73 ARX Zornitza Stark Publications for gene: ARX were set to
Lissencephaly and Band Heterotopia v0.72 ARX Zornitza Stark Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Lissencephaly and Band Heterotopia v0.71 ARX Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: 14722918; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.2888 DPM3 Zornitza Stark edited their review of gene: DPM3: Changed phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937, Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Marked gene: TLR7 as ready
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Classified gene: TLR7 as Green List (high evidence)
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Susceptibility to Viral Infections v0.64 TLR7 Zornitza Stark gene: TLR7 was added
gene: TLR7 was added to Susceptibility to Viral Infections. Sources: Expert list
Mode of inheritance for gene: TLR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TLR7 were set to 32706371
Phenotypes for gene: TLR7 were set to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051
Review for gene: TLR7 was set to GREEN
Added comment: Four affected individuals from two unrelated families and some functional data.
Sources: Expert list
Mendeliome v0.3970 TLR7 Zornitza Stark reviewed gene: TLR7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32706371; Phenotypes: Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Palmoplantar Keratoderma and Erythrokeratoderma v0.94 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Palmoplantar Keratoderma and Erythrokeratoderma v0.93 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3970 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Mendeliome v0.3969 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ichthyosis and Porokeratosis v0.97 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Ichthyosis and Porokeratosis v0.96 ASPRV1 Zornitza Stark edited their review of gene: ASPRV1: Changed rating: GREEN; Changed phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ichthyosis and Porokeratosis v0.96 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, M 146750; Mode of inheritance: None
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395
Cardiomyopathy_Paediatric v0.6 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from ?Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis)
Cardiomyopathy_Paediatric v0.5 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Cardiomyopathy_Paediatric v0.4 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3969 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Mendeliome v0.3969 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Mendeliome v0.3969 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395
Mendeliome v0.3968 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Mendeliome v0.3967 MRPL44 Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3966 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395
Mitochondrial disease v0.467 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Mitochondrial disease v0.466 MRPL44 Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.465 MRPL44 Zornitza Stark edited their review of gene: MRPL44: Changed rating: GREEN
Mitochondrial disease v0.465 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: ; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson Marked gene: FANCL as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson Gene: fancl has been classified as Red List (Low Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson gene: FANCL was added
gene: FANCL was added to Amenorrhoea. Sources: Literature
Mode of inheritance for gene: FANCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FANCL were set to 32048394; 32851770; 11823446
Phenotypes for gene: FANCL were set to Primary ovarian insufficiency
Review for gene: FANCL was set to AMBER
Added comment: 2 independent cases reported with heterozygous loss of function variants and primary ovarian insufficiency. However, there is no reported evidence of POI in female carriers of FANCL pathogenic variants for fanconi anemia. Null mouse model is less fertile and has defective proliferation of germ cells.
Sources: Literature
Early-onset Dementia v0.72 PRNP Bryony Thompson Classified STR: PRNP as Green List (high evidence)
Early-onset Dementia v0.72 PRNP Bryony Thompson Str: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.71 PRNP Bryony Thompson STR: PRNP was added
STR: PRNP was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: PRNP.
Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP were set to 20301407
Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP was set to GREEN
STR: PRNP was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Mendeliome v0.3966 KBTBD13 Zornitza Stark Marked gene: KBTBD13 as ready
Mendeliome v0.3966 KBTBD13 Zornitza Stark Gene: kbtbd13 has been classified as Green List (High Evidence).
Mendeliome v0.3966 KBTBD13 Zornitza Stark Phenotypes for gene: KBTBD13 were changed from to Nemaline myopathy 6, autosomal dominant, MIM# 609273; Hereditary motor neuropathy; late-onset limb girdle muscular dystrophy
Mendeliome v0.3965 KBTBD13 Zornitza Stark Publications for gene: KBTBD13 were set to
Mendeliome v0.3964 KBTBD13 Zornitza Stark Mode of inheritance for gene: KBTBD13 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3963 KBTBD13 Zornitza Stark edited their review of gene: KBTBD13: Changed rating: GREEN
Mendeliome v0.3963 KBTBD13 Zornitza Stark reviewed gene: KBTBD13: Rating: ; Mode of pathogenicity: None; Publications: 11731279, 21104864; Phenotypes: Nemaline myopathy 6, autosomal dominant, MIM# 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: None
Mitochondrial disease v0.465 NDUFA13 Zornitza Stark Publications for gene: NDUFA13 were set to 25901006
Mendeliome v0.3963 NDUFA13 Zornitza Stark Publications for gene: NDUFA13 were set to 25901006
Mendeliome v0.3962 NDUFA13 Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence)
Mendeliome v0.3962 NDUFA13 Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.3961 NDUFA13 Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639
Mitochondrial disease v0.464 NDUFA13 Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence)
Mitochondrial disease v0.464 NDUFA13 Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence).
