Activity

Filter

Cancel
Date Panel Item Activity
824 actions
Early-onset Dementia v2.0 ATN1_DRPLA_CAG STR ATN1_DRPLA_CAG: gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration)
Early-onset Dementia v2.0 NOTCH2NLC_NIID_GGC STR NOTCH2NLC_NIID_GGC: gene migrated from ENSG00000286219 to ENSG00000286219 (gene set migration)
Early-onset Dementia v2.0 TBP_SCA17_CAG STR TBP_SCA17_CAG: gene migrated from ENSG00000112592 to ENSG00000112592 (gene set migration)
Early-onset Dementia v2.0 PRNP_CJD_octapeptide STR PRNP_CJD_octapeptide: gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration)
Early-onset Dementia v2.0 C9orf72_FTDALS_GGGGCC STR C9orf72_FTDALS_GGGGCC: gene migrated from ENSG00000147894 to ENSG00000147894 (gene set migration)
Early-onset Dementia v2.0 JPH3_HDL2_CTG STR JPH3_HDL2_CTG: gene migrated from ENSG00000154118 to ENSG00000154118 (gene set migration)
Early-onset Dementia v2.0 ATN1 Gene migrated from ENSG00000111676 to ENSG00000111676 (gene set migration)
Early-onset Dementia v2.0 C9orf72 Gene migrated from ENSG00000147894 to ENSG00000147894 (gene set migration)
Early-onset Dementia v2.0 PRKCH Gene migrated from ENSG00000027075 to ENSG00000027075 (gene set migration)
Early-onset Dementia v2.0 SPART Gene migrated from ENSG00000133104 to ENSG00000133104 (gene set migration)
Early-onset Dementia v2.0 ALS2 Gene migrated from ENSG00000003393 to ENSG00000003393 (gene set migration)
Early-onset Dementia v2.0 GSN Gene migrated from ENSG00000148180 to ENSG00000148180 (gene set migration)
Early-onset Dementia v2.0 TH Gene migrated from ENSG00000180176 to ENSG00000180176 (gene set migration)
Early-onset Dementia v2.0 HTRA2 Gene migrated from ENSG00000115317 to ENSG00000115317 (gene set migration)
Early-onset Dementia v2.0 PPIA Gene migrated from ENSG00000196262 to ENSG00000196262 (gene set migration)
Early-onset Dementia v2.0 ATP7B Gene migrated from ENSG00000123191 to ENSG00000123191 (gene set migration)
Early-onset Dementia v2.0 SOD1 Gene migrated from ENSG00000142168 to ENSG00000142168 (gene set migration)
Early-onset Dementia v2.0 SETX Gene migrated from ENSG00000107290 to ENSG00000107290 (gene set migration)
Early-onset Dementia v2.0 GCH1 Gene migrated from ENSG00000131979 to ENSG00000131979 (gene set migration)
Early-onset Dementia v2.0 SNCB Gene migrated from ENSG00000074317 to ENSG00000074317 (gene set migration)
Early-onset Dementia v2.0 UCHL1 Gene migrated from ENSG00000154277 to ENSG00000154277 (gene set migration)
Early-onset Dementia v2.0 FIG4 Gene migrated from ENSG00000112367 to ENSG00000112367 (gene set migration)
Early-onset Dementia v2.0 ANG Gene migrated from ENSG00000214274 to ENSG00000214274 (gene set migration)
Early-onset Dementia v2.0 TET2 Gene migrated from ENSG00000168769 to ENSG00000168769 (gene set migration)
Early-onset Dementia v2.0 VAPB Gene migrated from ENSG00000124164 to ENSG00000124164 (gene set migration)
Early-onset Dementia v2.0 FA2H Gene migrated from ENSG00000103089 to ENSG00000103089 (gene set migration)
Early-onset Dementia v2.0 NR4A2 Gene migrated from ENSG00000153234 to ENSG00000153234 (gene set migration)
Early-onset Dementia v2.0 CYLD Gene migrated from ENSG00000083799 to ENSG00000083799 (gene set migration)
Early-onset Dementia v2.0 POLG Gene migrated from ENSG00000140521 to ENSG00000140521 (gene set migration)
Early-onset Dementia v2.0 COL4A2 Gene migrated from ENSG00000134871 to ENSG00000134871 (gene set migration)
Early-onset Dementia v2.0 HNRNPA1 Gene migrated from ENSG00000135486 to ENSG00000135486 (gene set migration)
Early-onset Dementia v2.0 SORL1 Gene migrated from ENSG00000137642 to ENSG00000137642 (gene set migration)
Early-onset Dementia v2.0 HNRNPA2B1 Gene migrated from ENSG00000122566 to ENSG00000122566 (gene set migration)
Early-onset Dementia v2.0 RBMX Gene migrated from ENSG00000147274 to ENSG00000147274 (gene set migration)
Early-onset Dementia v2.0 CCNF Gene migrated from ENSG00000162063 to ENSG00000162063 (gene set migration)
Early-onset Dementia v2.0 GBA1 Gene symbol changed from GBA to GBA1 during gene set migration (ENSG00000177628 -> ENSG00000177628)
Early-onset Dementia v2.0 TAF15 Gene migrated from ENSG00000270647 to ENSG00000270647 (gene set migration)
Early-onset Dementia v2.0 SQSTM1 Gene migrated from ENSG00000161011 to ENSG00000161011 (gene set migration)
Early-onset Dementia v2.0 KIF5A Gene migrated from ENSG00000155980 to ENSG00000155980 (gene set migration)
Early-onset Dementia v2.0 MATR3 Gene migrated from ENSG00000015479 to ENSG00000015479 (gene set migration)
Early-onset Dementia v2.0 APOE Gene migrated from ENSG00000130203 to ENSG00000130203 (gene set migration)
Early-onset Dementia v2.0 TIA1 Gene migrated from ENSG00000116001 to ENSG00000116001 (gene set migration)
Early-onset Dementia v2.0 FUS Gene migrated from ENSG00000089280 to ENSG00000089280 (gene set migration)
Early-onset Dementia v2.0 FTL Gene migrated from ENSG00000087086 to ENSG00000087086 (gene set migration)
Early-onset Dementia v2.0 CYP27A1 Gene migrated from ENSG00000135929 to ENSG00000135929 (gene set migration)
Early-onset Dementia v2.0 CHCHD10 Gene migrated from ENSG00000250479 to ENSG00000250479 (gene set migration)
Early-onset Dementia v2.0 C19orf12 Gene migrated from ENSG00000131943 to ENSG00000131943 (gene set migration)
Early-onset Dementia v2.0 ARSA Gene migrated from ENSG00000100299 to ENSG00000100299 (gene set migration)
Early-onset Dementia v2.0 ATP13A2 Gene migrated from ENSG00000159363 to ENSG00000159363 (gene set migration)
Early-onset Dementia v2.0 SNCA Gene migrated from ENSG00000145335 to ENSG00000145335 (gene set migration)
Early-onset Dementia v2.0 STUB1 Gene migrated from ENSG00000103266 to ENSG00000103266 (gene set migration)
Early-onset Dementia v2.0 CTSF Gene migrated from ENSG00000174080 to ENSG00000174080 (gene set migration)
Early-onset Dementia v2.0 MAPT Gene migrated from ENSG00000186868 to ENSG00000186868 (gene set migration)
Early-onset Dementia v2.0 PRKN Gene migrated from ENSG00000185345 to ENSG00000185345 (gene set migration)
Early-onset Dementia v2.0 VPS13A Gene migrated from ENSG00000197969 to ENSG00000197969 (gene set migration)
Early-onset Dementia v2.0 VPS35 Gene migrated from ENSG00000069329 to ENSG00000069329 (gene set migration)
Early-onset Dementia v2.0 WDR45 Gene migrated from ENSG00000196998 to ENSG00000196998 (gene set migration)
Early-onset Dementia v2.0 RNF216 Gene migrated from ENSG00000011275 to ENSG00000011275 (gene set migration)
Early-onset Dementia v2.0 HTRA1 Gene migrated from ENSG00000166033 to ENSG00000166033 (gene set migration)
Early-onset Dementia v2.0 CP Gene migrated from ENSG00000047457 to ENSG00000047457 (gene set migration)
Early-onset Dementia v2.0 PARK7 Gene migrated from ENSG00000116288 to ENSG00000116288 (gene set migration)
Early-onset Dementia v2.0 ANXA11 Gene migrated from ENSG00000122359 to ENSG00000122359 (gene set migration)
Early-onset Dementia v2.0 SPG11 Gene migrated from ENSG00000104133 to ENSG00000104133 (gene set migration)
Early-onset Dementia v2.0 DCTN1 Gene migrated from ENSG00000204843 to ENSG00000204843 (gene set migration)
Early-onset Dementia v2.0 DNAJC5 Gene migrated from ENSG00000101152 to ENSG00000101152 (gene set migration)
Early-onset Dementia v2.0 CST3 Gene migrated from ENSG00000101439 to ENSG00000101439 (gene set migration)
Early-onset Dementia v2.0 CAPRIN1 Gene migrated from ENSG00000135387 to ENSG00000135387 (gene set migration)
Early-onset Dementia v2.0 SLC9A6 Gene migrated from ENSG00000198689 to ENSG00000198689 (gene set migration)
Early-onset Dementia v2.0 GLA Gene migrated from ENSG00000102393 to ENSG00000102393 (gene set migration)
Early-onset Dementia v2.0 NOTCH3 Gene migrated from ENSG00000074181 to ENSG00000074181 (gene set migration)
Early-onset Dementia v2.0 COL4A1 Gene migrated from ENSG00000187498 to ENSG00000187498 (gene set migration)
Early-onset Dementia v2.0 TREX1 Gene migrated from ENSG00000213689 to ENSG00000213689 (gene set migration)
Early-onset Dementia v2.0 VPS13C Gene migrated from ENSG00000129003 to ENSG00000129003 (gene set migration)
Early-onset Dementia v2.0 TUBA4A Gene migrated from ENSG00000127824 to ENSG00000127824 (gene set migration)
Early-onset Dementia v2.0 CHMP2B Gene migrated from ENSG00000083937 to ENSG00000083937 (gene set migration)
Early-onset Dementia v2.0 OPTN Gene migrated from ENSG00000123240 to ENSG00000123240 (gene set migration)
Early-onset Dementia v2.0 PSEN2 Gene migrated from ENSG00000143801 to ENSG00000143801 (gene set migration)
Early-onset Dementia v2.0 TBK1 Gene migrated from ENSG00000183735 to ENSG00000183735 (gene set migration)
Early-onset Dementia v2.0 TARDBP Gene migrated from ENSG00000120948 to ENSG00000120948 (gene set migration)
Early-onset Dementia v2.0 TYROBP Gene migrated from ENSG00000011600 to ENSG00000011600 (gene set migration)
Early-onset Dementia v2.0 NHLRC1 Gene migrated from ENSG00000187566 to ENSG00000187566 (gene set migration)
Early-onset Dementia v2.0 PLA2G6 Gene migrated from ENSG00000184381 to ENSG00000184381 (gene set migration)
Early-onset Dementia v2.0 PANK2 Gene migrated from ENSG00000125779 to ENSG00000125779 (gene set migration)
Early-onset Dementia v2.0 PRNP Gene migrated from ENSG00000171867 to ENSG00000171867 (gene set migration)
Early-onset Dementia v2.0 NPC2 Gene migrated from ENSG00000119655 to ENSG00000119655 (gene set migration)
Early-onset Dementia v2.0 PSEN1 Gene migrated from ENSG00000080815 to ENSG00000080815 (gene set migration)
Early-onset Dementia v2.0 UBQLN2 Gene migrated from ENSG00000188021 to ENSG00000188021 (gene set migration)
Early-onset Dementia v2.0 NPC1 Gene migrated from ENSG00000141458 to ENSG00000141458 (gene set migration)
Early-onset Dementia v2.0 VCP Gene migrated from ENSG00000165280 to ENSG00000165280 (gene set migration)
Early-onset Dementia v2.0 GRN Gene migrated from ENSG00000030582 to ENSG00000030582 (gene set migration)
Early-onset Dementia v2.0 EPM2A Gene migrated from ENSG00000112425 to ENSG00000112425 (gene set migration)
Early-onset Dementia v2.0 XK Gene migrated from ENSG00000047597 to ENSG00000047597 (gene set migration)
Early-onset Dementia v2.0 TREM2 Gene migrated from ENSG00000095970 to ENSG00000095970 (gene set migration)
Early-onset Dementia v2.0 APP Gene migrated from ENSG00000142192 to ENSG00000142192 (gene set migration)
Early-onset Dementia v2.0 ITM2B Gene migrated from ENSG00000136156 to ENSG00000136156 (gene set migration)
Early-onset Dementia v2.0 CLN6 Gene migrated from ENSG00000128973 to ENSG00000128973 (gene set migration)
Early-onset Dementia v2.0 TTR Gene migrated from ENSG00000118271 to ENSG00000118271 (gene set migration)
Early-onset Dementia v2.0 SPG21 Gene migrated from ENSG00000090487 to ENSG00000090487 (gene set migration)
Early-onset Dementia v2.0 PINK1 Gene migrated from ENSG00000158828 to ENSG00000158828 (gene set migration)
Early-onset Dementia v2.0 LRRK2 Gene migrated from ENSG00000188906 to ENSG00000188906 (gene set migration)
Early-onset Dementia v2.0 DNMT1 Gene migrated from ENSG00000130816 to ENSG00000130816 (gene set migration)
Early-onset Dementia v2.0 CSF1R Gene migrated from ENSG00000182578 to ENSG00000182578 (gene set migration)
Early-onset Dementia v2.0 Panel migrated to gene set Ensemblv115. Source version: v1.58
Early-onset Dementia v1.58 RBMX Zornitza Stark Marked gene: RBMX as ready
Early-onset Dementia v1.58 RBMX Zornitza Stark Gene: rbmx has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.58 RBMX Lucy Spencer Publications for gene: RBMX were set to 25256757; 34260915; 37277488; 39263607
Early-onset Dementia v1.57 RBMX Lucy Spencer Phenotypes for gene: RBMX were changed from Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238; Gustavson syndrome, MIM# 309555; Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related to Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related
Early-onset Dementia v1.56 Lucy Spencer Copied gene RBMX from panel Mendeliome
Early-onset Dementia v1.56 RBMX Lucy Spencer gene: RBMX was added
gene: RBMX was added to Early-onset Dementia. Sources: Expert Review Amber,Expert Review
Mode of inheritance for gene: RBMX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: RBMX were set to 25256757; 34260915; 37277488; 39263607
Phenotypes for gene: RBMX were set to Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238; Gustavson syndrome, MIM# 309555; Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related
Early-onset Dementia v1.55 SPG11 Zornitza Stark Marked gene: SPG11 as ready
Early-onset Dementia v1.55 SPG11 Zornitza Stark Gene: spg11 has been classified as Green List (High Evidence).
Early-onset Dementia v1.55 SPG11 Zornitza Stark Publications for gene: SPG11 were set to
Early-onset Dementia v1.54 PRKCH Zornitza Stark Marked gene: PRKCH as ready
Early-onset Dementia v1.54 PRKCH Zornitza Stark Gene: prkch has been classified as Red List (Low Evidence).
Early-onset Dementia v1.54 PRKCH Zornitza Stark gene: PRKCH was added
gene: PRKCH was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: PRKCH was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PRKCH were set to 40591711
Phenotypes for gene: PRKCH were set to Alzheimer disease, MONDO:0004975, PRKCH-related
Review for gene: PRKCH was set to RED
Added comment: PMID 40591711 reports eight individuals from one family with a homozygous missense K65R variant
Sources: Literature
Early-onset Dementia v1.53 SORL1 Zornitza Stark Marked gene: SORL1 as ready
Early-onset Dementia v1.53 SORL1 Zornitza Stark Gene: sorl1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.53 Zornitza Stark Copied gene SORL1 from panel Incidentalome
Early-onset Dementia v1.53 SORL1 Zornitza Stark gene: SORL1 was added
gene: SORL1 was added to Early-onset Dementia. Sources: Expert Review Amber,Victorian Clinical Genetics Services
Mode of inheritance for gene: SORL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SORL1 were set to 27026413; 39226352; 40182695
Phenotypes for gene: SORL1 were set to Alzheimer disease, MONDO:0004975, SORL1-related
Early-onset Dementia v1.52 SQSTM1 Krithika Murali Classified gene: SQSTM1 as Amber List (moderate evidence)
Early-onset Dementia v1.52 SQSTM1 Krithika Murali Gene: sqstm1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.51 SQSTM1 Krithika Murali Classified gene: SQSTM1 as Amber List (moderate evidence)
Early-onset Dementia v1.51 SQSTM1 Krithika Murali Gene: sqstm1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.51 SQSTM1 Krithika Murali Classified gene: SQSTM1 as Amber List (moderate evidence)
Early-onset Dementia v1.51 SQSTM1 Krithika Murali Gene: sqstm1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.50 SQSTM1 Krithika Murali commented on gene: SQSTM1
Early-onset Dementia v1.50 TH Zornitza Stark Phenotypes for gene: TH were changed from Segawa syndrome, recessive MIM#605407 to Segawa syndrome, recessive MIM#605407
Early-onset Dementia v1.50 TH Zornitza Stark Marked gene: TH as ready
Early-onset Dementia v1.50 TH Zornitza Stark Gene: th has been classified as Red List (Low Evidence).
Early-onset Dementia v1.50 TH Zornitza Stark Phenotypes for gene: TH were changed from to Segawa syndrome, recessive MIM#605407
Early-onset Dementia v1.49 TH Zornitza Stark Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v1.48 DNMT1 Chirag Patel Publications for gene DNMT1 were changed from 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 to 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424
Early-onset Dementia v1.47 DNMT1 Chirag Patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DNMT1.
Source Victorian Clinical Genetics Services was removed from DNMT1.
Source ClinGen was added to DNMT1.
Mode of inheritance for gene DNMT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DNMT1 were changed from to Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584
Publications for gene DNMT1 were changed from 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457 to 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457
Early-onset Dementia v1.46 DCTN1 Chirag Patel Phenotypes for gene: DCTN1 were changed from Perry syndrome, MIM# 168605 to Perry syndrome, MONDO:0008201
Publications for gene DCTN1 were changed from 20945553, 19136952, 24343258 to 20945553, 19136952, 24343258
Early-onset Dementia v1.45 DCTN1 Chirag Patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DCTN1.
Source Victorian Clinical Genetics Services was removed from DCTN1.
Source Literature was added to DCTN1.
Publications for gene DCTN1 were changed from 19136952, 24343258 to 19136952, 24343258
Early-onset Dementia v1.44 DNAJC5 Chirag Patel Source Melbourne Genomics Health Alliance Complex Neurology Flagship was removed from DNAJC5.
Source Victorian Clinical Genetics Services was removed from DNAJC5.
Source Expert list was added to DNAJC5.
Mode of inheritance for gene DNAJC5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DNAJC5 were changed from to Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083
Publications for gene DNAJC5 were changed from 22978711; 21820099; 22235333; 31919451; 26659577 to 22978711; 21820099; 22235333; 31919451; 26659577
Early-onset Dementia v1.43 SQSTM1 Zornitza Stark Publications for gene: SQSTM1 were set to 22084127; 22972638
Early-onset Dementia v1.42 SQSTM1 Zornitza Stark Classified gene: SQSTM1 as Green List (high evidence)
Early-onset Dementia v1.42 SQSTM1 Zornitza Stark Gene: sqstm1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.41 SQSTM1 Chris Ciotta reviewed gene: SQSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27554286, 31362587, 28490746, 31859009, 23942205; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v1.41 NOTCH2NLC_NIID_GGC Bryony Thompson Gene: NOTCH2NL was changed to NOTCH2NLC.
Early-onset Dementia v1.40 CST3 Zornitza Stark Phenotypes for gene: CST3 were changed from Cerebral amyloid angiopathy MIM#105150; leukodystrophy MONDO:0019046 to Cerebral amyloid angiopathy MIM#105150; Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214
Early-onset Dementia v1.39 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence).
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Early-onset Dementia v1.37 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Early-onset Dementia v1.36 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Dementia v1.35 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.33 PRNP_CJD_octapeptide Bryony Thompson CJD was changed to PRNP_CJD_octapeptide
Early-onset Dementia v1.32 SLC9A6 Zornitza Stark Mode of inheritance for gene: SLC9A6 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Dementia v1.31 SLC9A6 Zornitza Stark edited their review of gene: SLC9A6: Changed phenotypes: Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142; Changed mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Dementia v1.31 SLC9A6 Zornitza Stark Marked gene: SLC9A6 as ready
Early-onset Dementia v1.31 SLC9A6 Zornitza Stark Gene: slc9a6 has been classified as Green List (High Evidence).
Early-onset Dementia v1.31 SLC9A6 Zornitza Stark Classified gene: SLC9A6 as Green List (high evidence)
Early-onset Dementia v1.31 SLC9A6 Zornitza Stark Gene: slc9a6 has been classified as Green List (High Evidence).
Early-onset Dementia v1.30 SLC9A6 Zornitza Stark gene: SLC9A6 was added
gene: SLC9A6 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: SLC9A6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: SLC9A6 were set to 35198730; 39810750; 35198730; 31192222
Phenotypes for gene: SLC9A6 were set to Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142
Review for gene: SLC9A6 was set to GREEN
Added comment: Multiple female carriers reported with adult-onset neurological phenotypes including neurodegerative disease and Parkinsonism. Some had affected sons with ID. Uncertain whether this is a separate entity or manifestation in female carriers of a XL condition.
Sources: Literature
Early-onset Dementia v1.29 ANXA11 Bryony Thompson Marked gene: ANXA11 as ready
Early-onset Dementia v1.29 ANXA11 Bryony Thompson Gene: anxa11 has been classified as Green List (High Evidence).
Early-onset Dementia v1.29 ANXA11 Bryony Thompson Classified gene: ANXA11 as Green List (high evidence)
Early-onset Dementia v1.29 ANXA11 Bryony Thompson Gene: anxa11 has been classified as Green List (High Evidence).
Early-onset Dementia v1.28 ANXA11 Bryony Thompson gene: ANXA11 was added
gene: ANXA11 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: ANXA11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ANXA11 were set to 36458208; 39755715; 38896345; 38896262
Phenotypes for gene: ANXA11 were set to amyotrophic lateral sclerosis type 23 MONDO:0027694
Mode of pathogenicity for gene: ANXA11 was set to Other
Review for gene: ANXA11 was set to GREEN
gene: ANXA11 was marked as current diagnostic
Added comment: FTD can be a feature of the condition. ANXA11 is classified as a multisystem proteinopathy gene. Gain-of-function is the mechanism of disease.
Sources: Literature
Early-onset Dementia v1.27 CAPRIN1 Shekeeb Mohammad gene: CAPRIN1 was added
gene: CAPRIN1 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: CAPRIN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CAPRIN1 were set to 39878554
Phenotypes for gene: CAPRIN1 were set to Childhood Dementia; Myoclonus-Ataxia; Sensorimotor Neuropathy; cerebellar atrophy; cortical atrophy
Penetrance for gene: CAPRIN1 were set to unknown
Review for gene: CAPRIN1 was set to GREEN
gene: CAPRIN1 was marked as current diagnostic
Added comment: Sources: Literature
Early-onset Dementia v1.27 KIF5A Bryony Thompson Marked gene: KIF5A as ready
Early-onset Dementia v1.27 KIF5A Bryony Thompson Gene: kif5a has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.27 KIF5A Bryony Thompson Classified gene: KIF5A as Amber List (moderate evidence)
Early-onset Dementia v1.27 KIF5A Bryony Thompson Gene: kif5a has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.26 KIF5A Bryony Thompson gene: KIF5A was added
gene: KIF5A was added to Early-onset Dementia. Sources: Other
Mode of inheritance for gene: KIF5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF5A were set to 33077544; 36604770
Phenotypes for gene: KIF5A were set to Amyotrophic lateral sclerosis, susceptibility to, 25 MONDO:0060670
Mode of pathogenicity for gene: KIF5A was set to Other
Review for gene: KIF5A was set to AMBER
Added comment: ALS-FTD phenotype has been reported in two families with KIF5A variants. The mechanism of disease is likely gain of function.
Sources: Other
Early-onset Dementia v1.25 TREM2 Zornitza Stark Phenotypes for gene: TREM2 were changed from Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193 to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193; {Alzhieimer disease 17, susceptibility to}, MIM# 615080
Early-onset Dementia v1.24 TREM2 Zornitza Stark edited their review of gene: TREM2: Changed phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193, {Alzhieimer disease 17, susceptibility to}, MIM# 615080
Early-onset Dementia v1.24 TUBA4A Bryony Thompson Publications for gene: TUBA4A were set to 28069311; 25374358; 26675813
Early-onset Dementia v1.23 TUBA4A Bryony Thompson edited their review of gene: TUBA4A: Changed phenotypes: Inherited neurodegenerative disorder MONDO:0024237, TUBA4A-related
Early-onset Dementia v1.23 TUBA4A Bryony Thompson Classified gene: TUBA4A as Green List (high evidence)
Early-onset Dementia v1.23 TUBA4A Bryony Thompson Gene: tuba4a has been classified as Green List (High Evidence).
Early-onset Dementia v1.22 TUBA4A Bryony Thompson reviewed gene: TUBA4A: Rating: GREEN; Mode of pathogenicity: None; Publications: 25374358, 28069311, 35327632, 34169147, 38884572, 33760283; Phenotypes: amyotrophic lateral sclerosis type 22 MONDO:0014531; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v1.22 GBA Lauren Rogers reviewed gene: GBA: Rating: AMBER; Mode of pathogenicity: None; Publications: 36084847; Phenotypes: {Lewy body dementia, susceptibility to} (MIM# 127750); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v1.22 POLG Zornitza Stark Classified gene: POLG as Amber List (moderate evidence)
Early-onset Dementia v1.22 POLG Zornitza Stark Gene: polg has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.21 COL4A2 Zornitza Stark Classified gene: COL4A2 as Amber List (moderate evidence)
Early-onset Dementia v1.21 COL4A2 Zornitza Stark Gene: col4a2 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v1.20 TREX1 Bryony Thompson Marked gene: TREX1 as ready
Early-onset Dementia v1.20 TREX1 Bryony Thompson Gene: trex1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.20 TREX1 Bryony Thompson Classified gene: TREX1 as Green List (high evidence)
Early-onset Dementia v1.20 TREX1 Bryony Thompson Gene: trex1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.19 POLG Bryony Thompson Marked gene: POLG as ready
Early-onset Dementia v1.19 POLG Bryony Thompson Gene: polg has been classified as Red List (Low Evidence).
Early-onset Dementia v1.19 POLG Bryony Thompson Classified gene: POLG as Red List (low evidence)
Early-onset Dementia v1.19 POLG Bryony Thompson Gene: polg has been classified as Red List (Low Evidence).
Early-onset Dementia v1.18 COL4A2 Bryony Thompson Marked gene: COL4A2 as ready
Early-onset Dementia v1.18 COL4A2 Bryony Thompson Gene: col4a2 has been classified as Red List (Low Evidence).
Early-onset Dementia v1.18 COL4A2 Bryony Thompson Classified gene: COL4A2 as Red List (low evidence)
Early-onset Dementia v1.18 COL4A2 Bryony Thompson Gene: col4a2 has been classified as Red List (Low Evidence).
Early-onset Dementia v1.17 COL4A1 Bryony Thompson Marked gene: COL4A1 as ready
Early-onset Dementia v1.17 COL4A1 Bryony Thompson Gene: col4a1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.17 COL4A1 Bryony Thompson Classified gene: COL4A1 as Green List (high evidence)
Early-onset Dementia v1.17 COL4A1 Bryony Thompson Gene: col4a1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.16 GLA Zornitza Stark Marked gene: GLA as ready
Early-onset Dementia v1.16 GLA Zornitza Stark Gene: gla has been classified as Green List (High Evidence).
Early-onset Dementia v1.16 GLA Zornitza Stark Classified gene: GLA as Green List (high evidence)
Early-onset Dementia v1.16 GLA Zornitza Stark Gene: gla has been classified as Green List (High Evidence).
Early-onset Dementia v1.15 GLA Lynn Tan gene: GLA was added
gene: GLA was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: GLA was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GLA were set to 36927868; 38254927; 9213072; 23949010; 32510623
Phenotypes for gene: GLA were set to Fabry disease MONDO:0010526
Review for gene: GLA was set to GREEN
gene: GLA was marked as current diagnostic
Added comment: PMID 36927868 (2023)
Index patient with GLA T410A (α-Gal A activity 32%) developed dementia and died of stroke in her 70s

PMID: 9213072 (1997)
47M biochemically confirmed Fabry’s with predominant manifestation being a dementing illness

PMID: 23949010 (2014)
Systematic review on cognitive dysfunction in Fabry's disease: patients with Fabry disease may be impaired in: executive functioning assessed by two standardised tests, the Stroop test and the Trail Making test part B, information processing speed and attention. Five case studies documenting neuropsychological impairment also described.

PMID: 32510623
Prospective cohort study to describe cognitive function changes in Fabry's over a year. Eighty‐one patients were included of which 76 patients (94%) completed both assessments (age: 44 years, 34% men, 75% classical phenotype). Four patients (5.3%) showed reliable decrease in cognitive functioning, two women and one man with classical disease and one woman with non‐classical disease (age range: 19‐41 years). Changes were from excellent to good/average and from good to average. None had a history of stroke or extensive WMLs. Follow‐up CESD scores were similar in two patients (+0 and +1) and increased in two others (+6, +11).

PMID: 38254927 (2023)
"This vasculopathy, along with elevating the risk of cerebral ischemia and stroke, is likely the pathophysiological basis for cognitive impairments in FD patients. Nevertheless, there is currently insufficient evidence indicating a direct association between neuropsychological findings and alterations in morphology in the CNS of FD patients as determined by brain imaging techniques such as magnetic resonance imaging."
Sources: Literature
Early-onset Dementia v1.15 NOTCH3 Ain Roesley Mode of inheritance for gene: NOTCH3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Early-onset Dementia v1.14 NOTCH3 Ain Roesley reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Early-onset Dementia v1.14 COL4A2 Lynn Tan edited their review of gene: COL4A2: Added comment: PMID: 35699195
The frequency of cognitive features in COL4A2 was 27% [11/41 individuals from 22 pedigrees]. These 11 patients all had developmental delay.

PMID: 37272523
Ontario Neurodegenerative Disease Research Initiative (ONDRI) sample size 510: 8 patients with COL4A1/2 variants had Alzheimer's disease/mild cognitive impairment, 3 patients with COL4A1/2 variants had frontotemporal dementia

PMID: 36300346
UK Biobank cohort study (n = 454 756): 2 patients with COL4A1/2 variants had vascular dementia, 8 patients with COL4A1/2 variants had all-cause dementia

Dev delay vs early-onset dementia
PMID: 37272523 and PMID: 36300346 -combined cohort with both COL4A1 and COL4A2

Sources: Literature; Changed rating: AMBER
Early-onset Dementia v1.14 POLG Lynn Tan gene: POLG was added
gene: POLG was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: POLG were set to 15477547; 14694057; 16638794
Phenotypes for gene: POLG were set to Mitochondrial DNA depletion syndrome 4a MONDO:0008758
Review for gene: POLG was set to AMBER
gene: POLG was marked as current diagnostic
Added comment: PMID: 15477547
5 patients with "cognitive impairment" in their 30s-50s, one male "had mild cognitive decline in the fifth decade".

PMID: 14694057
Biallelic POLG A467T variants: The 18-year-old patient is the elder son of nonconsanguineous parents, aged 45 and 41 years. The clinical features of myoclonus, seizure, axonal sensory ataxic neuropathy, and hepatotoxicity induced by valproate and mild cognitive decline and cardiomyopathy were indicative of a multisystem disorder and suggestive of mitochondrial disease.