Mitochondrial disease v0.463 NDUFA13 Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639
Mendeliome v0.3961 KBTBD13 Elena Savva reviewed gene: KBTBD13: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 28403181, 31167812, 31671076, 30208948; Phenotypes: Nemaline myopathy 6, autosomal dominant, 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Classified STR: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.69 C9orf72 Bryony Thompson STR: C9orf72 was added
STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: C9orf72.
Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: C9orf72 were set to 25577942
Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: C9orf72 was set to GREEN
STR: C9orf72 was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Arthrogryposis v0.207 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Arthrogryposis v0.207 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Arthrogryposis v0.207 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Arthrogryposis v0.206 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Arthrogryposis v0.205 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.204 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Muscular dystrophy and myopathy_Paediatric v0.65 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Muscular dystrophy and myopathy_Paediatric v0.64 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.63 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3961 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Mendeliome v0.3961 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Mendeliome v0.3961 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Mendeliome v0.3960 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Mendeliome v0.3959 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3958 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.71 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from LAMA2-related muscular dystrophy to LAMA2-related muscular dystrophy; Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855
Lissencephaly and Band Heterotopia v0.70 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Autism v0.107 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Autism v0.107 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Autism v0.107 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Autism v0.106 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Autism v0.105 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Autism v0.104 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Genetic Epilepsy v0.809 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Genetic Epilepsy v0.808 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.807 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3958 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Mendeliome v0.3958 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Mendeliome v0.3958 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Mendeliome v0.3957 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Mendeliome v0.3956 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3955 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Intellectual disability syndromic and non-syndromic v0.2887 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Intellectual disability syndromic and non-syndromic v0.2886 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2885 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.139 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from GRIN2B-related neurodevelopmental disorder to GRIN2B-related neurodevelopmental disorder; Mental retardation, autosomal dominant 6, MIM# 613970
Polymicrogyria and Schizencephaly v0.138 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Classified gene: GRIN1 as Green List (high evidence)
Dystonia and Chorea v0.72 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.71 GRIN1 Zornitza Stark gene: GRIN1 was added
gene: GRIN1 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: GRIN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: GRIN1 were set to 29365063; 27164704; 27164704; 28051072
Phenotypes for gene: GRIN1 were set to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Review for gene: GRIN1 was set to GREEN
Added comment: Over 20 individuals reported with de novo missense variants in GRIN1 and severe neurodevelopmental phenotype, comprising ID, seizures, and a movement disorder, in particular dystonia. Two families reported with bi-allelic variants: different mechanism postulated (LOF vs affecting channel functioning or hypomorphic alleles), parents were carriers and unaffected. Movement disorder, in particular dystonia also reported in bi-allelic cases.
Sources: Expert list
Mendeliome v0.3955 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Mendeliome v0.3955 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Mendeliome v0.3955 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Mendeliome v0.3954 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Mendeliome v0.3953 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3952 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254
Genetic Epilepsy v0.806 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Genetic Epilepsy v0.805 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.804 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Intellectual disability syndromic and non-syndromic v0.2884 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Intellectual disability syndromic and non-syndromic v0.2883 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2882 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Added comment: Comment when marking as ready: All variants occurred between residues 559 and 828, and there may be an association between variant location and PMG.