PMID: 16638794
We studied 26 patients belonging to 20 families with a disorder caused by biallelic mutations in the POLG gene. Mild cognitive abnormalities were clinically suspected in eight patients. In four a mild cognitive impairment was confirmed by neuropsychological examination.

Cognitive impairment -developmental delay/regression/ID in childhood vs dementia (and decline from a baseline) later in life
Sources: Literature
Early-onset Dementia v1.14 COL4A2 Lynn Tan gene: COL4A2 was added
gene: COL4A2 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: COL4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL4A2 were set to 35699195; 37272523; 36300346
Phenotypes for gene: COL4A2 were set to Familial porencephaly MONDO:0020496
Review for gene: COL4A2 was set to GREEN
gene: COL4A2 was marked as current diagnostic
Added comment: PMID: 35699195
The frequency of cognitive features in COL4A2 was 27% [11/41 individuals from 22 pedigrees]. Developmental delay was present in over 80% of individuals with COL4A1/2 with cognitive features.

PMID: 37272523
Ontario Neurodegenerative Disease Research Initiative (ONDRI) sample size 510: 8 patients with COL4A1/2 variants had Alzheimer's disease/mild cognitive impairment, 3 patients with COL4A1/2 variants had frontotemporal dementia

PMID: 36300346
UK Biobank cohort study (n = 454 756): 2 patients with COL4A1/2 variants had vascular dementia, 8 patients with COL4A1/2 variants had all-cause dementia
Sources: Literature
Early-onset Dementia v1.14 COL4A1 Lynn Tan gene: COL4A1 was added
gene: COL4A1 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: COL4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: COL4A1 were set to 35699195; 37272523; 36300346; 30413629
Phenotypes for gene: COL4A1 were set to Brain small vessel disease 1 with or without ocular anomalies MONDO:0008289; Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814
Review for gene: COL4A1 was set to GREEN
gene: COL4A1 was marked as current diagnostic
Added comment: PMID: 35699195
Systematic review: frequency of cognitive features in COL4A1 was 33% [128/390 individuals from 233 pedigrees]. Developmental delay was present in over 80% of individuals with COL4A1/2 with cognitive features.

PMID: 37272523
Ontario Neurodegenerative Disease Research Initiative (ONDRI) sample size 510: 8 patients with COL4A1/2 variants had Alzheimer's disease/mild cognitive impairment, 3 patients with COL4A1/2 variants had frontotemporal dementia

PMID: 36300346
UK Biobank cohort study (n = 454 756): 2 patients with COL4A1/2 variants had vascular dementia, 8 patients with COL4A1/2 variants had all-cause dementia

PMID: 30413629
Child with COL4A1 p. G601S variant: developmental delay, moderate cognitive impairment, autism, and normal neurologic examination. Focal-onset drug-resistant seizures started at 11 years of age.
3-year-old girl with de novo COL4A1 p.G1239R: Surgical delivery was performed because prenatal hydrocephalus was suspected. The child developed microcephaly, severe cognitive impairment, and drug-resistant epileptic spasms.
Sources: Literature
Early-onset Dementia v1.14 TREX1 Lynn Tan gene: TREX1 was added
gene: TREX1 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: TREX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TREX1 were set to 29380913; 35699195; 36586737; 35307828
Phenotypes for gene: TREX1 were set to Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations MONDO:0008641
Review for gene: TREX1 was set to GREEN
gene: TREX1 was marked as current diagnostic
Added comment: PMID: 35699195
Systematic review: frequency of cognitive features in TREX1 was 29% [36/123 individuals from 34 pedigrees]

PMID: 29380913
Symptoms for this disorder start in adulthood and frequently include rapid loss of vision, multifocal strokes and dementia.

PMID: 36586737
1. Female patient displayed the first symptoms at a very early-age, 57 years old, and originated from Serbia. She presented with mild cognitive impairment.
2. 53-year old Dutch patient who displayed presenile dementia
3. 39-year old Finnish patient presenting migrane without aura, severe and pervasive cognitive impairment

PMID: 35307828
First stroke at age 39, diagnosed with severe amyloid angiopathy, and he also started suffering from migraines without aura and was later diagnosed with cognitive impairment
Sources: Literature
Early-onset Dementia v1.14 VPS13C Bryony Thompson Marked gene: VPS13C as ready
Early-onset Dementia v1.14 VPS13C Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence).
Early-onset Dementia v1.14 VPS13C Bryony Thompson Classified gene: VPS13C as Green List (high evidence)
Early-onset Dementia v1.14 VPS13C Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence).
Early-onset Dementia v1.14 VPS13C Bryony Thompson Classified gene: VPS13C as Green List (high evidence)
Early-onset Dementia v1.14 VPS13C Bryony Thompson Gene: vps13c has been classified as Green List (High Evidence).
Early-onset Dementia v1.13 VPS13C Bryony Thompson gene: VPS13C was added
gene: VPS13C was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: VPS13C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: VPS13C were set to 33579389; 37330543; 34875562
Phenotypes for gene: VPS13C were set to autosomal recessive early-onset Parkinson disease 23 MONDO:0014796
Review for gene: VPS13C was set to GREEN
gene: VPS13C was marked as current diagnostic
Added comment: Multiple cases with biallelic variants and dementia with Lewy bodies have been reported.
Sources: Literature
Early-onset Dementia v1.12 CST3 Bryony Thompson Phenotypes for gene: CST3 were changed from Cerebral amyloid angiopathy MIM#105150 to Cerebral amyloid angiopathy MIM#105150; leukodystrophy MONDO:0019046
Early-onset Dementia v1.11 CST3 Bryony Thompson Publications for gene: CST3 were set to 22435454; 8866434; 2602413; 8108423
Early-onset Dementia v1.10 CST3 Bryony Thompson Classified gene: CST3 as Green List (high evidence)
Early-onset Dementia v1.10 CST3 Bryony Thompson Added comment: Comment on list classification: Cognitive decline is a feature of CST3-leukodystrophy
Early-onset Dementia v1.10 CST3 Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence).
Early-onset Dementia v1.9 CST3 Bryony Thompson edited their review of gene: CST3: Added comment: New gene-disease association: 16 patients from 8 leukodystrophy families carrying one of four different stop-gain or frameshift dominant variants in the C-terminal (in the NMD-exclusion zone) of the CST3 gene. Suggested mechanism of disease by rendering the protein more prone to aggregation. The clinical phenotype consists of recurrent episodes of hemiplegic migraine associated with transient unilateral focal deficits and slowly progressing motor symptoms and cognitive decline in mid-old adult ages. Clinical & radiological features differ from Cerebral Amyloid Angiopathy.; Changed publications: 22435454, 8866434, 2602413, 8108423, 38489591; Changed phenotypes: Cerebral amyloid angiopathy MIM#105150, leukodystrophy MONDO:0019046
Early-onset Dementia v1.9 APP Bryony Thompson Marked gene: APP as ready
Early-onset Dementia v1.9 APP Bryony Thompson Gene: app has been classified as Green List (High Evidence).
Early-onset Dementia v1.9 APP Bryony Thompson Mode of pathogenicity for gene: APP was changed from to Other
Early-onset Dementia v1.8 APP Bryony Thompson Publications for gene: APP were set to
Early-onset Dementia v1.7 APP Bryony Thompson Phenotypes for gene: APP were changed from to Alzheimer disease MONDO:0007088
Early-onset Dementia v1.6 APP Bryony Thompson Mode of inheritance for gene: APP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v1.5 CCNF Zornitza Stark edited their review of gene: CCNF: Changed rating: AMBER
Early-onset Dementia v1.5 CHMP2B Bryony Thompson Marked gene: CHMP2B as ready
Early-onset Dementia v1.5 CHMP2B Bryony Thompson Gene: chmp2b has been classified as Green List (High Evidence).
Early-onset Dementia v1.5 CHMP2B Bryony Thompson Phenotypes for gene: CHMP2B were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795; MONDO:0010936)
Early-onset Dementia v1.4 CHMP2B Bryony Thompson Publications for gene: CHMP2B were set to
Early-onset Dementia v1.3 CHMP2B Bryony Thompson Mode of pathogenicity for gene: CHMP2B was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Early-onset Dementia v1.2 CHMP2B Bryony Thompson Mode of pathogenicity for gene: CHMP2B was changed from to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Early-onset Dementia v1.1 CHMP2B Bryony Thompson Mode of inheritance for gene: CHMP2B was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v1.1 CHMP2B Bryony Thompson Mode of inheritance for gene: CHMP2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v1.0 Bryony Thompson promoted panel to version 1.0
Early-onset Dementia v0.221 NR4A2 Bryony Thompson Marked gene: NR4A2 as ready
Early-onset Dementia v0.221 NR4A2 Bryony Thompson Gene: nr4a2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.221 HTRA2 Bryony Thompson Marked gene: HTRA2 as ready
Early-onset Dementia v0.221 HTRA2 Bryony Thompson Gene: htra2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.221 TIA1 Bryony Thompson Marked gene: TIA1 as ready
Early-onset Dementia v0.221 TIA1 Bryony Thompson Gene: tia1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.221 TIA1 Bryony Thompson Classified gene: TIA1 as Amber List (moderate evidence)
Early-onset Dementia v0.221 TIA1 Bryony Thompson Gene: tia1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.220 TIA1 Bryony Thompson gene: TIA1 was added
gene: TIA1 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: TIA1 was set to Other
Publications for gene: TIA1 were set to 36861178; 29599744; 29457785
Phenotypes for gene: TIA1 were set to Multisystem proteinopathy
Review for gene: TIA1 was set to AMBER
Added comment: Digenic variants in SQSTM1 and TIA1 have been reported in multisystem proteinopathy which includes clinical combinations of inclusion body myopathy (IBM), neurodegeneration [motor neuron disorder (MND)/frontotemporal dementia (FTD)], and Paget disease of bone (PDB). FTD has reported in at least one individual with FTD as a feature of the phenotype.
Sources: Literature
Early-onset Dementia v0.219 HNRNPA1 Bryony Thompson Classified gene: HNRNPA1 as Amber List (moderate evidence)
Early-onset Dementia v0.219 HNRNPA1 Bryony Thompson Added comment: Comment on list classification: Included as an amber gene because the gene is associated with multisystem proteinopathy, which FTD can be a feature. No FTD has been reported in association with this gene.
Early-onset Dementia v0.219 HNRNPA1 Bryony Thompson Gene: hnrnpa1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.218 GCH1 Bryony Thompson Marked gene: GCH1 as ready
Early-onset Dementia v0.218 GCH1 Bryony Thompson Gene: gch1 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.218 FIG4 Bryony Thompson Marked gene: FIG4 as ready
Early-onset Dementia v0.218 FIG4 Bryony Thompson Gene: fig4 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.218 ANG Bryony Thompson Marked gene: ANG as ready
Early-onset Dementia v0.218 ANG Bryony Thompson Gene: ang has been classified as Red List (Low Evidence).
Early-onset Dementia v0.218 ALS2 Bryony Thompson Marked gene: ALS2 as ready
Early-onset Dementia v0.218 ALS2 Bryony Thompson Gene: als2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.218 SCA17 Bryony Thompson Classified STR: SCA17 as Green List (high evidence)
Early-onset Dementia v0.218 SCA17 Bryony Thompson Str: sca17 has been classified as Green List (High Evidence).
Early-onset Dementia v0.217 SCA17 Bryony Thompson Marked STR: SCA17 as ready
Early-onset Dementia v0.217 SCA17 Bryony Thompson Str: sca17 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.217 SCA17 Bryony Thompson STR: SCA17 was added
STR: SCA17 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA17 were set to 10484774; 20301611
Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: SCA17 was set to GREEN
STR: SCA17 was marked as clinically relevant
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Dementia is a feature of the condition
Sources: Expert list
Early-onset Dementia v0.216 XK Sangavi Sivagnanasundram Deleted their comment
Early-onset Dementia v0.216 XK Sangavi Sivagnanasundram edited their review of gene: XK: Added comment: McLeod Syndrome (MLS) is multisystem disorder with central nervous system (CNS), neuromuscular, cardiovascular, and hematologic manifestations in males.

Dementia is not a typical feature of MLS but cognitive impairment has been identified in multiple individuals with MLS.

PMID: 12899725
Reported in one individual with McLeod Syndrome (MLS) who developed mild dementia during disease progression (age of onset was later in life). Testing confirmed he has a complete deletion of exon 2.

PMID: 11761473
Approx 15 individuals identified with neurological impact to the central nervous system resulting in cognitive impairment.; Changed rating: GREEN; Changed publications: 12899725, 11761473
Early-onset Dementia v0.216 CCNF Bryony Thompson edited their review of gene: CCNF: Changed rating: AMBER
Early-onset Dementia v0.216 NHLRC1 Zornitza Stark Marked gene: NHLRC1 as ready
Early-onset Dementia v0.216 NHLRC1 Zornitza Stark Gene: nhlrc1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.216 NHLRC1 Zornitza Stark Phenotypes for gene: NHLRC1 were changed from to Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780
Early-onset Dementia v0.215 NHLRC1 Zornitza Stark Publications for gene: NHLRC1 were set to
Early-onset Dementia v0.214 NHLRC1 Zornitza Stark Mode of inheritance for gene: NHLRC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.213 NPC2 Zornitza Stark Marked gene: NPC2 as ready
Early-onset Dementia v0.213 NPC2 Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.213 NPC2 Zornitza Stark Phenotypes for gene: NPC2 were changed from to Niemann-pick disease, type C2 MIM#607625
Early-onset Dementia v0.212 NPC2 Zornitza Stark Publications for gene: NPC2 were set to
Early-onset Dementia v0.211 NPC2 Zornitza Stark Mode of inheritance for gene: NPC2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.210 OPTN Zornitza Stark Marked gene: OPTN as ready
Early-onset Dementia v0.210 OPTN Zornitza Stark Gene: optn has been classified as Green List (High Evidence).
Early-onset Dementia v0.210 OPTN Zornitza Stark Phenotypes for gene: OPTN were changed from to Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435)
Early-onset Dementia v0.209 OPTN Zornitza Stark Publications for gene: OPTN were set to
Early-onset Dementia v0.208 OPTN Zornitza Stark Mode of inheritance for gene: OPTN was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.207 PANK2 Zornitza Stark Marked gene: PANK2 as ready
Early-onset Dementia v0.207 PANK2 Zornitza Stark Gene: pank2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.207 PANK2 Zornitza Stark Phenotypes for gene: PANK2 were changed from to Neurodegeneration with brain iron accumulation 1 (MIM#234200)
Early-onset Dementia v0.206 PANK2 Zornitza Stark Publications for gene: PANK2 were set to
Early-onset Dementia v0.205 PANK2 Zornitza Stark Mode of inheritance for gene: PANK2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.204 PRNP Zornitza Stark Marked gene: PRNP as ready
Early-onset Dementia v0.204 PRNP Zornitza Stark Gene: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.204 PRNP Zornitza Stark Phenotypes for gene: PRNP were changed from to Prion Disease (MIM#176640); Creutzfeldt-Jakob disease (MIM#123400)
Early-onset Dementia v0.203 PRNP Zornitza Stark Publications for gene: PRNP were set to
Early-onset Dementia v0.202 PRNP Zornitza Stark Mode of inheritance for gene: PRNP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.201 PSEN1 Zornitza Stark Marked gene: PSEN1 as ready
Early-onset Dementia v0.201 PSEN1 Zornitza Stark Gene: psen1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.201 PSEN1 Zornitza Stark Phenotypes for gene: PSEN1 were changed from to Alzheimer disease, type 3 (MIM#607822; MONDO:0011913)
Early-onset Dementia v0.200 PSEN1 Zornitza Stark Publications for gene: PSEN1 were set to
Early-onset Dementia v0.199 PSEN1 Zornitza Stark Mode of inheritance for gene: PSEN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.198 PSEN2 Zornitza Stark Marked gene: PSEN2 as ready
Early-onset Dementia v0.198 PSEN2 Zornitza Stark Gene: psen2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.198 PSEN2 Zornitza Stark Phenotypes for gene: PSEN2 were changed from to Alzheimer disease-4 (MIM#606889)
Early-onset Dementia v0.197 PSEN2 Zornitza Stark Publications for gene: PSEN2 were set to
Early-onset Dementia v0.196 PSEN2 Zornitza Stark Mode of inheritance for gene: PSEN2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.195 SQSTM1 Zornitza Stark Marked gene: SQSTM1 as ready
Early-onset Dementia v0.195 SQSTM1 Zornitza Stark Gene: sqstm1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.195 SQSTM1 Zornitza Stark Phenotypes for gene: SQSTM1 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437)
Early-onset Dementia v0.194 SQSTM1 Zornitza Stark Publications for gene: SQSTM1 were set to
Early-onset Dementia v0.193 SQSTM1 Zornitza Stark Mode of inheritance for gene: SQSTM1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.192 SQSTM1 Zornitza Stark Classified gene: SQSTM1 as Amber List (moderate evidence)
Early-onset Dementia v0.192 SQSTM1 Zornitza Stark Gene: sqstm1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.191 TARDBP Zornitza Stark Marked gene: TARDBP as ready
Early-onset Dementia v0.191 TARDBP Zornitza Stark Gene: tardbp has been classified as Green List (High Evidence).
Early-onset Dementia v0.191 TARDBP Zornitza Stark Phenotypes for gene: TARDBP were changed from to Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069)
Early-onset Dementia v0.190 TARDBP Zornitza Stark Publications for gene: TARDBP were set to
Early-onset Dementia v0.189 TARDBP Zornitza Stark Mode of inheritance for gene: TARDBP was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.188 TBK1 Zornitza Stark Marked gene: TBK1 as ready
Early-onset Dementia v0.188 TBK1 Zornitza Stark Gene: tbk1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.188 TBK1 Zornitza Stark Phenotypes for gene: TBK1 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439
Early-onset Dementia v0.187 TBK1 Zornitza Stark Publications for gene: TBK1 were set to
Early-onset Dementia v0.186 TBK1 Zornitza Stark Mode of inheritance for gene: TBK1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.185 TYROBP Zornitza Stark Marked gene: TYROBP as ready
Early-onset Dementia v0.185 TYROBP Zornitza Stark Gene: tyrobp has been classified as Green List (High Evidence).
Early-onset Dementia v0.185 TYROBP Zornitza Stark Phenotypes for gene: TYROBP were changed from to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770)
Early-onset Dementia v0.184 TYROBP Zornitza Stark Publications for gene: TYROBP were set to
Early-onset Dementia v0.183 TYROBP Zornitza Stark Mode of inheritance for gene: TYROBP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.182 PLA2G6 Zornitza Stark Marked gene: PLA2G6 as ready
Early-onset Dementia v0.182 PLA2G6 Zornitza Stark Gene: pla2g6 has been classified as Green List (High Evidence).
Early-onset Dementia v0.182 PLA2G6 Zornitza Stark Phenotypes for gene: PLA2G6 were changed from to Parkinson disease 14, autosomal recessive, MIM# 612953
Early-onset Dementia v0.181 PLA2G6 Zornitza Stark Publications for gene: PLA2G6 were set to
Early-onset Dementia v0.180 PLA2G6 Zornitza Stark Mode of inheritance for gene: PLA2G6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.179 PLA2G6 Sangavi Sivagnanasundram reviewed gene: PLA2G6: Rating: AMBER; Mode of pathogenicity: None; Publications: 25634434, 26836416, 22406380, 20938027; Phenotypes: Parkinson disease 14, autosomal recessive 612953; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.179 TYROBP Sangavi Sivagnanasundram reviewed gene: TYROBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301376; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.179 TBK1 Sangavi Sivagnanasundram reviewed gene: TBK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301623; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 4 616439; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.179 TARDBP Sangavi Sivagnanasundram reviewed gene: TARDBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301761, 21803454; Phenotypes: Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.179 SQSTM1 Sangavi Sivagnanasundram reviewed gene: SQSTM1: Rating: AMBER; Mode of pathogenicity: None; Publications: 22084127, 22972638; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.179 PSEN2 Sangavi Sivagnanasundram reviewed gene: PSEN2: Rating: GREEN; Mode of pathogenicity: Other; Publications: 22503161, 20301340, 25323700, 35491795; Phenotypes: Alzheimer disease-4 (MIM#606889); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.179 PSEN1 Sangavi Sivagnanasundram reviewed gene: PSEN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22503161, 20301340; Phenotypes: Alzheimer disease, type 3 (MIM#607822, MONDO:0011913); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.179 PRNP Sangavi Sivagnanasundram reviewed gene: PRNP: Rating: GREEN; Mode of pathogenicity: None; Publications: 27910931, 19571725, 20301407, 6351815; Phenotypes: Prion Disease (MIM#176640), Creutzfeldt-Jakob disease (MIM#123400); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.179 PANK2 Sangavi Sivagnanasundram reviewed gene: PANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 24600523, 23447832, 19480328; Phenotypes: Neurodegeneration with brain iron accumulation 1 (MIM#234200); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.179 OPTN Sangavi Sivagnanasundram reviewed gene: OPTN: Rating: GREEN; Mode of pathogenicity: None; Publications: 31838784, 20428114, 20301623; Phenotypes: Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.179 NPC2 Sangavi Sivagnanasundram reviewed gene: NPC2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27792009, 20525256; Phenotypes: Niemann-pick disease, type C2 MIM#607625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.179 NPC1 Sangavi Sivagnanasundram edited their review of gene: NPC1: Changed rating: AMBER
Early-onset Dementia v0.179 NPC1 Sangavi Sivagnanasundram changed review comment from: NPC is a slowly progressive lysosomal disorder with subtle cognitive impairment in affected individuals at first which progresses to dementia during the disease course. LoF is the mechanism of disease.

PMID: 11182931
reported in one individual with NPC and dementia as a phenotype.; to: NPC is a slowly progressive lysosomal disorder with subtle cognitive impairment in affected individuals at first which progresses to dementia during the disease course. NPC type 1 is also known as "juvenile alzheimers disease". LoF is the mechanism of disease.