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from GRIN1-related neurodevelopmental disorder to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254
Intellectual disability syndromic and non-syndromic v0.2882 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Intellectual disability syndromic and non-syndromic v0.2881 HARS Zornitza Stark commented on gene: HARS: Please note this is the correct PMID for this disease association
Intellectual disability syndromic and non-syndromic v0.2881 HARS Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome, mild-severe intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ataxia v0.222 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Ataxia v0.221 HARS Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Additional findings_Paediatric v0.2 ZNF674 Zornitza Stark gene: ZNF674 was added
gene: ZNF674 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZNF674 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ZNF674 were set to Mental retardation
Additional findings_Paediatric v0.2 ZNF252P Zornitza Stark gene: ZNF252P was added
gene: ZNF252P was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZNF252P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZNF252P were set to Hypothyroidism
Additional findings_Paediatric v0.2 ZFPM2 Zornitza Stark gene: ZFPM2 was added
gene: ZFPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZFPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZFPM2 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 YARS2 Zornitza Stark gene: YARS2 was added
gene: YARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: YARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: YARS2 were set to Myopathy, lactic acidosis, and sideroblastic anemia
Additional findings_Paediatric v0.2 WRAP53 Zornitza Stark gene: WRAP53 was added
gene: WRAP53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WRAP53 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WRAP53 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 WNT7A Zornitza Stark gene: WNT7A was added
gene: WNT7A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT7A were set to Ulna and fibula absence of with severe limb deficiency
Additional findings_Paediatric v0.2 WNT5A Zornitza Stark gene: WNT5A was added
gene: WNT5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WNT5A were set to Robinow syndrome
Additional findings_Paediatric v0.2 WNT3 Zornitza Stark gene: WNT3 was added
gene: WNT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT3 were set to Tetra-amelia, autosomal recessive
Additional findings_Paediatric v0.2 WNK1 Zornitza Stark gene: WNK1 was added
gene: WNK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNK1 were set to Neuropathy, hereditary sensory and autonomic, type I
Additional findings_Paediatric v0.2 WDR36 Zornitza Stark gene: WDR36 was added
gene: WDR36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WDR36 were set to Glaucoma
Additional findings_Paediatric v0.2 WDR35 Zornitza Stark gene: WDR35 was added
gene: WDR35 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR35 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR35 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 WDR19 Zornitza Stark gene: WDR19 was added
gene: WDR19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR19 were set to Nephronophthisis
Additional findings_Paediatric v0.2 VSX1 Zornitza Stark gene: VSX1 was added
gene: VSX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VSX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VSX1 were set to Keratoconus
Additional findings_Paediatric v0.2 VPS53 Zornitza Stark gene: VPS53 was added
gene: VPS53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VPS53 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS53 were set to Progressive cerebello-cerebral atrophy
Additional findings_Paediatric v0.2 VAMP1 Zornitza Stark gene: VAMP1 was added
gene: VAMP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VAMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VAMP1 were set to Spastic ataxia
Additional findings_Paediatric v0.2 UQCRQ Zornitza Stark gene: UQCRQ was added
gene: UQCRQ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UQCRQ was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UQCRQ were set to Mitochondrial complex III deficiency
Additional findings_Paediatric v0.2 UQCRB Zornitza Stark gene: UQCRB was added
gene: UQCRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UQCRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UQCRB were set to Mitochondrial complex III deficiency
Additional findings_Paediatric v0.2 UGT1A5 Zornitza Stark gene: UGT1A5 was added
gene: UGT1A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UGT1A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A5 were set to UDP glucuronosyltransferase deficiency
Additional findings_Paediatric v0.2 UGT1A4 Zornitza Stark gene: UGT1A4 was added
gene: UGT1A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UGT1A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A4 were set to Crigler-Najjar syndrome
Additional findings_Paediatric v0.2 UCP2 Zornitza Stark gene: UCP2 was added
gene: UCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UCP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: UCP2 were set to Hyperinsulinism
Additional findings_Paediatric v0.2 UBA1 Zornitza Stark gene: UBA1 was added
gene: UBA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UBA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: UBA1 were set to Spinal muscular atrophy, X-linked infantile
Additional findings_Paediatric v0.2 TUBA8 Zornitza Stark gene: TUBA8 was added
gene: TUBA8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TUBA8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TUBA8 were set to Polymicrogyria with optic nerve hypoplasia
Additional findings_Paediatric v0.2 TTC21B Zornitza Stark gene: TTC21B was added
gene: TTC21B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TTC21B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC21B were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.2 TSPYL1 Zornitza Stark gene: TSPYL1 was added
gene: TSPYL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSPYL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSPYL1 were set to Sudden infant death with dysgenesis of the testes syndrome
Additional findings_Paediatric v0.2 TSPEAR Zornitza Stark gene: TSPEAR was added