PMID: 11182931
reported in one individual with NPC and dementia as a phenotype.
Early-onset Dementia v0.179 NPC1 Sangavi Sivagnanasundram edited their review of gene: NPC1: Changed rating: GREEN; Changed publications: 20301473, 11182931, 22495346
Early-onset Dementia v0.179 NHLRC1 Sangavi Sivagnanasundram reviewed gene: NHLRC1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28556688, 34117373; Phenotypes: Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.179 NPC1 Zornitza Stark Marked gene: NPC1 as ready
Early-onset Dementia v0.179 NPC1 Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.179 NPC1 Zornitza Stark Phenotypes for gene: NPC1 were changed from to Niemann-Pick disease, type C1 (MIM#257220; MONDO:0009757)
Early-onset Dementia v0.178 NPC1 Zornitza Stark Publications for gene: NPC1 were set to
Early-onset Dementia v0.177 NPC1 Zornitza Stark Mode of inheritance for gene: NPC1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.176 UBQLN2 Zornitza Stark Phenotypes for gene: UBQLN2 were changed from Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) to Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857)
Early-onset Dementia v0.175 UBQLN2 Zornitza Stark Marked gene: UBQLN2 as ready
Early-onset Dementia v0.175 UBQLN2 Zornitza Stark Gene: ubqln2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.175 UBQLN2 Zornitza Stark Phenotypes for gene: UBQLN2 were changed from to Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857)
Early-onset Dementia v0.174 UBQLN2 Zornitza Stark Publications for gene: UBQLN2 were set to
Early-onset Dementia v0.173 UBQLN2 Zornitza Stark Mode of inheritance for gene: UBQLN2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Dementia v0.172 VCP Zornitza Stark Marked gene: VCP as ready
Early-onset Dementia v0.172 VCP Zornitza Stark Gene: vcp has been classified as Green List (High Evidence).
Early-onset Dementia v0.172 VCP Zornitza Stark Phenotypes for gene: VCP were changed from to Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320); Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954)
Early-onset Dementia v0.171 VCP Zornitza Stark Publications for gene: VCP were set to
Early-onset Dementia v0.170 VCP Zornitza Stark Mode of inheritance for gene: VCP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.169 XK Zornitza Stark Marked gene: XK as ready
Early-onset Dementia v0.169 XK Zornitza Stark Gene: xk has been classified as Green List (High Evidence).
Early-onset Dementia v0.169 XK Zornitza Stark Phenotypes for gene: XK were changed from to McLeod syndrome with or without chronic granulomatous disease (MIM#300842)
Early-onset Dementia v0.168 XK Zornitza Stark Publications for gene: XK were set to
Early-onset Dementia v0.167 XK Zornitza Stark Mode of inheritance for gene: XK was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Early-onset Dementia v0.166 XK Zornitza Stark reviewed gene: XK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: McLeod syndrome with or without chronic granulomatous disease (MIM#300842); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Dementia v0.166 GRN Zornitza Stark Marked gene: GRN as ready
Early-onset Dementia v0.166 GRN Zornitza Stark Gene: grn has been classified as Green List (High Evidence).
Early-onset Dementia v0.166 GRN Zornitza Stark Phenotypes for gene: GRN were changed from to frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923
Early-onset Dementia v0.165 GRN Zornitza Stark Publications for gene: GRN were set to
Early-onset Dementia v0.164 GRN Zornitza Stark Mode of inheritance for gene: GRN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.163 EPM2A Zornitza Stark Marked gene: EPM2A as ready
Early-onset Dementia v0.163 EPM2A Zornitza Stark Gene: epm2a has been classified as Green List (High Evidence).
Early-onset Dementia v0.163 EPM2A Zornitza Stark Phenotypes for gene: EPM2A were changed from to Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780
Early-onset Dementia v0.162 EPM2A Zornitza Stark Publications for gene: EPM2A were set to
Early-onset Dementia v0.161 EPM2A Zornitza Stark Mode of inheritance for gene: EPM2A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.160 NPC1 Sangavi Sivagnanasundram reviewed gene: NPC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 20301473, 11182931; Phenotypes: Niemann-Pick disease, type C1 (MIM#257220, MONDO:0009757); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.160 UBQLN2 Sangavi Sivagnanasundram reviewed gene: UBQLN2: Rating: AMBER; Mode of pathogenicity: None; Publications: 20301623, 31319884, 21857683, 30348461; Phenotypes: Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857); Mode of inheritance: None
Early-onset Dementia v0.160 VCP Sangavi Sivagnanasundram reviewed gene: VCP: Rating: GREEN; Mode of pathogenicity: None; Publications: 15034582, 30103325, 21145000; Phenotypes: Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320), Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.160 XK Sangavi Sivagnanasundram reviewed gene: XK: Rating: RED; Mode of pathogenicity: None; Publications: 12899725; Phenotypes: McLeod syndrome with or without chronic granulomatous disease (MIM#300842); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Early-onset Dementia v0.160 GRN Sangavi Sivagnanasundram reviewed gene: GRN: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301545, 17436289; Phenotypes: frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.160 EPM2A Sangavi Sivagnanasundram reviewed gene: EPM2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 12019207; Phenotypes: Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.160 DNMT1 Sangavi Sivagnanasundram reviewed gene: DNMT1: Rating: AMBER; Mode of pathogenicity: None; Publications: 21532572; Phenotypes: Neuropathy, hereditary sensory, type IE (MIM#614116); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.160 DNAJC5 Sangavi Sivagnanasundram reviewed gene: DNAJC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 6153706, 11489285, 12112194, 12790899; Phenotypes: Ceroid lipofuscinosis, neuronal, 4 (Kufs type), autosomal dominant (MIM#162350); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.160 CSF1R Sangavi Sivagnanasundram reviewed gene: CSF1R: Rating: GREEN; Mode of pathogenicity: Other; Publications: 22934315, 24336230; Phenotypes: Leukoencephalopathy, diffuse hereditary, with spheroids 1 (MIM#221820); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.160 CHMP2B Sangavi Sivagnanasundram reviewed gene: CHMP2B: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 20301378, 16041373; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.160 APP Sangavi Sivagnanasundram reviewed gene: APP: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301340, 1671712, 1678058, 1908231, 1302033; Phenotypes: Alzheimer disease (MIM#104300, MONDO:0007088); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.160 CCNF Bryony Thompson Classified gene: CCNF as Amber List (moderate evidence)
Early-onset Dementia v0.160 CCNF Bryony Thompson Added comment: Comment on list classification: Limited gene-disease validity assessment by ClinGen ALS spectrum disorders GCEP - 05/04/2022
Early-onset Dementia v0.160 CCNF Bryony Thompson Gene: ccnf has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.159 Zornitza Stark HPO terms changed from to Cognitive impairment, HP:0100543
List of related panels changed from to Cognitive impairment; HP:0100543
Early-onset Dementia v0.158 ITM2B Bryony Thompson Marked gene: ITM2B as ready
Early-onset Dementia v0.158 ITM2B Bryony Thompson Gene: itm2b has been classified as Green List (High Evidence).
Early-onset Dementia v0.158 ITM2B Bryony Thompson Phenotypes for gene: ITM2B were changed from to Cerebral amyloid angiopathy MONDO:0005620
Early-onset Dementia v0.157 ITM2B Bryony Thompson Publications for gene: ITM2B were set to
Early-onset Dementia v0.156 ITM2B Bryony Thompson Mode of inheritance for gene: ITM2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.155 ITM2B Bryony Thompson reviewed gene: ITM2B: Rating: GREEN; Mode of pathogenicity: Other; Publications: 10391242, 10781099, 20385796, 33814452; Phenotypes: Cerebral amyloid angiopathy MONDO:0005620; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Early-onset Dementia v0.155 APOE Zornitza Stark Classified gene: APOE as Amber List (moderate evidence)
Early-onset Dementia v0.155 APOE Zornitza Stark Gene: apoe has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.154 APOE Zornitza Stark changed review comment from: E4 allele association with late-onset AD.; to: E4 allele association with late-onset AD. Susceptibility allele.
Early-onset Dementia v0.154 APOE Zornitza Stark edited their review of gene: APOE: Changed rating: AMBER
Early-onset Dementia v0.154 APOE Elena Savva reviewed gene: APOE: Rating: AMBER; Mode of pathogenicity: Other; Publications: PMID: 33679311; Phenotypes: Alzheimer disease 2 MIM#104310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.154 CLN6 Bryony Thompson Marked gene: CLN6 as ready
Early-onset Dementia v0.154 CLN6 Bryony Thompson Gene: cln6 has been classified as Green List (High Evidence).
Early-onset Dementia v0.154 CLN6 Bryony Thompson Classified gene: CLN6 as Green List (high evidence)
Early-onset Dementia v0.154 CLN6 Bryony Thompson Gene: cln6 has been classified as Green List (High Evidence).
Early-onset Dementia v0.153 PPIA Seb Lunke Marked gene: PPIA as ready
Early-onset Dementia v0.153 PPIA Seb Lunke Gene: ppia has been classified as Red List (Low Evidence).
Early-onset Dementia v0.153 PPIA Seb Lunke Phenotypes for gene: PPIA were changed from amyotrophic lateral sclerosis, MONDO:0004976 to amyotrophic lateral sclerosis, MONDO:0004976, PPIA-associated
Early-onset Dementia v0.152 PPIA Seb Lunke gene: PPIA was added
gene: PPIA was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: PPIA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: PPIA were set to 34972208
Phenotypes for gene: PPIA were set to amyotrophic lateral sclerosis, MONDO:0004976
Review for gene: PPIA was set to RED
Added comment: Sources: Literature
Early-onset Dementia v0.151 MATR3 Bryony Thompson Marked gene: MATR3 as ready
Early-onset Dementia v0.151 MATR3 Bryony Thompson Gene: matr3 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.151 MATR3 Bryony Thompson Phenotypes for gene: MATR3 were changed from Amyotrophic lateral sclerosis 21 MIM#606070 to Amyotrophic lateral sclerosis 21 MIM#606070; frontotemporal dementia; multisystem proteinopathy
Early-onset Dementia v0.150 MATR3 Bryony Thompson Publications for gene: MATR3 were set to
Early-onset Dementia v0.149 MATR3 Bryony Thompson Mode of inheritance for gene: MATR3 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.148 MATR3 Bryony Thompson edited their review of gene: MATR3: Changed phenotypes: Amyotrophic lateral sclerosis 21 MIM#606070, frontotemporal dementia, multisystem proteinopathy; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.148 MATR3 Bryony Thompson changed review comment from: One family with ALS-FTD has been reported so far. A rat primary neuron model showed neurons were bidirectionally vulnerable to MATR3 levels, with pathogenic MATR3 mutants displaying enhanced toxicity.; to: Two cases/families with ALS-FTD has been reported with missense variants. An early-onset bvFTD case has been reported with a MATR3 variant 5 retrotransposition of uncertain significance. A rat primary neuron model showed neurons were bidirectionally vulnerable to MATR3 levels, with pathogenic MATR3 mutants displaying enhanced toxicity.
Early-onset Dementia v0.148 MATR3 Bryony Thompson edited their review of gene: MATR3: Changed publications: 24686783, 30015619, 28029397, 33408686; Changed phenotypes: Amyotrophic lateral sclerosis 21 MIM#606070, frontotemporal dementia
Early-onset Dementia v0.148 CJD Bryony Thompson Marked STR: CJD as ready
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.148 CJD Bryony Thompson Classified STR: CJD as Green List (high evidence)
Early-onset Dementia v0.148 CJD Bryony Thompson Str: cjd has been classified as Green List (High Evidence).
Early-onset Dementia v0.147 CJD Bryony Thompson STR: CJD was added
STR: CJD was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CJD were set to 2159587; 20301407
Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: CJD was set to GREEN
STR: CJD was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Early-onset Dementia v0.146 Bryony Thompson removed STR:PRNP from the panel
Early-onset Dementia v0.145 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.145 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.144 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102; 34333668
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 4-40, 1 control had 61 repeats and may have been a presymptomatic carrier.
Intermediate range: 41-60 identified in Parkinson's disease
Pathogenic repeat range: >=60-520
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.143 Bryony Thompson removed STR:NIID from the panel
Early-onset Dementia v0.142 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.142 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.142 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.141 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Oculopharyngodistal myopathy 3 MIM#619473; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[X]
Expanded repeat in NOTCH2NLC sequence is (GGC)9(GGA)2(GGC)2.
Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease.
Normal repeat range: 7-60
Pathogenic repeat range: >=61-500
Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.140 Bryony Thompson removed STR:NIID from the panel
Early-onset Dementia v0.139 FTDALS Bryony Thompson Marked STR: FTDALS as ready
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Dementia v0.139 FTDALS Bryony Thompson Classified STR: FTDALS as Green List (high evidence)
Early-onset Dementia v0.139 FTDALS Bryony Thompson Str: ftdals has been classified as Green List (High Evidence).
Early-onset Dementia v0.138 FTDALS Bryony Thompson STR: FTDALS was added
STR: FTDALS was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for STR: FTDALS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FTDALS were set to 25577942; 21944779; 21944778
Phenotypes for STR: FTDALS were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: FTDALS was set to GREEN
STR: FTDALS was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.137 Bryony Thompson removed STR:C9orf72 from the panel
Early-onset Dementia v0.136 NIID Bryony Thompson Marked STR: NIID as ready
Early-onset Dementia v0.136 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.136 NIID Bryony Thompson Classified STR: NIID as Green List (high evidence)
Early-onset Dementia v0.136 NIID Bryony Thompson Str: niid has been classified as Green List (High Evidence).
Early-onset Dementia v0.135 NIID Bryony Thompson STR: NIID was added
STR: NIID was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for STR: NIID was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NIID were set to 31178126; 31332381; 31819945; 33887199; 33943039; 32250060; 31332380; 32852534; 32989102
Phenotypes for STR: NIID were set to Neuronal intranuclear inclusion disease MIM#603472; Tremor, hereditary essential, 6 MIM#618866
Review for STR: NIID was set to GREEN
STR: NIID was marked as clinically relevant
Added comment: NM_001364012.2:c.-164GGC[(66_517)] Large number of families and sporadic cases reported with expansions, with a range of neurodegenerative phenotypes, including: dementia, Parkinsonism/tremor, peripheral neuropathy, leukoencephalopathy, myopathy, motor neurone disease. Normal repeat range: 7-60 Pathogenic repeat range: >=61-500 Mechanism of disease is translation of repeat expansion into a toxic polyglycine protein, identified in both mouse models and tissue samples from affected individuals.
Sources: Literature
Early-onset Dementia v0.134 CST3 Zornitza Stark Classified gene: CST3 as Amber List (moderate evidence)
Early-onset Dementia v0.134 CST3 Zornitza Stark Gene: cst3 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.133 CST3 Zornitza Stark Tag founder tag was added to gene: CST3.
Early-onset Dementia v0.133 CST3 Zornitza Stark reviewed gene: CST3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.133 CLN6 Bryony Thompson gene: CLN6 was added
gene: CLN6 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: CLN6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CLN6 were set to 30561534
Phenotypes for gene: CLN6 were set to Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300
Review for gene: CLN6 was set to GREEN
gene: CLN6 was marked as current diagnostic
Added comment: Dementia or cognitive decline was a feature of the condition in 15/20 cases from 13 unrelated families with Kufs type ceroid lipofuscinosis caused by biallelic CLN6 variants. In some cases, this was the initial presenting feature of the condition.
Sources: Literature
Early-onset Dementia v0.132 CCNF Zornitza Stark Phenotypes for gene: CCNF were changed from amyotrophic lateral sclerosis with/without frontotemporal dementia to Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141
Early-onset Dementia v0.131 CCNF Zornitza Stark reviewed gene: CCNF: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141; Mode of inheritance: None
Early-onset Dementia v0.131 CYLD Zornitza Stark Phenotypes for gene: CYLD were changed from Frontotemporal dementia; Amyotrophic lateral sclerosis to Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132
Early-onset Dementia v0.130 CYLD Zornitza Stark edited their review of gene: CYLD: Changed phenotypes: Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132
Early-onset Dementia v0.130 ATP7B Bryony Thompson edited their review of gene: ATP7B: Changed publications: 26758278, 25988284
Early-onset Dementia v0.130 SNCA Zornitza Stark Marked gene: SNCA as ready
Early-onset Dementia v0.130 SNCA Zornitza Stark Gene: snca has been classified as Green List (High Evidence).
Early-onset Dementia v0.130 SNCA Zornitza Stark Phenotypes for gene: SNCA were changed from to Dementia, Lewy body (MIM#127750); Parkinson disease 1 (MIM#168601); Parkinson disease 4 (MIM#605543)
Early-onset Dementia v0.129 SNCA Zornitza Stark Publications for gene: SNCA were set to
Early-onset Dementia v0.128 SNCA Zornitza Stark Mode of inheritance for gene: SNCA was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.127 SNCA Zornitza Stark reviewed gene: SNCA: Rating: GREEN; Mode of pathogenicity: None; Publications: 32849182, 26858591, 32740728; Phenotypes: Dementia, Lewy body (MIM#127750), Parkinson disease 1 (MIM#168601), Parkinson disease 4 (MIM#605543); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.127 STUB1 Bryony Thompson Classified gene: STUB1 as Green List (high evidence)
Early-onset Dementia v0.127 STUB1 Bryony Thompson Gene: stub1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.126 STUB1 Bryony Thompson edited their review of gene: STUB1: Changed phenotypes: Spinocerebellar ataxia 48 MIM#618093, cognitive impairment, Spinocerebellar ataxia, autosomal recessive 16 MIM#615768; Set current diagnostic: yes
Early-onset Dementia v0.126 STUB1 Bryony Thompson gene: STUB1 was added
gene: STUB1 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: STUB1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: STUB1 were set to 32713943
Phenotypes for gene: STUB1 were set to Spinocerebellar ataxia 48 MIM#618093; cognitive impairment; Spinocerebellar ataxia, autosomal recessive 16 MIM#615768
Review for gene: STUB1 was set to GREEN
Added comment: Cognitive impairment can be a feature of conditions caused by this gene. Cognitive impairment, mostly dysexecutive, was observed and sometimes predominant in 54% (26/48) of cases with dominant (mainly) or recessive ataxia and pathogenic variants in STUB1. No STUB1 variants were found in 115 patients with FTD.
Sources: Expert list
Early-onset Dementia v0.125 C9orf72 Bryony Thompson Classified gene: C9orf72 as No list
Early-onset Dementia v0.125 C9orf72 Bryony Thompson Gene: c9orf72 has been removed from the panel.
Early-onset Dementia v0.124 ATN1 Bryony Thompson Classified gene: ATN1 as No list
Early-onset Dementia v0.124 ATN1 Bryony Thompson Gene: atn1 has been removed from the panel.
Early-onset Dementia v0.123 DRPLA Bryony Thompson Marked STR: DRPLA as ready
Early-onset Dementia v0.123 DRPLA Bryony Thompson Str: drpla has been classified as Green List (High Evidence).
Early-onset Dementia v0.123 DRPLA Bryony Thompson Classified STR: DRPLA as Green List (high evidence)
Early-onset Dementia v0.123 DRPLA Bryony Thompson Str: drpla has been classified as Green List (High Evidence).
Early-onset Dementia v0.122 DRPLA Bryony Thompson STR: DRPLA was added
STR: DRPLA was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: DRPLA.
Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DRPLA were set to 29325606; 20301664
Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Review for STR: DRPLA was set to GREEN
STR: DRPLA was marked as clinically relevant
Added comment: NM_001007026​.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance
Sources: Expert list
Early-onset Dementia v0.121 TUBA4A Zornitza Stark Marked gene: TUBA4A as ready
Early-onset Dementia v0.121 TUBA4A Zornitza Stark Gene: tuba4a has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.121 TUBA4A Zornitza Stark Phenotypes for gene: TUBA4A were changed from to Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208
Early-onset Dementia v0.120 TUBA4A Zornitza Stark Publications for gene: TUBA4A were set to
Early-onset Dementia v0.119 TUBA4A Zornitza Stark Mode of inheritance for gene: TUBA4A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.118 TUBA4A Zornitza Stark Classified gene: TUBA4A as Amber List (moderate evidence)
Early-onset Dementia v0.118 TUBA4A Zornitza Stark Gene: tuba4a has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.117 TUBA4A Zornitza Stark reviewed gene: TUBA4A: Rating: AMBER; Mode of pathogenicity: None; Publications: 28069311, 25374358, 26675813; Phenotypes: Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.117 CHCHD10 Zornitza Stark Publications for gene: CHCHD10 were set to 24934289; 31690696; 30877432; 32369233
Early-onset Dementia v0.116 CHCHD10 Zornitza Stark changed review comment from: CHCHD10 is a small protein of the mitochondrial intermembrane space that is enriched at cristae junctions. It is predicted to be involved in oxidative phosphorylation or in maintenance of cristae morphology. Variants have been associated with a broad spectrum of neurological/neuromuscular phenotypes. Several large multiplex families described segregating different neurological disorders, ranging from dementia, to SMA, to myopathy. GOF mechanism has been proposed for FTD/ALS association based on a mouse model.

Two families reported with p.Ser59Leu variant and predominantly a dementia phenotype. Variant segregated with disease in 8 family members in one of the families. No variants in this gene identified in an Australian cohort study, PMID 31690696; however, good functional data including from mouse model supports gene-disease association.; to: CHCHD10 is a small protein of the mitochondrial intermembrane space that is enriched at cristae junctions. It is predicted to be involved in oxidative phosphorylation or in maintenance of cristae morphology. Variants have been associated with a broad spectrum of neurological/neuromuscular phenotypes. Several large multiplex families described segregating different neurological disorders, ranging from dementia, to SMA, to myopathy. GOF mechanism has been proposed for FTD/ALS association based on a mouse model.

Two families reported with p.Ser59Leu variant, and one with a truncating variant and predominantly a dementia phenotype. Variant segregated with disease in 8 family members in one of the families. No variants in this gene identified in an Australian cohort study, PMID 31690696; however, good functional data including from mouse model supports gene-disease association.
Early-onset Dementia v0.116 CHCHD10 Zornitza Stark edited their review of gene: CHCHD10: Changed publications: 24934289, 31690696, 30877432, 32369233, 28069311
Early-onset Dementia v0.116 TTR Zornitza Stark Marked gene: TTR as ready
Early-onset Dementia v0.116 TTR Zornitza Stark Gene: ttr has been classified as Green List (High Evidence).
Early-onset Dementia v0.116 TTR Zornitza Stark Phenotypes for gene: TTR were changed from to Amyloidosis, hereditary, transthyretin-related, MIM# 105210
Early-onset Dementia v0.115 TTR Zornitza Stark Publications for gene: TTR were set to
Early-onset Dementia v0.114 TTR Zornitza Stark Mode of inheritance for gene: TTR was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.113 TTR Zornitza Stark reviewed gene: TTR: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301373; Phenotypes: Amyloidosis, hereditary, transthyretin-related, MIM# 105210; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.113 TREM2 Zornitza Stark Marked gene: TREM2 as ready
Early-onset Dementia v0.113 TREM2 Zornitza Stark Gene: trem2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.113 TREM2 Zornitza Stark Phenotypes for gene: TREM2 were changed from to Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193
Early-onset Dementia v0.112 TREM2 Zornitza Stark Publications for gene: TREM2 were set to
Early-onset Dementia v0.111 TREM2 Zornitza Stark Mode of inheritance for gene: TREM2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.110 TREM2 Zornitza Stark reviewed gene: TREM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 12080485, 15883308; Phenotypes: Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.110 SPG21 Zornitza Stark changed review comment from: Mast syndrome is an autosomal recessive complicated form of hereditary spastic paraplegia in which progressive spastic paraparesis is associated in more advanced cases with cognitive decline, dementia, and other neurologic abnormalities. Symptom onset usually occurs in adulthood, and the disorder is progressive with variable severity. Brain imaging shows thinning of the corpus callosum. The disorder occurs with high frequency in the Old Order Amish. Founder variant in Amish, two additional families and a mouse model.; to: Mast syndrome is an autosomal recessive complicated form of hereditary spastic paraplegia in which progressive spastic paraparesis is associated in more advanced cases with cognitive decline, dementia, and other neurologic abnormalities. Symptom onset usually occurs in adulthood, and the disorder is progressive with variable severity. Brain imaging shows thinning of the corpus callosum. The disorder occurs with high frequency in the Old Order Amish. Founder variant in Amish, two additional families and a mouse model.

New HGNC approved gene name is ACP33
Early-onset Dementia v0.110 SPG21 Zornitza Stark Tag new gene name tag was added to gene: SPG21.
Early-onset Dementia v0.110 SPG21 Zornitza Stark Marked gene: SPG21 as ready
Early-onset Dementia v0.110 SPG21 Zornitza Stark Gene: spg21 has been classified as Green List (High Evidence).
Early-onset Dementia v0.110 SPG21 Zornitza Stark Phenotypes for gene: SPG21 were changed from to Mast syndrome, MIM# 248900
Early-onset Dementia v0.109 SPG21 Zornitza Stark Publications for gene: SPG21 were set to
Early-onset Dementia v0.108 SPG21 Zornitza Stark Mode of inheritance for gene: SPG21 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.107 SPG21 Zornitza Stark edited their review of gene: SPG21: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.107 SPG21 Zornitza Stark edited their review of gene: SPG21: Changed rating: GREEN
Early-onset Dementia v0.107 SPG21 Zornitza Stark reviewed gene: SPG21: Rating: ; Mode of pathogenicity: None; Publications: 14564668, 24451228, 28752238, 26978163; Phenotypes: Mast syndrome, MIM# 248900; Mode of inheritance: None
Early-onset Dementia v0.107 SNCB Zornitza Stark Tag disputed tag was added to gene: SNCB.
Early-onset Dementia v0.107 SNCB Zornitza Stark Marked gene: SNCB as ready
Early-onset Dementia v0.107 SNCB Zornitza Stark Gene: sncb has been classified as Red List (Low Evidence).
Early-onset Dementia v0.107 SNCB Zornitza Stark Phenotypes for gene: SNCB were changed from to Dementia, Lewy body, MIM#127750
Early-onset Dementia v0.106 SNCB Zornitza Stark Publications for gene: SNCB were set to
Early-onset Dementia v0.105 SNCB Zornitza Stark Mode of inheritance for gene: SNCB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.104 SNCB Zornitza Stark Classified gene: SNCB as Red List (low evidence)
Early-onset Dementia v0.104 SNCB Zornitza Stark Gene: sncb has been classified as Red List (Low Evidence).
Early-onset Dementia v0.103 SNCB Zornitza Stark reviewed gene: SNCB: Rating: RED; Mode of pathogenicity: None; Publications: 15365127, 20697047; Phenotypes: Dementia, Lewy body, 127750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.103 FUS Zornitza Stark Marked gene: FUS as ready
Early-onset Dementia v0.103 FUS Zornitza Stark Gene: fus has been classified as Green List (High Evidence).
Early-onset Dementia v0.103 FUS Zornitza Stark Phenotypes for gene: FUS were changed from to Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030
Early-onset Dementia v0.102 FUS Zornitza Stark Publications for gene: FUS were set to
Early-onset Dementia v0.101 FUS Zornitza Stark Mode of inheritance for gene: FUS was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.100 FUS Zornitza Stark reviewed gene: FUS: Rating: GREEN; Mode of pathogenicity: None; Publications: 32941707, 32770214; Phenotypes: Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.100 FTL Zornitza Stark Marked gene: FTL as ready
Early-onset Dementia v0.100 FTL Zornitza Stark Gene: ftl has been classified as Green List (High Evidence).
Early-onset Dementia v0.100 FTL Zornitza Stark Phenotypes for gene: FTL were changed from to Neurodegeneration with brain iron accumulation 3, MIM# 606159
Early-onset Dementia v0.99 FTL Zornitza Stark Publications for gene: FTL were set to
Early-onset Dementia v0.98 FTL Zornitza Stark Mode of inheritance for gene: FTL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.97 FTL Zornitza Stark reviewed gene: FTL: Rating: GREEN; Mode of pathogenicity: None; Publications: 11438811, 18854324, 15099026, 15173247; Phenotypes: Neurodegeneration with brain iron accumulation 3, MIM# 606159; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.97 FA2H Zornitza Stark Marked gene: FA2H as ready
Early-onset Dementia v0.97 FA2H Zornitza Stark Gene: fa2h has been classified as Red List (Low Evidence).
Early-onset Dementia v0.97 FA2H Zornitza Stark Phenotypes for gene: FA2H were changed from to Spastic paraplegia 35, autosomal recessive, MIM# 612319
Early-onset Dementia v0.96 FA2H Zornitza Stark Mode of inheritance for gene: FA2H was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.95 FA2H Zornitza Stark Classified gene: FA2H as Red List (low evidence)
Early-onset Dementia v0.95 FA2H Zornitza Stark Gene: fa2h has been classified as Red List (Low Evidence).
Early-onset Dementia v0.94 FA2H Zornitza Stark reviewed gene: FA2H: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Spastic paraplegia 35, autosomal recessive, MIM# 612319; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.94 DCTN1 Zornitza Stark Marked gene: DCTN1 as ready
Early-onset Dementia v0.94 DCTN1 Zornitza Stark Gene: dctn1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.94 DCTN1 Zornitza Stark Phenotypes for gene: DCTN1 were changed from to Perry syndrome, MIM# 168605
Early-onset Dementia v0.93 DCTN1 Zornitza Stark Publications for gene: DCTN1 were set to
Early-onset Dementia v0.92 DCTN1 Zornitza Stark Mode of inheritance for gene: DCTN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.91 DCTN1 Zornitza Stark reviewed gene: DCTN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19136952; Phenotypes: Perry syndrome, MIM# 168605; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.91 CYP27A1 Zornitza Stark Marked gene: CYP27A1 as ready
Early-onset Dementia v0.91 CYP27A1 Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.91 CYP27A1 Zornitza Stark Phenotypes for gene: CYP27A1 were changed from to Cerebrotendinous xanthomatosis, MIM# 213700
Early-onset Dementia v0.90 CYP27A1 Zornitza Stark Mode of inheritance for gene: CYP27A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.89 CYP27A1 Zornitza Stark reviewed gene: CYP27A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cerebrotendinous xanthomatosis, MIM# 213700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.89 CHCHD10 Zornitza Stark Marked gene: CHCHD10 as ready
Early-onset Dementia v0.89 CHCHD10 Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence).
Early-onset Dementia v0.89 CHCHD10 Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911
Early-onset Dementia v0.88 CHCHD10 Zornitza Stark Publications for gene: CHCHD10 were set to
Early-onset Dementia v0.87 CHCHD10 Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.86 CHCHD10 Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: None; Publications: 24934289, 31690696, 30877432, 32369233; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.86 C19orf12 Zornitza Stark Marked gene: C19orf12 as ready
Early-onset Dementia v0.86 C19orf12 Zornitza Stark Gene: c19orf12 has been classified as Green List (High Evidence).
Early-onset Dementia v0.86 C19orf12 Zornitza Stark Phenotypes for gene: C19orf12 were changed from to Neurodegeneration with brain iron accumulation 4, MIM# 614298
Early-onset Dementia v0.85 C19orf12 Zornitza Stark Publications for gene: C19orf12 were set to
Early-onset Dementia v0.84 C19orf12 Zornitza Stark Mode of inheritance for gene: C19orf12 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.83 C19orf12 Zornitza Stark reviewed gene: C19orf12: Rating: GREEN; Mode of pathogenicity: None; Publications: 23278385, 21981780, 23269600; Phenotypes: Neurodegeneration with brain iron accumulation 4, MIM# 614298; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.83 ATP13A2 Zornitza Stark Marked gene: ATP13A2 as ready
Early-onset Dementia v0.83 ATP13A2 Zornitza Stark Gene: atp13a2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.83 ATP13A2 Zornitza Stark Phenotypes for gene: ATP13A2 were changed from to Kufor-Rakeb syndrome, MIM# 606693
Early-onset Dementia v0.82 ATP13A2 Zornitza Stark Mode of inheritance for gene: ATP13A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.81 ATP13A2 Zornitza Stark reviewed gene: ATP13A2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Kufor-Rakeb syndrome, MIM# 606693; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.81 ARSA Zornitza Stark Marked gene: ARSA as ready
Early-onset Dementia v0.81 ARSA Zornitza Stark Gene: arsa has been classified as Green List (High Evidence).
Early-onset Dementia v0.81 ARSA Zornitza Stark Phenotypes for gene: ARSA were changed from to Metachromatic leukodystrophy, MIM# 250100, adult-onset
Early-onset Dementia v0.80 ARSA Zornitza Stark Publications for gene: ARSA were set to
Early-onset Dementia v0.79 ARSA Zornitza Stark Mode of inheritance for gene: ARSA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.78 ARSA Zornitza Stark reviewed gene: ARSA: Rating: GREEN; Mode of pathogenicity: None; Publications: 29486463, 26890752, 15710861; Phenotypes: Metachromatic leukodystrophy, MIM# 250100, adult-onset; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.78 APOE Zornitza Stark Marked gene: APOE as ready
Early-onset Dementia v0.78 APOE Zornitza Stark Gene: apoe has been classified as Green List (High Evidence).
Early-onset Dementia v0.78 APOE Zornitza Stark Phenotypes for gene: APOE were changed from to Alzheimer disease 2, MIM# 104310
Early-onset Dementia v0.77 APOE Zornitza Stark Mode of inheritance for gene: APOE was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.76 APOE Zornitza Stark reviewed gene: APOE: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alzheimer disease 2, MIM# 104310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Marked gene: NOTCH3 as ready
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence).
Early-onset Dementia v0.76 NOTCH3 Zornitza Stark Phenotypes for gene: NOTCH3 were changed from to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310
Early-onset Dementia v0.75 NOTCH3 Zornitza Stark Publications for gene: NOTCH3 were set to
Early-onset Dementia v0.74 NOTCH3 Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.73 NOTCH3 Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.73 TET2 Zornitza Stark Marked gene: TET2 as ready
Early-onset Dementia v0.73 TET2 Zornitza Stark Gene: tet2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.73 TET2 Zornitza Stark gene: TET2 was added
gene: TET2 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: TET2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TET2 were set to 32330418; 31943063
Phenotypes for gene: TET2 were set to Dementia
Review for gene: TET2 was set to RED
Added comment: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution. PMID: 31943063 - Li et al 2020 - functional studies in mice show that Tet2 depletion in the hippocampus exacerbates Alzheimer disease pathology and cognitive dysfunction at early disease stages.
Sources: Literature
Early-onset Dementia v0.72 PRNP Bryony Thompson Classified STR: PRNP as Green List (high evidence)
Early-onset Dementia v0.72 PRNP Bryony Thompson Str: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.71 PRNP Bryony Thompson STR: PRNP was added
STR: PRNP was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: PRNP.
Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP were set to 20301407
Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP was set to GREEN
STR: PRNP was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Classified STR: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.69 C9orf72 Bryony Thompson STR: C9orf72 was added
STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: C9orf72.
Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: C9orf72 were set to 25577942
Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: C9orf72 was set to GREEN
STR: C9orf72 was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Early-onset Dementia v0.68 C9orf72 Bryony Thompson Classified gene: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.68 C9orf72 Bryony Thompson Added comment: Comment on list classification: Only reported cause of disease is a hexanucleotide repeat (GGGGCC) located between the noncoding exons 1a and 1b. RNA toxicity or proteotoxicity is the expected mechanism of disease.
Early-onset Dementia v0.68 C9orf72 Bryony Thompson Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.67 HDL2 Bryony Thompson Classified STR: HDL2 as Green List (high evidence)
Early-onset Dementia v0.67 HDL2 Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.66 HDL2 Bryony Thompson STR: HDL2 was added
STR: HDL2 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: HDL2.
Mode of inheritance for STR: HDL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HDL2 were set to 20301701
Phenotypes for STR: HDL2 were set to Huntington disease-like 2 MIM#606438
Review for STR: HDL2 was set to GREEN
STR: HDL2 was marked as clinically relevant
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Sources: Expert list
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Marked gene: C9orf72 as ready
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Classified gene: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.64 C9orf72 Zornitza Stark gene: C9orf72 was added
gene: C9orf72 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to gene: C9orf72.
Mode of inheritance for gene: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: C9orf72 were set to 31779815; 21944778; 21944779
Phenotypes for gene: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for gene: C9orf72 was set to GREEN
Added comment: Well established gene-disease association.
Sources: Expert list
Early-onset Dementia v0.63 HNRNPA2B1 Bryony Thompson Marked gene: HNRNPA2B1 as ready
Early-onset Dementia v0.63 HNRNPA2B1 Bryony Thompson Gene: hnrnpa2b1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.63 HNRNPA2B1 Bryony Thompson Classified gene: HNRNPA2B1 as Amber List (moderate evidence)
Early-onset Dementia v0.63 HNRNPA2B1 Bryony Thompson Gene: hnrnpa2b1 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.62 HNRNPA2B1 Bryony Thompson gene: HNRNPA2B1 was added
gene: HNRNPA2B1 was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: HNRNPA2B1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPA2B1 were set to 23455423; 30279180; 29358076; 26744327; 23635965
Phenotypes for gene: HNRNPA2B1 were set to Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422
Review for gene: HNRNPA2B1 was set to AMBER
Added comment: One family reported that segregates cognitive impairment as part of the phenotype, and extensive functional analysis of protein, including a drosophila model.
Sources: Literature
Early-onset Dementia v0.61 HNRNPA1 Bryony Thompson Marked gene: HNRNPA1 as ready
Early-onset Dementia v0.61 HNRNPA1 Bryony Thompson Gene: hnrnpa1 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.61 HNRNPA1 Bryony Thompson gene: HNRNPA1 was added
gene: HNRNPA1 was added to Early-onset Dementia. Sources: Other
Mode of inheritance for gene: HNRNPA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: HNRNPA1 were set to 24612671; 24119545; 23455423
Phenotypes for gene: HNRNPA1 were set to Inclusion body myopathy with early-onset Paget disease without frontotemporal dementia 3 MIM#615424; Amyotrophic lateral sclerosis 20 MIM#615426
Review for gene: HNRNPA1 was set to RED
Added comment: I cannot find any evidence that pathogenic variants in this gene cause dementia. The conditions associated with the gene are a pure ALS without FTD and myopathy.
Sources: Other
Early-onset Dementia v0.60 CST3 Bryony Thompson Marked gene: CST3 as ready
Early-onset Dementia v0.60 CST3 Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence).
Early-onset Dementia v0.60 GSN Bryony Thompson Marked gene: GSN as ready
Early-onset Dementia v0.60 GSN Bryony Thompson Gene: gsn has been classified as Red List (Low Evidence).
Early-onset Dementia v0.60 GSN Bryony Thompson gene: GSN was added
gene: GSN was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: GSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GSN were set to Amyloidosis, Finnish type MIM#105120
Review for gene: GSN was set to RED
Added comment: I could not find any evidence of a gene-disease association with dementia. Hereditary motor and sensory neuropathy is reported as the neurological phenotype.
Sources: Expert list
Early-onset Dementia v0.59 CST3 Bryony Thompson Classified gene: CST3 as Green List (high evidence)
Early-onset Dementia v0.59 CST3 Bryony Thompson Gene: cst3 has been classified as Green List (High Evidence).
Early-onset Dementia v0.58 CST3 Bryony Thompson changed review comment from: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but there is modest risk associated with the homozygote (rs1064039) minor allele geneotype, combined OR 1.6.
Sources: Expert list; to: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but there is modest risk associated with the homozygote (rs1064039) minor allele genotype, combined OR 1.6.
Sources: Expert list
Early-onset Dementia v0.58 CST3 Bryony Thompson changed review comment from: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but the combined OR for the homozygote (rs1064039) minor allele is modest risk at 1.6.
Sources: Expert list; to: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but there is modest risk associated with the homozygote (rs1064039) minor allele geneotype, combined OR 1.6.
Sources: Expert list
Early-onset Dementia v0.58 CST3 Bryony Thompson gene: CST3 was added
gene: CST3 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: CST3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CST3 were set to 22435454; 8866434; 2602413; 8108423
Phenotypes for gene: CST3 were set to Cerebral amyloid angiopathy MIM#105150
Mode of pathogenicity for gene: CST3 was set to Other
Review for gene: CST3 was set to GREEN
Added comment: A single missense variant L68Q causes Icelandic-type CAA, where brain haemorrhage is main presenting feature of the condition. Progressive multi-infarct dementia has been reported in at least 17 cases. Dementia has been reported as the presenting feature in 2 cases from the same family. The gene has also been reported as an Alzheimer's disease susceptibility loci, but the combined OR for the homozygote (rs1064039) minor allele is modest risk at 1.6.
Sources: Expert list
Early-onset Dementia v0.57 CYLD Bryony Thompson Classified gene: CYLD as Amber List (moderate evidence)
Early-onset Dementia v0.57 CYLD Bryony Thompson Gene: cyld has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.56 CYLD Bryony Thompson reviewed gene: CYLD: Rating: AMBER; Mode of pathogenicity: None; Publications: 32666117, 32666099, 32185393; Phenotypes: frontotemporal dementia, amyotrophic lateral sclerosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.56 MAPT Zornitza Stark Marked gene: MAPT as ready
Early-onset Dementia v0.56 MAPT Zornitza Stark Gene: mapt has been classified as Green List (High Evidence).
Early-onset Dementia v0.56 MAPT Zornitza Stark Phenotypes for gene: MAPT were changed from to Supranuclear palsy, progressive (MIM# 601104) AD; Supranuclear palsy, progressive atypical (MIM# 260540) AR
Early-onset Dementia v0.55 MAPT Zornitza Stark Publications for gene: MAPT were set to
Early-onset Dementia v0.54 MAPT Zornitza Stark Mode of inheritance for gene: MAPT was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Dementia v0.53 MAPT Ain Roesley reviewed gene: MAPT: Rating: GREEN; Mode of pathogenicity: None; Publications: 20838030, 11220749; Phenotypes: Supranuclear palsy, progressive (MIM# 601104) AD, Supranuclear palsy, progressive atypical (MIM# 260540) AR; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.53 ATN1 Bryony Thompson Tag STR tag was added to gene: ATN1.
Early-onset Dementia v0.53 CTSF Zornitza Stark Classified gene: CTSF as Green List (high evidence)
Early-onset Dementia v0.53 CTSF Zornitza Stark Gene: ctsf has been classified as Green List (High Evidence).
Early-onset Dementia v0.53 CTSF Zornitza Stark Marked gene: CTSF as ready
Early-onset Dementia v0.53 CTSF Zornitza Stark Gene: ctsf has been classified as Green List (High Evidence).
Early-onset Dementia v0.53 CTSF Zornitza Stark Classified gene: CTSF as Green List (high evidence)
Early-onset Dementia v0.53 CTSF Zornitza Stark Gene: ctsf has been classified as Green List (High Evidence).
Early-onset Dementia v0.52 CTSF Elena Savva gene: CTSF was added
gene: CTSF was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: CTSF was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CTSF were set to PMID: 28749476; 27668283; 27524508
Phenotypes for gene: CTSF were set to Ceroid lipofuscinosis, neuronal, 13, Kufs type 615362
Review for gene: CTSF was set to GREEN
Added comment: OMIM: Cathepsin is a member of the papain family of cysteine proteases. These enzymes represent a major component of the lysosomal proteolytic system.