gene: TSPEAR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSPEAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSPEAR were set to Sensorineural deafness
Additional findings_Paediatric v0.2 TSFM Zornitza Stark gene: TSFM was added
gene: TSFM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSFM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSFM were set to Combined oxidative phosphorylation deficiency
Additional findings_Paediatric v0.2 TRPM2 Zornitza Stark gene: TRPM2 was added
gene: TRPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPM2 were set to ALS and Parkinson's disease
Additional findings_Paediatric v0.2 TRIP11 Zornitza Stark gene: TRIP11 was added
gene: TRIP11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRIP11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIP11 were set to Achondrogenesis type 1A
Additional findings_Paediatric v0.2 TRHR Zornitza Stark gene: TRHR was added
gene: TRHR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRHR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRHR were set to Thyrotropin-releasing hormone resistance, generalized
Additional findings_Paediatric v0.2 TRH Zornitza Stark gene: TRH was added
gene: TRH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRH were set to Thyrotropin-releasing hormone deficiency
Additional findings_Paediatric v0.2 TRDN Zornitza Stark gene: TRDN was added
gene: TRDN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRDN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRDN were set to Catecholaminergic polymorphic ventricular tachycardia
Additional findings_Paediatric v0.2 TPRN Zornitza Stark gene: TPRN was added
gene: TPRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TPRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPRN were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TNXB Zornitza Stark gene: TNXB was added
gene: TNXB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TNXB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNXB were set to Ehlers-Danlos syndrome due to tenascin X deficiency
Additional findings_Paediatric v0.2 TMPO Zornitza Stark gene: TMPO was added
gene: TMPO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TMPO were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TMEM237 Zornitza Stark gene: TMEM237 was added
gene: TMEM237 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMEM237 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM237 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMEM216 Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM216
Additional findings_Paediatric v0.2 TMEM216 Zornitza Stark gene: TMEM216 was added
gene: TMEM216 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMEM216 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM216 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMC8 Zornitza Stark gene: TMC8 was added
gene: TMC8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMC8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMC8 were set to Epidermodysplasia verruciformi
Additional findings_Paediatric v0.2 TJP2 Zornitza Stark gene: TJP2 was added
gene: TJP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TJP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TJP2 were set to Hypercholanemia, familial
Additional findings_Paediatric v0.2 THBS1 Zornitza Stark gene: THBS1 was added
gene: THBS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: THBS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THBS1 were set to Pulmonary hypertension
Additional findings_Paediatric v0.2 THBD Zornitza Stark gene: THBD was added
gene: THBD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: THBD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THBD were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 TGIF1 Zornitza Stark gene: TGIF1 was added
gene: TGIF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGIF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGIF1 were set to Holoprosencephaly-4
Additional findings_Paediatric v0.2 TGFBR3 Zornitza Stark gene: TGFBR3 was added
gene: TGFBR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFBR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR3 were set to Premature ovarian failure
Additional findings_Paediatric v0.2 TGFB3 Zornitza Stark gene: TGFB3 was added
gene: TGFB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFB3 were set to Arrhythmogenic right ventricular dysplasia
Additional findings_Paediatric v0.2 TGFB1 Zornitza Stark gene: TGFB1 was added
gene: TGFB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFB1 were set to Camurati-Engelmann disease
Additional findings_Paediatric v0.2 TFR2 Zornitza Stark gene: TFR2 was added
gene: TFR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TFR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TFR2 were set to Hemochromatosis type 3
Additional findings_Paediatric v0.2 TCTN3 Zornitza Stark gene: TCTN3 was added
gene: TCTN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TCTN3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN3 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TCTN1 Zornitza Stark gene: TCTN1 was added
gene: TCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN1 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TCAP Zornitza Stark Source BabySeq Category C gene was added to TCAP.
Source Expert Review Red was added to TCAP.
Added phenotypes Cardiomyopathy, dilated for gene: TCAP
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 TBX20 Zornitza Stark gene: TBX20 was added
gene: TBX20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TBX20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX20 were set to Congenital heart disease
Additional findings_Paediatric v0.2 TBCE Zornitza Stark gene: TBCE was added
gene: TBCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TBCE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBCE were set to Hypoparathyroidism retardation dysmorphism syndrome
Additional findings_Paediatric v0.2 TARDBP Zornitza Stark gene: TARDBP was added
gene: TARDBP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TARDBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TARDBP were set to Amyotrophic lateral sclerosis type 10
Additional findings_Paediatric v0.2 TAB2 Zornitza Stark gene: TAB2 was added
gene: TAB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TAB2 were set to Congenital heart disease, nonsyndromic