PMID: 28749476 - 1 chet patient (missense, CNV) with FTD, onset at 37 years old.

PMID: 27668283 - 2 families with adult-onset neuronal ceroid lipofuscinosis and FTD. Onset in 20s-30s. Light and electron microscopy shows swollen neuronal perikarya and intraneuronal storage of polymorphic lipofuscin-like inclusions

PMID: 27524508 - 1 hom family (PTC) with early-onset Alzheimer disease
Sources: Expert list
Early-onset Dementia v0.52 GBA Zornitza Stark Marked gene: GBA as ready
Early-onset Dementia v0.52 GBA Zornitza Stark Gene: gba has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.52 GBA Zornitza Stark Phenotypes for gene: GBA were changed from to {Lewy body dementia, susceptibility to} (MIM# 127750)
Early-onset Dementia v0.51 GBA Zornitza Stark Publications for gene: GBA were set to
Early-onset Dementia v0.50 GBA Zornitza Stark Mode of inheritance for gene: GBA was changed from Unknown to Other
Early-onset Dementia v0.49 GBA Zornitza Stark Classified gene: GBA as Amber List (moderate evidence)
Early-onset Dementia v0.49 GBA Zornitza Stark Gene: gba has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.48 GBA Ain Roesley reviewed gene: GBA: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 23588557, 32439597, 31010158; Phenotypes: {Lewy body dementia, susceptibility to} (MIM# 127750); Mode of inheritance: Other
Early-onset Dementia v0.48 CYLD Zornitza Stark Marked gene: CYLD as ready
Early-onset Dementia v0.48 CYLD Zornitza Stark Gene: cyld has been classified as Red List (Low Evidence).
Early-onset Dementia v0.48 CYLD Zornitza Stark gene: CYLD was added
gene: CYLD was added to Early-onset Dementia. Sources: Literature
Mode of inheritance for gene: CYLD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CYLD were set to 32185393
Phenotypes for gene: CYLD were set to Frontotemporal dementia; Amyotrophic lateral sclerosis
Review for gene: CYLD was set to RED
Added comment: Recent report of a missense variant segregating in 1 family with frontotemporal dementia and amyotrophic lateral sclerosis. Functional studies showed that the variant resulted in a gain of ubiquitinase function, opposite from the mechanism causing the well-documented cutaneous phenotypes
Sources: Literature
Early-onset Dementia v0.47 ATN1 Bryony Thompson Classified gene: ATN1 as Green List (high evidence)
Early-onset Dementia v0.47 ATN1 Bryony Thompson Added comment: Comment on list classification: Note: trinucleotide repeat is the only cause of dementia for this gene. STRs are currently not detectable in WES/WGS technologies.
Early-onset Dementia v0.47 ATN1 Bryony Thompson Gene: atn1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.46 ATN1 Bryony Thompson Deleted their comment
Early-onset Dementia v0.46 ATN1 Bryony Thompson Classified gene: ATN1 as Green List (high evidence)
Early-onset Dementia v0.46 ATN1 Bryony Thompson Added comment: Comment on list classification: STR only cause of dementia for this gene
Early-onset Dementia v0.46 ATN1 Bryony Thompson Gene: atn1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.45 ATN1 Bryony Thompson gene: ATN1 was added
gene: ATN1 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATN1 were set to 7633415
Phenotypes for gene: ATN1 were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Mode of pathogenicity for gene: ATN1 was set to Other
Review for gene: ATN1 was set to GREEN
Added comment: DRPLA contains various combinations of myoclonus, seizures, ataxia, choreoathetosis, and dementia, and is only caused by trinucleotide repeat expansion. Mean age of onset is 30 years of age. From OMIM: In 22 patients unstable expansion of a CAG unit in the DRPLA gene was identified. Each patient was a heterozygote with 1 allele in the normal range (8-25 repeat units) and a second expanded allele with the range of 54-68 repeat units. There were no overlaps in the number of CAG repeat units between control chromosomes and DRPLA chromosomes.
Sources: Expert list
Early-onset Dementia v0.44 CCNF Bryony Thompson Marked gene: CCNF as ready
Early-onset Dementia v0.44 CCNF Bryony Thompson Gene: ccnf has been classified as Green List (High Evidence).
Early-onset Dementia v0.44 CCNF Bryony Thompson Classified gene: CCNF as Green List (high evidence)
Early-onset Dementia v0.44 CCNF Bryony Thompson Gene: ccnf has been classified as Green List (High Evidence).
Early-onset Dementia v0.43 CCNF Bryony Thompson gene: CCNF was added
gene: CCNF was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: CCNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CCNF were set to 27080313
Phenotypes for gene: CCNF were set to amyotrophic lateral sclerosis with/without frontotemporal dementia
Review for gene: CCNF was set to GREEN
Added comment: Four cases, within three families with FTD with/without ALS.
Sources: Expert list
Early-onset Dementia v0.40 Bryony Thompson Panel types changed to Victorian Clinical Genetics Services; Melbourne Genomics; Royal Melbourne Hospital; Rare Disease
Early-onset Dementia v0.38 PINK1 Bryony Thompson Mode of inheritance for gene: PINK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.37 PRKN Bryony Thompson Marked gene: PRKN as ready
Early-onset Dementia v0.37 PRKN Bryony Thompson Gene: prkn has been classified as Green List (High Evidence).
Early-onset Dementia v0.37 PRKN Bryony Thompson Phenotypes for gene: PRKN were changed from to Parkinson disease, juvenile, type 2 MIM#600116
Early-onset Dementia v0.36 PRKN Bryony Thompson Mode of inheritance for gene: PRKN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.35 SPG11 Bryony Thompson Phenotypes for gene: SPG11 were changed from to Spastic paraplegia 11, autosomal recessive MIM#604360; Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668; Amyotrophic lateral sclerosis 5, juvenile MIM#602099
Early-onset Dementia v0.34 SPG11 Bryony Thompson Mode of inheritance for gene: SPG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.33 VPS13A Bryony Thompson Phenotypes for gene: VPS13A were changed from to Choreoacanthocytosis MIM#200150
Early-onset Dementia v0.33 VPS13A Bryony Thompson Mode of inheritance for gene: VPS13A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.32 VPS35 Bryony Thompson Mode of inheritance for gene: VPS35 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.31 VPS35 Bryony Thompson Phenotypes for gene: VPS35 were changed from to {Parkinson disease 17} MIM#614203; Cognitive decline
Early-onset Dementia v0.30 VAPB Bryony Thompson Phenotypes for gene: VAPB were changed from to Amyotrophic lateral sclerosis 8 MIM#608627; Spinal muscular atrophy, late-onset, Finkel type MIM#182980
Early-onset Dementia v0.29 MATR3 Bryony Thompson Marked gene: MATR3 as ready
Early-onset Dementia v0.29 MATR3 Bryony Thompson Gene: matr3 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.29 MATR3 Bryony Thompson Phenotypes for gene: MATR3 were changed from to Amyotrophic lateral sclerosis 21 MIM#606070
Early-onset Dementia v0.28 MATR3 Bryony Thompson Mode of inheritance for gene: MATR3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.27 PARK7 Bryony Thompson Mode of inheritance for gene: PARK7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.26 LRRK2 Bryony Thompson Mode of inheritance for gene: LRRK2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.25 TAF15 Bryony Thompson Classified gene: TAF15 as Amber List (moderate evidence)
Early-onset Dementia v0.25 TAF15 Bryony Thompson Gene: taf15 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.24 RNF216 Bryony Thompson Classified gene: RNF216 as Green List (high evidence)
Early-onset Dementia v0.24 RNF216 Bryony Thompson Gene: rnf216 has been classified as Green List (High Evidence).
Early-onset Dementia v0.24 RNF216 Bryony Thompson Classified gene: RNF216 as Green List (high evidence)
Early-onset Dementia v0.24 RNF216 Bryony Thompson Gene: rnf216 has been classified as Green List (High Evidence).
Early-onset Dementia v0.23 RNF216 Bryony Thompson Marked gene: RNF216 as ready
Early-onset Dementia v0.23 RNF216 Bryony Thompson Gene: rnf216 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.23 CP Bryony Thompson Classified gene: CP as Green List (high evidence)
Early-onset Dementia v0.23 CP Bryony Thompson Gene: cp has been classified as Green List (High Evidence).
Early-onset Dementia v0.22 MATR3 Bryony Thompson Classified gene: MATR3 as Amber List (moderate evidence)
Early-onset Dementia v0.22 MATR3 Bryony Thompson Gene: matr3 has been classified as Amber List (Moderate Evidence).
Early-onset Dementia v0.21 GCH1 Bryony Thompson Classified gene: GCH1 as Red List (low evidence)
Early-onset Dementia v0.21 GCH1 Bryony Thompson Gene: gch1 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.20 FIG4 Bryony Thompson Classified gene: FIG4 as Red List (low evidence)
Early-onset Dementia v0.20 FIG4 Bryony Thompson Added comment: Comment on list classification: ALS-FTD not a prominent phenotype
Early-onset Dementia v0.20 FIG4 Bryony Thompson Gene: fig4 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.19 ATP7B Bryony Thompson Marked gene: ATP7B as ready
Early-onset Dementia v0.19 ATP7B Bryony Thompson Gene: atp7b has been classified as Red List (Low Evidence).
Early-onset Dementia v0.19 ATP7B Bryony Thompson Classified gene: ATP7B as Red List (low evidence)
Early-onset Dementia v0.19 ATP7B Bryony Thompson Gene: atp7b has been classified as Red List (Low Evidence).
Early-onset Dementia v0.18 ANG Bryony Thompson Classified gene: ANG as Red List (low evidence)
Early-onset Dementia v0.18 ANG Bryony Thompson Added comment: Comment on list classification: Not a prominent ALS-FTD phenotype
Early-onset Dementia v0.18 ANG Bryony Thompson Gene: ang has been classified as Red List (Low Evidence).
Early-onset Dementia v0.17 WDR45 Bryony Thompson Classified gene: WDR45 as Green List (high evidence)
Early-onset Dementia v0.17 WDR45 Bryony Thompson Gene: wdr45 has been classified as Green List (High Evidence).
Early-onset Dementia v0.16 WDR45 Bryony Thompson changed review comment from: De novo variants identified in 5 cases with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), which included dementia as a feature.
Sources: Expert list; to: De novo variants identified in 5 female cases with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), which included dementia as a feature.
Sources: Expert list
Early-onset Dementia v0.16 WDR45 Bryony Thompson gene: WDR45 was added
gene: WDR45 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: WDR45 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: WDR45 were set to 23435086
Phenotypes for gene: WDR45 were set to Neurodegeneration with brain iron accumulation 5 MIM#300894
Review for gene: WDR45 was set to GREEN
Added comment: De novo variants identified in 5 cases with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), which included dementia as a feature.
Sources: Expert list
Early-onset Dementia v0.15 VPS35 Bryony Thompson reviewed gene: VPS35: Rating: ; Mode of pathogenicity: None; Publications: 31686421, 22105352; Phenotypes: {Parkinson disease 17} MIM#614203; Mode of inheritance: None
Early-onset Dementia v0.15 VPS13A Bryony Thompson reviewed gene: VPS13A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26813249, 15824261, 30140251, 31192303; Phenotypes: Choreoacanthocytosis MIM#200150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.15 VAPB Bryony Thompson Classified gene: VAPB as Red List (low evidence)
Early-onset Dementia v0.15 VAPB Bryony Thompson Gene: vapb has been classified as Red List (Low Evidence).
Early-onset Dementia v0.14 VAPB Bryony Thompson reviewed gene: VAPB: Rating: RED; Mode of pathogenicity: None; Publications: 31873036, 31089860; Phenotypes: Amyotrophic lateral sclerosis 8 MIM#608627, Spinal muscular atrophy, late-onset, Finkel type MIM#182980; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.14 UCHL1 Bryony Thompson Classified gene: UCHL1 as Red List (low evidence)
Early-onset Dementia v0.14 UCHL1 Bryony Thompson Gene: uchl1 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.13 UCHL1 Bryony Thompson reviewed gene: UCHL1: Rating: RED; Mode of pathogenicity: None; Publications: 27231703, 15297154; Phenotypes: Spastic paraplegia 79, autosomal recessive MIM#615491; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.13 TH Bryony Thompson Classified gene: TH as Red List (low evidence)
Early-onset Dementia v0.13 TH Bryony Thompson Gene: th has been classified as Red List (Low Evidence).
Early-onset Dementia v0.12 TH Bryony Thompson reviewed gene: TH: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Segawa syndrome, recessive MIM#605407; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.12 TAF15 Bryony Thompson gene: TAF15 was added
gene: TAF15 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: TAF15 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: TAF15 were set to 28889094
Phenotypes for gene: TAF15 were set to Amyotrophic lateral sclerosis; Frontotemporal dementia
Review for gene: TAF15 was set to AMBER
Added comment: Two missense variants identified in two unrelated cases with a similar phenotype which included low motor neuron predominant signs, behavioural variant FTD and movement disorders, and in one patient, neuropathology showed a frontotemporal lobar degeneration pattern.
Sources: Expert list
Early-onset Dementia v0.11 SPG11 Bryony Thompson reviewed gene: SPG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 27318863, 28237315, 18079167; Phenotypes: Spastic paraplegia 11, autosomal recessive MIM#604360, Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668, Amyotrophic lateral sclerosis 5, juvenile MIM#602099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.11 SPART Bryony Thompson Classified gene: SPART as Red List (low evidence)
Early-onset Dementia v0.11 SPART Bryony Thompson Gene: spart has been classified as Red List (Low Evidence).
Early-onset Dementia v0.10 SPART Bryony Thompson reviewed gene: SPART: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Troyer syndrome MIM#275900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.10 SOD1 Bryony Thompson Classified gene: SOD1 as Red List (low evidence)
Early-onset Dementia v0.10 SOD1 Bryony Thompson Gene: sod1 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.9 SOD1 Bryony Thompson reviewed gene: SOD1: Rating: RED; Mode of pathogenicity: None; Publications: 19252762, 20577002; Phenotypes: Amyotrophic lateral sclerosis 1 MIM#105400, Spastic tetraplegia and axial hypotonia, progressive MIM#618598; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.9 SETX Bryony Thompson Classified gene: SETX as Red List (low evidence)
Early-onset Dementia v0.9 SETX Bryony Thompson Gene: setx has been classified as Red List (Low Evidence).
Early-onset Dementia v0.8 SETX Bryony Thompson reviewed gene: SETX: Rating: RED; Mode of pathogenicity: None; Publications: 24694197; Phenotypes: Amyotrophic lateral sclerosis 4, juvenile MIM#602433, Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.8 RNF216 Bryony Thompson gene: RNF216 was added
gene: RNF216 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: RNF216 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF216 were set to 23656588; 25841028; 27995769
Phenotypes for gene: RNF216 were set to Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840
Review for gene: RNF216 was set to GREEN
Added comment: At least 3 families reported with dementia as a feature of the condition. Mouse model has deficits in spatial learning and memory.
Sources: Expert list
Early-onset Dementia v0.7 PRKN Bryony Thompson edited their review of gene: PRKN: Changed rating: GREEN
Early-onset Dementia v0.7 PRKN Bryony Thompson reviewed gene: PRKN: Rating: ; Mode of pathogenicity: None; Publications: 29644727; Phenotypes: Parkinson disease, juvenile, type 2 MIM#600116; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.7 PINK1 Bryony Thompson reviewed gene: PINK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29644727, 15955953; Phenotypes: Parkinson disease 6, early onset MIM#605909; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.7 PARK7 Bryony Thompson reviewed gene: PARK7: Rating: GREEN; Mode of pathogenicity: None; Publications: 16240358, 27085187, 29644727; Phenotypes: Parkinson disease 7, autosomal recessive early-onset MIM#606324; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.7 NR4A2 Bryony Thompson Classified gene: NR4A2 as Red List (low evidence)
Early-onset Dementia v0.7 NR4A2 Bryony Thompson Gene: nr4a2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.6 NR4A2 Bryony Thompson reviewed gene: NR4A2: Rating: RED; Mode of pathogenicity: None; Publications: 12756136, 9092472; Phenotypes: ; Mode of inheritance: Unknown
Early-onset Dementia v0.6 MATR3 Bryony Thompson reviewed gene: MATR3: Rating: AMBER; Mode of pathogenicity: None; Publications: 24686783, 30015619; Phenotypes: Amyotrophic lateral sclerosis 21 MIM#606070; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.6 LRRK2 Bryony Thompson reviewed gene: LRRK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17060595, 31038182, 27521182, 28487191; Phenotypes: Parkinson disease 8 MIM#607060; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.6 ALS2 Bryony Thompson Classified gene: ALS2 as Red List (low evidence)
Early-onset Dementia v0.6 ALS2 Bryony Thompson Gene: als2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.5 ALS2 Bryony Thompson Classified gene: ALS2 as Red List (low evidence)
Early-onset Dementia v0.5 ALS2 Bryony Thompson Gene: als2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.5 HTRA2 Bryony Thompson Classified gene: HTRA2 as Red List (low evidence)
Early-onset Dementia v0.5 HTRA2 Bryony Thompson Gene: htra2 has been classified as Red List (Low Evidence).
Early-onset Dementia v0.4 HTRA2 Bryony Thompson reviewed gene: HTRA2: Rating: RED; Mode of pathogenicity: None; Publications: 18800009; Phenotypes: Parkinson disease 13 MIM#610297, 3-methylglutaconic aciduria, type VIII MIM#617248; Mode of inheritance: None
Early-onset Dementia v0.4 HTRA1 Bryony Thompson Classified gene: HTRA1 as Green List (high evidence)
Early-onset Dementia v0.4 HTRA1 Bryony Thompson Gene: htra1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.4 HTRA1 Bryony Thompson Classified gene: HTRA1 as Green List (high evidence)
Early-onset Dementia v0.4 HTRA1 Bryony Thompson Gene: htra1 has been classified as Green List (High Evidence).
Early-onset Dementia v0.3 HTRA1 Bryony Thompson gene: HTRA1 was added
gene: HTRA1 was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: HTRA1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: HTRA1 were set to 29895533; 26063658; 19387015
Phenotypes for gene: HTRA1 were set to CARASIL syndrome MIM#600142; Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779
Review for gene: HTRA1 was set to GREEN
Added comment: Dementia or cognitive decline have been reported in >3 cases with recessive and dominant disease.
Sources: Expert list
Early-onset Dementia v0.2 GCH1 Bryony Thompson reviewed gene: GCH1: Rating: RED; Mode of pathogenicity: None; Publications: 29948246; Phenotypes: Dystonia, DOPA-responsive, with or without hyperphenylalaninemia MIM#128230, Hyperphenylalaninemia, BH4-deficient, B MIM#233910; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.2 FIG4 Bryony Thompson reviewed gene: FIG4: Rating: RED; Mode of pathogenicity: None; Publications: 28889094, 19118816; Phenotypes: Amyotrophic lateral sclerosis 11 MIM#612577, Charcot-Marie-Tooth disease, type 4J MIM#611228; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Early-onset Dementia v0.2 CP Bryony Thompson gene: CP was added
gene: CP was added to Early-onset Dementia. Sources: Expert list
Mode of inheritance for gene: CP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CP were set to 7539672; https://doi.org/10.1093/qjmed/89.5.355; 28874056; 28012953
Phenotypes for gene: CP were set to Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290
Review for gene: CP was set to GREEN
Added comment: >3 cases have been reported with dementia/cognitive decline as a feature of the condition. Cp-/- mice have increased memory impairment and iron accumulation and high expression of CP could have a protective role in Alzheimer's disease.
Sources: Expert list
Early-onset Dementia v0.1 ATP7B Bryony Thompson reviewed gene: ATP7B: Rating: RED; Mode of pathogenicity: None; Publications: 26758278, 25988284, 26758278; Phenotypes: Wilson disease MIM#277900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.1 ANG Bryony Thompson reviewed gene: ANG: Rating: RED; Mode of pathogenicity: None; Publications: 19153377; Phenotypes: Amyotrophic lateral sclerosis 9 MIM#611895; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Early-onset Dementia v0.1 ALS2 Bryony Thompson reviewed gene: ALS2: Rating: RED; Mode of pathogenicity: None; Publications: 31405128, 12145748, 24562058; Phenotypes: Amyotrophic lateral sclerosis 2, juvenile MIM#205100, Primary lateral sclerosis, juvenile MIM#606353, Spastic paralysis, infantile onset ascending MIM#607225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Dementia v0.1 Zornitza Stark Panel name changed from Early-onset Dementia_MGHA_VCGS to Early-onset Dementia
Panel types changed to Victorian Clinical Genetics Services; Melbourne Genomics
Early-onset Dementia v0.0 XK Zornitza Stark gene: XK was added
gene: XK was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: XK was set to Unknown
Early-onset Dementia v0.0 VPS35 Zornitza Stark gene: VPS35 was added
gene: VPS35 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: VPS35 was set to Unknown
Early-onset Dementia v0.0 VPS13A Zornitza Stark gene: VPS13A was added
gene: VPS13A was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: VPS13A was set to Unknown
Early-onset Dementia v0.0 VCP Zornitza Stark gene: VCP was added
gene: VCP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: VCP was set to Unknown
Early-onset Dementia v0.0 VAPB Zornitza Stark gene: VAPB was added
gene: VAPB was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: VAPB was set to Unknown
Early-onset Dementia v0.0 UCHL1 Zornitza Stark gene: UCHL1 was added
gene: UCHL1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: UCHL1 was set to Unknown
Early-onset Dementia v0.0 UBQLN2 Zornitza Stark gene: UBQLN2 was added
gene: UBQLN2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: UBQLN2 was set to Unknown
Early-onset Dementia v0.0 TYROBP Zornitza Stark gene: TYROBP was added
gene: TYROBP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TYROBP was set to Unknown
Early-onset Dementia v0.0 TUBA4A Zornitza Stark gene: TUBA4A was added
gene: TUBA4A was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TUBA4A was set to Unknown
Early-onset Dementia v0.0 TTR Zornitza Stark gene: TTR was added
gene: TTR was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TTR was set to Unknown
Early-onset Dementia v0.0 TREM2 Zornitza Stark gene: TREM2 was added
gene: TREM2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TREM2 was set to Unknown
Early-onset Dementia v0.0 TH Zornitza Stark gene: TH was added
gene: TH was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TH was set to Unknown
Early-onset Dementia v0.0 TBK1 Zornitza Stark gene: TBK1 was added
gene: TBK1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TBK1 was set to Unknown
Early-onset Dementia v0.0 TARDBP Zornitza Stark gene: TARDBP was added
gene: TARDBP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: TARDBP was set to Unknown
Early-onset Dementia v0.0 SQSTM1 Zornitza Stark gene: SQSTM1 was added
gene: SQSTM1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SQSTM1 was set to Unknown
Early-onset Dementia v0.0 SPG21 Zornitza Stark gene: SPG21 was added
gene: SPG21 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SPG21 was set to Unknown
Early-onset Dementia v0.0 SPG11 Zornitza Stark gene: SPG11 was added
gene: SPG11 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SPG11 was set to Unknown
Early-onset Dementia v0.0 SPART Zornitza Stark gene: SPART was added
gene: SPART was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SPART was set to Unknown
Early-onset Dementia v0.0 SOD1 Zornitza Stark gene: SOD1 was added
gene: SOD1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SOD1 was set to Unknown
Early-onset Dementia v0.0 SNCB Zornitza Stark gene: SNCB was added
gene: SNCB was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SNCB was set to Unknown
Early-onset Dementia v0.0 SNCA Zornitza Stark gene: SNCA was added
gene: SNCA was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SNCA was set to Unknown
Early-onset Dementia v0.0 SETX Zornitza Stark gene: SETX was added
gene: SETX was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: SETX was set to Unknown
Early-onset Dementia v0.0 PSEN2 Zornitza Stark gene: PSEN2 was added
gene: PSEN2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PSEN2 was set to Unknown
Early-onset Dementia v0.0 PSEN1 Zornitza Stark gene: PSEN1 was added
gene: PSEN1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PSEN1 was set to Unknown
Early-onset Dementia v0.0 PRNP Zornitza Stark gene: PRNP was added
gene: PRNP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PRNP was set to Unknown
Early-onset Dementia v0.0 PRKN Zornitza Stark gene: PRKN was added
gene: PRKN was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PRKN was set to Unknown
Early-onset Dementia v0.0 PLA2G6 Zornitza Stark gene: PLA2G6 was added
gene: PLA2G6 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PLA2G6 was set to Unknown
Early-onset Dementia v0.0 PINK1 Zornitza Stark gene: PINK1 was added
gene: PINK1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PINK1 was set to Unknown
Early-onset Dementia v0.0 PARK7 Zornitza Stark gene: PARK7 was added
gene: PARK7 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PARK7 was set to Unknown
Early-onset Dementia v0.0 PANK2 Zornitza Stark gene: PANK2 was added
gene: PANK2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: PANK2 was set to Unknown
Early-onset Dementia v0.0 OPTN Zornitza Stark gene: OPTN was added
gene: OPTN was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: OPTN was set to Unknown
Early-onset Dementia v0.0 NR4A2 Zornitza Stark gene: NR4A2 was added
gene: NR4A2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: NR4A2 was set to Unknown
Early-onset Dementia v0.0 NPC2 Zornitza Stark gene: NPC2 was added
gene: NPC2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: NPC2 was set to Unknown
Early-onset Dementia v0.0 NPC1 Zornitza Stark gene: NPC1 was added
gene: NPC1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: NPC1 was set to Unknown
Early-onset Dementia v0.0 NOTCH3 Zornitza Stark gene: NOTCH3 was added
gene: NOTCH3 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: NOTCH3 was set to Unknown
Early-onset Dementia v0.0 NHLRC1 Zornitza Stark gene: NHLRC1 was added
gene: NHLRC1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: NHLRC1 was set to Unknown
Early-onset Dementia v0.0 MATR3 Zornitza Stark gene: MATR3 was added
gene: MATR3 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: MATR3 was set to Unknown
Early-onset Dementia v0.0 MAPT Zornitza Stark gene: MAPT was added
gene: MAPT was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: MAPT was set to Unknown
Early-onset Dementia v0.0 LRRK2 Zornitza Stark gene: LRRK2 was added
gene: LRRK2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: LRRK2 was set to Unknown
Early-onset Dementia v0.0 ITM2B Zornitza Stark gene: ITM2B was added
gene: ITM2B was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ITM2B was set to Unknown
Early-onset Dementia v0.0 HTRA2 Zornitza Stark gene: HTRA2 was added
gene: HTRA2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: HTRA2 was set to Unknown
Early-onset Dementia v0.0 GRN Zornitza Stark gene: GRN was added
gene: GRN was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: GRN was set to Unknown
Early-onset Dementia v0.0 GCH1 Zornitza Stark gene: GCH1 was added
gene: GCH1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: GCH1 was set to Unknown
Early-onset Dementia v0.0 GBA Zornitza Stark gene: GBA was added
gene: GBA was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: GBA was set to Unknown
Early-onset Dementia v0.0 FUS Zornitza Stark gene: FUS was added
gene: FUS was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FUS was set to Unknown
Early-onset Dementia v0.0 FTL Zornitza Stark gene: FTL was added
gene: FTL was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FTL was set to Unknown
Early-onset Dementia v0.0 FIG4 Zornitza Stark gene: FIG4 was added
gene: FIG4 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FIG4 was set to Unknown
Early-onset Dementia v0.0 FA2H Zornitza Stark gene: FA2H was added
gene: FA2H was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: FA2H was set to Unknown
Early-onset Dementia v0.0 EPM2A Zornitza Stark gene: EPM2A was added
gene: EPM2A was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: EPM2A was set to Unknown
Early-onset Dementia v0.0 DNMT1 Zornitza Stark gene: DNMT1 was added
gene: DNMT1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DNMT1 was set to Unknown
Early-onset Dementia v0.0 DNAJC5 Zornitza Stark gene: DNAJC5 was added
gene: DNAJC5 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DNAJC5 was set to Unknown
Early-onset Dementia v0.0 DCTN1 Zornitza Stark gene: DCTN1 was added
gene: DCTN1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: DCTN1 was set to Unknown
Early-onset Dementia v0.0 CYP27A1 Zornitza Stark gene: CYP27A1 was added
gene: CYP27A1 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CYP27A1 was set to Unknown
Early-onset Dementia v0.0 CSF1R Zornitza Stark gene: CSF1R was added
gene: CSF1R was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CSF1R was set to Unknown
Early-onset Dementia v0.0 CHMP2B Zornitza Stark gene: CHMP2B was added
gene: CHMP2B was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CHMP2B was set to Unknown
Early-onset Dementia v0.0 CHCHD10 Zornitza Stark gene: CHCHD10 was added
gene: CHCHD10 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: CHCHD10 was set to Unknown
Early-onset Dementia v0.0 C19orf12 Zornitza Stark gene: C19orf12 was added
gene: C19orf12 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: C19orf12 was set to Unknown
Early-onset Dementia v0.0 ATP7B Zornitza Stark gene: ATP7B was added
gene: ATP7B was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ATP7B was set to Unknown
Early-onset Dementia v0.0 ATP13A2 Zornitza Stark gene: ATP13A2 was added
gene: ATP13A2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ATP13A2 was set to Unknown
Early-onset Dementia v0.0 ARSA Zornitza Stark gene: ARSA was added
gene: ARSA was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ARSA was set to Unknown
Early-onset Dementia v0.0 APP Zornitza Stark gene: APP was added
gene: APP was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: APP was set to Unknown
Early-onset Dementia v0.0 APOE Zornitza Stark gene: APOE was added
gene: APOE was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: APOE was set to Unknown
Early-onset Dementia v0.0 ANG Zornitza Stark gene: ANG was added
gene: ANG was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ANG was set to Unknown
Early-onset Dementia v0.0 ALS2 Zornitza Stark gene: ALS2 was added
gene: ALS2 was added to Early-onset Dementia_MGHA_VCGS. Sources: Expert Review Green,Victorian Clinical Genetics Services,Melbourne Genomics Health Alliance Complex Neurology Flagship
Mode of inheritance for gene: ALS2 was set to Unknown
Early-onset Dementia v0.0 Zornitza Stark Added panel Early-onset Dementia_MGHA_VCGS